Pandora Report 12.15.2023

This week covers the FDA’s ongoing investigation into contaminated applesauce, the passing of Gao Yaojie-an activist responsible for bringing to light the extent of China’s AIDS epidemic-, and more.

Biodefense MS Graduates Riley Flynn and Sophie Hirshfield at GMU’s 2023 Winter Commencement Ceremony

FDA Leadership Says Tainted Applesauce Pouches May Have Been Intentionally Contaminated

Cinnamon applesauce pouches available Weis, WanaBanana, and Schnucks have been pulled from shelves after they were found to be contaminated with lead. Dozens of children in the United States have been sickened by the tainted products. Now, the FDA’s Deputy Commissioner for Human Foods, Jim Jones, says they may have been intentionally contaminated.

In an interview with Politico, Jones said “We’re still in the midst of our investigation. But so far all of the signals we’re getting lead to an intentional act on the part of someone in the supply chain and we’re trying to sort of figure that out.” All of the pouches in question were linked to a manufacturing facility in Ecuador that the FDA is currently inspecting.

‘“My instinct is they didn’t think this product was going to end up in a country with a robust regulatory process,” Jones said. “They thought it was going to end up in places that did not have the ability to detect something like this.”’

Politico further explained that “The FDA continues to investigate a number of theories for how the pouches became contaminated, and has not drawn any conclusions about the way the lead was added, why or by whom. The FDA says it currently believes the adulteration is “economically motivated.” That generally refers to ingredients being altered in order to make products appear higher in value, often so companies can produce a cheaper item and sell it at an elevated price.”

“The agency and the Centers for Disease Control and Prevention have collaborated with state and local health authorities as well as Ecuadorian authorities to trace the origin of the cinnamon in the applesauce pouches, which is believed to be the source of the lead contamination. More than 60 U.S. children under the age of 6 have tested positive for lead poisoning after consuming the pouches — some at levels more than 500 times the acceptable threshold for lead, according to The Washington Post.”

Gao Yaojie, Chinese Physician and Self-Exiled AIDS Activist, Dead at 95

Gao Yaojie, a gynecologist and well-known AIDS activist, died on December 10 in New York City. Gao, formerly based in China’s Henan province, was famous for her work to expose the outbreak of HIV/AIDS in the country in the 1990s and 2000s. The outbreak was large in scale and primarily driven by the country’s Plasma Economy, which arose because of restrictions on foreign imports of blood products in the 1990s. This resulted in blood plasma donation becoming a way for rural populations to make money in government-supported plasma donation centers. However, unsafe practices like repeated use of unsterilized needles and pooling multiple donors’ blood during the plasmapheresis allowed HIV to spread widely.

Because of the Chinese government’s efforts to suppress reporting on this epidemic, poor rural populations were left largely unaware of the dangers of plasma donation and the public in general was unaware of the severity of the crisis. Gao was one of the first to speak publicly about the outbreak, helping draw the attention of media outlets. She later told documentary filmmakers about her motivations for doing this, saying, “My driving thought is: how can I save more people from dying of this disease? We each only live one life.”

It is estimated that at least one million Chinese were infected with HIV during this epidemic, highlighting the importance of Gao’s and others’ bravery. For this, she garnered praise from the United Nations, several Western organizations, and even Hillary Clinton. This rising fame led to her being placed under house arrest in 2007, with about 50 police preventing her from traveling to the United States to accept an award recognizing her work. In response to this, she told NPR “I think they feel I got in the way of their political achievements and their official careers…Otherwise, why would they put me under house arrest? What law did I break to warrant mobilizing all these police?”

NPR further explained her activities later in life in their article on her passing, writing: “Despite pressure from Henan provincial authorities to stop publicizing the AIDS crisis, she continued her work, using all the proceeds from her books and pamphlets to support AIDS families, especially children orphaned by the disease or the many suicides that it caused.”

“Restrictions on her movement began hindering in work in China, however, and in 2009, she abruptly fled to the US, after fearing she would be put under house arrest again. Many admirers continued to visit her apartment in West Harlem, including a group of young Chinese students who kept her company in the loneliness of exile.”

‘”Many Chinese regarded her as a hero, and when they came to New York, if they didn’t know how to contact her , [sic] they would ask me. I would ask them for an email written in Chinese and would forward it to her. So far as I know, she always wrote back to those people and welcomed them to come visit,” remembers Andrew Nathan, a political science professor at Columbia University who handled much of Gao’s affairs in New York.”

“The Biological and Toxin Weapons Convention in 2023: Glimmers of Progress Set Against a Troubled Geopolitical Landscape”

Experts at CSR’s Nolan Center, including Biodefense PhD Program alumna and current faculty member Saskia Popescu, recently authored this blog post focused on the BWC’s potential for success in verification, universalization and effective implementation in Africa, and the creation of an International Agency for Biological Safety. They explain in their introduction: “For nearly two decades, efforts to strengthen the Biological and Toxin Weapons Convention (BWC) were in stasis, with opportunities missed and States Parties unable to agree to definite action. States Parties arrived at the Review Conference last year facing a growing biological weapons threat—augmented by rapidly converging complimentary technologies—coupled with a status quo in the BWC that was insufficient for the task. Yet nations drove a breakthrough: the consensus achieved at last year’s Review Conference proved that action is still possible despite the challenging international security environment.”

“In a world in which biological threats and vulnerabilities are exceedingly complex, there is a critical need to reinforce relationships among global experts, national governments, and civil society. Over the past two weeks, these stakeholders have met to identify, examine, and develop specific and effective measures to strengthen the Convention. An unwavering theme throughout the Meeting of States Parties underscored that preparedness and resilience are investments, rather than costs, reinforcing the deterrence by denial efforts CSR continues to promote. Although the challenging international security environment continues to hinder progress there are glimmers of genuine progress across several fronts…”

“Biosecurity in the Americas: Regional Threat Assessment”

A new from UMD’s START, co-authored by Biodefense MS Program alumna Alexandra Williams: “This publication, currently available in Spanish, provides a breadth and depth of focuses as a high-level assessment of the Central and South America regions and introduction to key topics as:

  1. The needed expansion of understanding of the differences and areas of collaboration between the concepts of biosafety and biosecurity,
  2. Existing international obligations to biosecurity through the BWC and UNSC Resolution 1540,
  3. How biosecurity applies to and may differ in application across a variety of facility types that engage in biological research or production, whether private or public laboratories, agricultural or university-based facilities,
  4. Biosecurity risks that include proliferation, bioterrorism, agroterrorism, and biocrime,
  5. The five pillars and mechanisms of biosecurity,
  6. Lastly, the application of biosecurity in the Central and South American regions.”

“NTI|Bio Convenes Workshop on Disincentivizing State Bioweapons Development and Use”

From NTI: “A week ahead of the Biological Weapons Convention (BWC) Working Group meetings in Geneva, Switzerland, NTI | bio convened a workshop on “Disincentivizing State Bioweapons Development and Use.” This two-day workshop on November 29 and 30 brought together academics, diplomats, biosecurity experts, and government policy makers to begin developing a cross-disciplinary thought and practice community to explore and develop potential disincentivizing solutions. Current thinking and policy on disincentivizing bioweapons acquisition and use is underdeveloped—especially by comparison with the nuclear security field.”

‘“We launched this effort because we see the need for more rigorous thinking on effective approaches to making bioweapons unattractive to nation-states,” said NTI | bio Vice President Jaime Yassif. “NTI’s goal is to bridge theory and practical policy-relevant approaches to develop new ideas that can invigorate international efforts to reduce biological threats.”’

Biodefense Graduate Program Director Gregory Koblentz and Associate Professor Sonia Ben Ouagrham-Gormley both participated in this workshop. Read more about it here.

“Great Powers and the Norms of the BW Prohibition Regime”

A new working paper from CBWNet: “The United States of America and the Soviet Union were instrumental in creating the biological weapons prohibition regime more than 50 years ago. This has left the regime with a big gap in its normative structure related to the verification of treaty compliance. The working paper by Alexander Kelle and Eva Siegmann analyses great power involvement in several areas of regime implementation and concludes that none of the great powers, including China, has supported the addition of declaration and inspection norms. While recent US and Chinese initiatives could still lead to a strengthening of the regime in different areas, Russian policies, most notably false accusations against the US and others, threaten to undermine the regime.”

“AI and Biorisk: An Explainer”

A new explainer from Georgetown’s CSET: “Recent government directives, international conferences, and media headlines reflect growing concern that artificial intelligence could exacerbate biological threats. When it comes to biorisk, AI tools are cited as enablers that lower information barriers, enhance novel biothreat design, or otherwise increase a malicious actor’s capabilities. In this explainer, CSET Biorisk Research Fellow Steph Batalis summarizes the state of the biorisk landscape with and without AI.”

“Bio X AI: Policy Recommendations For A New Frontier”

Jeffrey et al. discuss the work of the Federation of American Scientists’ Bio x AI Policy Development Sprint in this piece, explaining in their introduction: “Artificial intelligence (AI) is likely to yield tremendous advances in our basic understanding of biological systems, as well as significant benefits for health, agriculture, and the broader bioeconomy. However, AI tools, if misused or developed irresponsibly, can also pose risks to biosecurity. The landscape of biosecurity risks related to AI is complex and rapidly changing, and understanding the range of issues requires diverse perspectives and expertise. To better understand and address these challenges, FAS initiated the Bio x AI Policy Development Sprint to solicit creative recommendations from subject matter experts in the life sciences, biosecurity, and governance of emerging technologies. Through a competitive selection process, FAS identified six promising ideas and, over the course of seven weeks, worked closely with the authors to develop them into the recommendations included here. These recommendations cover a diverse range of topics to match the diversity of challenges that AI poses in the life sciences. We believe that these will help inform policy development on these topics, including the work of the National Security Commission on Emerging Biotechnologies.”

“Push to Improve Biosecurity in the Age of Genetic Engineering”

Wilmot James recently authored this opinion piece for Business Day, explaining in part “The possibility of using AI to develop bioweapons raises additional concerns, and remains uncharted territory. While the intersection of AI and biotechnology holds immense potential for positive applications in healthcare, research and diagnostics, it also poses risks if misused. AI algorithms could be employed to analyse vast genetic data sets and identify specific sequences for manipulation. This could accelerate the process of genetic engineering, allowing for the creation of more efficient and potentially harmful pathogens…To safeguard against such threats, multilateral and public-private sector agreements and regulations to govern the ethical use of AI in science, emphasising the prohibition of bioweapon development, should be established, with strong oversight committees responsible for assessing the ethical implications at the intersection of AI and biotechnology. These committees should include experts in AI, virology, bioethics and global health security.”

“Sounding the Alarm on Anti-Science”

Margaret Winchester provides background and overview of Peter Hotez’s latest book-The Deadly Rise of Anti-Science-in this piece for Health Affairs: “In his book, The Deadly Rise of Anti-Science, Hotez, professor and dean of the National School of Tropical Medicine at Baylor College of Medicine, and co-director of the Center for Vaccine Development at Texas Children’s Hospital, paints a bleak picture of public science denial during the pandemic, embedded in historic context. He tells the story of systematic anti-science efforts from his view in the trenches—and as a personal target for anti-science activists. This book, and his commentary in our December issue of Health Affairs on global lessons from COVID-19, highlight the very real effects of this movement, including lives lost, undermined public health efforts, foregone vaccinations, social schisms, and more, that will be felt for generations to come. As he writes, “anti-science now kills more Americans than global terrorism, or other deadly societal forces and social determinants.” Drawing from multiple sources, he estimates that approximately 200,000 people needlessly died in the US after COVID-19 vaccines became widely available.”

EU vs Disinfo Disinformation Review

The most recent edition of EU vs Disinfo’s Disinformation Review is now available and features multiple sections focused on Russia’s continued use of alleged US biological weapons laboratories as a bogeyman. Be sure to check it out for fantastic lines such as “If the only tool that you have is a hammer, everything looks like a biolab,” and “At a staged event, Putin mumbled out an announcement to veterans and the wider public that his regime would continue to rule over Russia after an orchestrated ritual not to be confused with an event known as an ‘election’ in the free world.”

2023 State of the Bioeconomy

From BIOISAC: “We have a lot to celebrate as we close 2023 and just over 12 months since the Executive Order calling for a safe, secure bioeconomy. Join us as we recap the activity, publications, outcomes, and – we will of course share a glimpse of the “behind the scenes” conversations from our 3 regional events and our one-day “Closing the Knowledge Gaps” event, our two-day table top training and the resulting “Going Viral: Bioeconomy Defense TTX” report, and, of course, the industry-demanded outputs from our hardware/software device security workgroup report and supplements, “Fortifying the Bioeconomy” as well as the Bioeconomy Security Questionnaire and Instrument Disposal Guide. We also have a lot left to do! We plan to share a few of our goals for 2024 and our upcoming regional events schedule.”

“Join us December 19th at 2pm Eastern-US for a live discussion.” Register here.

Presidential Advisory Council on Combating Antibiotic-Resistant Bacteria (PACCARB) Virtual Meeting

“The Presidential Advisory Council on Combating Antibiotic-Resistant Bacteria (PACCARB) provides advice, information, and recommendations to the U.S. Secretary of Health and Human Services (HHS Secretary). The council supports and evaluates U.S. government activities focused on fighting antimicrobial resistance (AMR) in human health, animal health, and environmental health. Using this One Health approach, members of the PACCARB have expertise from a range of backgrounds, including academia, industry, public health, advocacy, veterinary, and agricultural production.”

“The PACCARB was established under Executive Order 13676 and included in the Pandemic and All-Hazards Preparedness and Advancing Innovation Act of 2019 (PAHPAIA). Since 2019, the President has given authority to the HHS Secretary as the primary recipient of PACCARB recommendations. Additional information on the authority and activities of the PACCARB can be found on the About Us page in the charter.”

“As a federal advisory committee, the PACCARB looks to engage with the public and all AMR stakeholders. The council holds several public meetings every year both in-person and live streamed on the HHS.gov website. These meetings are open to anyone with an interest in combating AMR. See how to get involved!”

This virtual meeting will take place on December 20 from 9-4 EST. Learn more here.

61st ISODARCO Course: Nuclear Order and International Security after Ukraine

“The war in Ukraine has had an enormous impact on global security, reviving nuclear fears, undermining the prospects for arms control, and shattering many of the norms and constraints that were the foundation of European security.  ISODARCO 2024 will examine the global nuclear order in light of the Ukraine war, focusing on the states, the policies and the technologies that will shape the future in a much more difficult environment.  How will we cope with this more dangerous world?”

This course will take place January 7-14, 2024, at the University of Trento. Learn more and register here.

International Conference, CBRNE Research & Innovation

“The last 40 years have demonstrated that both military and civilian populations could be exposed to highly hazardous CBRNE agents following conflicts, natural outbreaks and disasters, industrial incidents or terrorist attacks.”

“Worldwide, researchers, responders and industrial capacities have been commited to provide adapted response to these challenges.”

“Building on the success of the first 5 International Conferences « CBRNE Research and Innovation » which took place in Antibes (2015), Lyon (2017), Nantes (2019), on line (2021) and Lille (2022), we want to give you a new opportunity to build up or strengthen collaborative networks in Strabourg (March 19th – 21rst 2024).”

“The CBRNE R&I Conference is specifically devoted to scientific updates, responders’ feedbacks and expression of needs. It also includes workshops and demonstrations of innovative materials, technologies and procedures, according to the following themes: DETECTION – IDENTIFICATION, PROTECTION – DECONTAMINATION, MEDICAL COUNTERMEASURES, RISKS & CRISIS MANAGEMENT.”

“Looking forward to your proposals for communication and to welcoming you at Strasbourg in March 2024!”

Learn more here.

Registration for GHS 2024 Now Open

Registration is now open for the Global Health Security 2024 conference in Sydney, Australia. This iteration will take place 18-21 June, 2024. The call for abstracts is also still open. “The mission of the Global Health Security conference is to provide a forum where leaders, researchers, policy-makers, and representatives from government, international organisations, civil society, and private industry from around the world can engage with each other, review the latest research and policy innovations, and agree solutions for making the world safer and healthier. To that end, our mission is to help foster a genuinely multidisciplinary community of practice that is committed to working collaboratively to enhance global health security and eliminate disease, irrespective of its origin or source.”

WHO Announces Proposed Members of Technical Advisory Group on Response Use of the Life Sciences and Dual-Use Research

The WHO recently announced its proposed membership of its Technical Advisory Group on Responsible use of the life sciences and dual-use research (TAG-RULS DUR). According to WHO, “As per WHO processes, there will be now a two-week public consultation period for WHO to receive feedback on the proposed TAG-RULS DUR members and set in place the modalities for the TAG-RULS DUR’s first meeting, which is planned to take place following this consultation period…The final membership to the TAG-RULS DUR is subject to the above-mentioned public consultation period and relevant WHO practices and procedures.”

The proposed membership and instructions for providing commentary on the individuals included are both available here.

Vote: 2023 Arms Control Person(s) of the Year Nominees

“Since 2007, the independent, nongovernmental Arms Control Association has nominated individuals and institutions that have, in the previous 12 months, advanced effective arms control, nonproliferation, and disarmament solutions and raised awareness of the threats posed by mass casualty weapons.”

“In a field that is often focused on grave threats and negative developments, the Arms Control Person(s) of the Year contest aims to highlight several positive initiatives—some at the grassroots level, some on the international scale—designed to advance disarmament, nuclear security, and international peace, security, and justice.”

Voting will take place between Dec. 8, 2023, and Jan. 11, 2024. The results will be announced on Jan. 12, 2024. Follow the discussion on social media using the hashtag #ACPOY2023.”

Learn about the nominees and vote here.

Pandora Report 12.08.2023

This week includes coverage of updates to Japan’s End User List, the Taliban’s newly declared war on polio, Biomemory’s $1k DNA storage cards, new publications, upcoming events, and more.

Japan Revises End User List, Includes 101 Chinese Organizations and Institutions

Japan’s Ministry of Economy, Trade, and Industry has revised the country’s End User List, which provides “…exporters with information on foreign entities for which concern cannot be eliminated regarding involvement in activities such as the development of weapons of mass destruction (WMDs) and other items, for the purpose of enhancing the effectiveness of the catch-all control on cargos and other loads relating to WMDs and other items.”

The updated list, which takes effect on Monday, now includes 706 organizations in 15 countries and regions, according to Nikkei. This is an increase of 36 over last year’s list and, notably, it includes the China Academy of Engineering Physics (CAEP)-the main center for Chinese research on and manufacturing of nuclear weapons. Seven total Chinese entities were added to the list, about 90% of which are thought to be involved in missile development. Nikkei notes that “Many universities, academies and research institutes are also listed, which reveals the extent of Xi Jinping’s Military-Civilian Fusion policy. Machine tools produced by Japanese companies and others are suspected of being used by the CAEP, according to a Nikkei investigation.”

223 Iranian organizations and institutions are on the list, in addition to 153 North Korean ones, and 101 each from China and Pakistan. Nikkei further explains that “Japan aims to prevent the outflow of civilian technology that could be diverted to military use. Exporters are required to get approval from the Minister of Economy, Trade and Industry to export products to the listed organizations unless it is clear that the materials will not be used to develop WMDs such as nuclear weapons or missiles.”

“The economy ministry makes the list to enhance the effectiveness of its “catch-all” control system, which obliges exporters to apply for an export license for goods that may be used for the development of WMDs even if the goods are not subject to export restrictions under international agreements. The list has been issued since catch-all controls were introduced in April 2002 and is revised about once a year. It is not an embargo list.”

Taliban Announces Polio Eradication Campaign

Naturally acquired polio remains endemic in just two countries today- Afghanistan and Pakistan- in part because, as Radio Azadi explains, “Islamic militants often target polio-vaccination teams, falsely claiming the vaccination campaigns are a Western conspiracy to sterilize children.” During its 20-year struggle to regain power, the Taliban often banned door-to-door vaccination efforts. In 2021, nationwide door-to-door polio vaccinations were allowed to resume after the Taliban and the United Nations/World Health Organization reached an agreement.

Now, as explained by a recent article in The Washington Post, the Taliban is “declaring war” on polio in an apparent complete reversal of its previous stance. The article explains “Vaccinators in the country’s northeast, the center of the poliovirus outbreak, search cars for unvaccinated children at roadside checkpoints manned by Taliban soldiers. With no deadly attacks on public health campaigners reported in Afghanistan this year, they also feel increasingly comfortable venturing into remote virus hot spots that were previously far beyond their reach.”

The country’s health ministry announced the continuation of its annual polio vaccination campaign in March of this year, marking the second year the program has continued to operate under the Taliban’s rule. The ministry indicated it aimed to reach approximately 9 million children with the campaign, as Afghanistan and neighboring Pakistan continue to struggle with endemic polio due in large part to accessibility difficulties, displacement, regional instability, and concerns about external interference. Pakistan suspended its anti-polio drive in multiple districts this year after police escorting vaccination teams were repeatedly attacked.

French Start-Up Announces Sales of DNA Storage Cards, BIO-ISAC Joins DNA Data Storage Alliance Amid Growing Interest, Concerns

Multiple news outlets have covered the French start-up Biomemory‘s release of $1,000 pairs of DNA cards that promise a “minimum” 150-year lifespan of data storage. The Verge’s Emma Roth explains “DNA has emerged as a theoretical alternative to hard drives, SSDs, and other forms of digital data storage, namely because of its impressive lifespan. Science estimates the technology could potentially last hundreds of thousands of years if stored in a cool, dry environment. That’s a heck of a lot longer than the lifespan of your average hard drive, which typically tops out at around five years.”

However, Biomemory’s cards currently offer just one kilobyte of storage, or about one email according to Wired. The data stored on the card is retrieved by mailing the cards to Eurofins Genomics, who then return the stored information using strings of DNA’s nucleotide bases-adenine (A), cytosine (C), guanine (G) and thymine (T). Users can then use Biomemory’s DNA translation feature to decode the stored information. The card is not returned afterward. The company expects to begin shipping orders from its waitlist in January.

‘”The launch of our DNA Cards represents a significant milestone in the evolution of data storage technology,” Erfane Arwani, CEO of Biomemory, said about the pioneering development. “After years of talk about the potential of molecular computing, we are incredibly proud to bring the first DNA data storage product to market, that not only pushes the boundaries of innovation but also aligns with our commitment to environmental sustainability and efficiency.”‘

This news has coincided with the announcement that the Bioeconomy Information Sharing and Analysis Center, an international organization that aims to address threats unique to the bioeconomy, has joined the DNA Data Storage Alliance. The organization explained in a statement: “This year BIO-ISAC created the Genomic Data Workgroup, informing the National Cybersecurity Center of Excellence at National Institute of Standards and Technology efforts to launch the Cybersecurity Framework Profile for Genomic Data and the forthcoming text on the Privacy Framework Profile for Genomic Data. Prioritizing workgroup efforts to apply and implement this work, BIO-ISAC pursued membership and presentation opportunities with aligned organizations and audiences.”

“Today, BIO-ISAC joins more than 40 members of the DNA Data Storage Alliance, in hopes of creating a future with safe, secure data storage systems and processes for genetic data at all stages of its lifecycle.”

“Founded in 2020, the DNA Data Storage Alliance was built to create and promote an interoperable storage ecosystem based on DNA as a data storage medium. The organization seeks to educate the public and raise awareness about this emerging technology and its vast power to preserve our digital legacy. As the methods of commercially viable DNA storage become better understood, the Alliance will consider recommending the creation of specifications and standards (e.g., encoding, reliability, retention, file systems) which enable end-users to add interoperable DNA-based storage solutions to their existing storage hierarchies.”

On a more fun note, Biomemory’s homepage does include a DNA Translate feature at the bottom which shows users how lines of text may be converted to strings of As, Cs, Gs, and Ts, so we tested it out: AGAGAGACAGTCTCACAGTCAGAGACTCACACAGAGACACAGTCACAGAGTCTGTCAGTCAGACAGTCTGTGAGTGACTCAGTCACAGACTCACACAGAGACTCAGTCAGAGAGTGACACAGTCTGTGAGTGACTCAGTGAGACACTCACACAGTCTCAGAGTGACTGACTCACACAGTGAGACAGTCTCACAGTCAGAGACTCACACAGTCACTCAGTCAGAGAGTGACTGAGTGAGACACTCACACAGTCTGTCAGTCAGAGAGTGCCGAAGTGACTGAGTCTGACAGTCAGAGAGTGAGACAGTGAGACAGTCAGAGAGTGACTCCCGAACAG

The page lacks a feature allowing users to translate their string of nucleotide bases back to regular text, so take our word for it: The Pandora Report is the best newsletter!

WHO Weekly Epidemiological Record One Health-Focused Issue

“The Weekly Epidemiological Record (WER) serves as an essential instrument for the rapid and accurate dissemination of epidemiological information on cases and outbreaks of diseases under the International Health Regulations and on other communicable diseases of public health importance, including emerging or re-emerging infections.”

The most recent issue is focused on One Health and includes pieces on incorporating One Health into the international political agenda, the Collaboration on One Health between WHO, FAO, WOAH, and UNEP, and more.

“Henry Kissinger Supported Wars and Coups. He Also Played a Little-Known Role in Eliminating Bioweapons”

Matt Field recently authored this piece about the late Henry Kissinger in The Bulletin of the Atomic Scientists, writing in part: “By the late 1960s, incidents with chemical weapons—including an accident with VX nerve agent in Utah that killed some 6,000 sheep—had focused Congress’s attention on the US chemical and biological warfare operation. Internationally, there were efforts to begin arms control negotiations around these weapons of mass destruction. And Kissinger led internal government deliberations over what to do with the US program. At one point, according to Tucker and Mahan, Kissinger, unhappy with a policy paper that contained both arguments in favor and against retaining biological weapons, produced his own paper that cut the points in favor of the offensive program. He included his personal recommendation to restrict the US program to biological defense, which involves the development of countermeasures such as vaccines.”

“Insights from BARDA Industry Day 2023”

Tanima Sinha, Director of Life Science Product Development and Government Contracts at the Biomedical Advanced Research and Development Authority (BARDA), recently authored this post covering BARDA Industry Day 2023 and upcoming insights from the conference that will be made available. She explains in part, “Here we will take a quick glimpse at ASPR (Administration for Strategic Preparedness and Response) and BARDA’s programs to enhance the nation’s biomedical industrial base and supply chain capacity. The COVID-19 pandemic brought to light the inadequate availability of essential medical needs. In response to these deficiencies, the USG/ HHS (Health and Human Services) (Health and Human Services) is expanding the public health industrial base through innovative solutions.”

Fortifying the Bioeconomy

From BIO-ISAC: “Standardizing tools for assessing, remediating, and disposing of hardware and software instruments has been a recurring problem in our sector, reducing our ability to operate in a safe, secure way. Earlier this year, BIO-ISAC took action to address this need.”
Fortifying the Bioeconomy, an in-depth resource about shared responsibility in hardware and software lifecycle management, is now available. This resource includes additional materials including a standardized vendor questionnaire and  an instrument disposal guide.”

“We hope these materials guide industry and offer us a safe, secure path forward for our nation’s labs, biomanufacturers, growers, and innovators.”

Access here.

“Country Reports on Terrorism 2022”

Country Reports on Terrorism 2022 is submitted in compliance with Title 22 of the United States Code, Section 2656f (the “Act”), which requires the Department of State to provide to Congress a full and complete annual report on terrorism for those countries and groups meeting the criteria of the Act.”

This report includes “Chapter 3 — The Global Challenge of Chemical, Biological, Radiological, or Nuclear Terrorism,” explaining the status of CBRN materials and expertise as terrorist threats and the United States’ efforts to counter them in 2022.

“New Information Tool on Nuclear Weapons Seeks to Identify the Next Arms Control Strategies”

Andrew Facini recently authored this piece for The Bulletin of the Atomic Scientists discussing the Council on Strategic Risks’ recently-launched Nuclear Weapons System Project. He explains, “For those of us seeking to cultivate nuclear policies geared toward enhancing strategic stability, the current trend reflects a worrying loss of perspective—a forgetting of the hard-earned lessons of the Cold War. To help put today’s trends in their historical context, a team of the Council on Strategic Risks (CSR) developed a new visualization tool and information system that maps every type of nuclear weapon fielded by the five nuclear weapons states (P5) under the Nuclear Non-Proliferation Treaty (NPT)—China, France, Russia, the United Kingdom, and the United States—from their inception to present day.”

What We’re Listening To 🎧

Technologically Speaking Podcast Ep. 6, Science is Messy

New from the Department of Homeland Security: “Host John Verrico sits down with Dr. Nick Bergman, director of S&T’s National Biodefense Analysis and Countermeasures Center (NBACC). Dr. Bergman is a bit of a germaphobe, but it’s hard not to be when you run a Biosecurity Level 4 lab that studies pathogens for which no vaccine or treatment exists. Hear an insider’s perspective of the COVID pandemic, find out how NBACC regularly helps the FBI, and meet a guy living a “pretty typical life” of helping save us all from superbugs.”

Listen here.

What We’re Watching🍿

Biosecurity

New from the Dutch Ministry of Health, Welfare and Sport: “This film provides an introduction into eight pillars of good practice for biosecurity, that are important when implementing biosecurity control measures.”

“These control measures are necessary to protect high-risk biological materials against theft or misuse by malicious parties.”

“The biosecurity aspects in these eight pillars of good practice are explained, which can help you to implement biosecurity within your organisation. This film is focussed on organisations that work with high risk biological materials.”

The short film is available in Dutch, English, and English with Russian subtitles.

Mitigating Arboviral Threats and Strengthening Public Health Preparedness

“Arboviruses are a broad group of viruses that are spread by arthropods, such as ticks and mosquitoes. Diseases caused by arboviruses, like dengue, chikungunya, Zika, and yellow fever, present a significant public health burden and threaten billions of people worldwide. Despite the global recognition of the devastating health and economic impacts of these diseases, the need persists for improved integration of mitigation efforts into public health systems and environmental and urban planning.”

“The National Academies Forum on Microbial Threats will conduct a two-day workshop that will identify lessons learned from previous outbreaks, outline current arbovirus surveillance capacities, and describe novel approaches to arbovirus mitigation. The workshop will include perspectives from researchers, public health practitioners, and environmental management experts from across the globe.”

This event will take place on December 12 and 13. Learn more here.

Presidential Advisory Council on Combating Antibiotic-Resistant Bacteria (PACCARB) Virtual Meeting

“The Presidential Advisory Council on Combating Antibiotic-Resistant Bacteria (PACCARB) provides advice, information, and recommendations to the U.S. Secretary of Health and Human Services (HHS Secretary). The council supports and evaluates U.S. government activities focused on fighting antimicrobial resistance (AMR) in human health, animal health, and environmental health. Using this One Health approach, members of the PACCARB have expertise from a range of backgrounds, including academia, industry, public health, advocacy, veterinary, and agricultural production.”

“The PACCARB was established under Executive Order 13676 and included in the Pandemic and All-Hazards Preparedness and Advancing Innovation Act of 2019 (PAHPAIA). Since 2019, the President has given authority to the HHS Secretary as the primary recipient of PACCARB recommendations. Additional information on the authority and activities of the PACCARB can be found on the About Us page in the charter.”

“As a federal advisory committee, the PACCARB looks to engage with the public and all AMR stakeholders. The council holds several public meetings every year both in-person and live streamed on the HHS.gov website. These meetings are open to anyone with an interest in combating AMR. See how to get involved!”

This virtual meeting will take place on December 20 from 9-4 EST. Learn more here.

61st ISODARCO Course: Nuclear Order and International Security after Ukraine

“The war in Ukraine has had an enormous impact on global security, reviving nuclear fears, undermining the prospects for arms control, and shattering many of the norms and constraints that were the foundation of European security.  ISODARCO 2024 will examine the global nuclear order in light of the Ukraine war, focusing on the states, the policies and the technologies that will shape the future in a much more difficult environment.  How will we cope with this more dangerous world?”

This course will take place January 7-14, 2024, at the University of Trento. Learn more and register here.

International Conference, CBRNE Research & Innovation

“The last 40 years have demonstrated that both military and civilian populations could be exposed to highly hazardous CBRNE agents following conflicts, natural outbreaks and disasters, industrial incidents or terrorist attacks.”

“Worldwide, researchers, responders and industrial capacities have been commited to provide adapted response to these challenges.”

“Building on the success of the first 5 International Conferences « CBRNE Research and Innovation » which took place in Antibes (2015), Lyon (2017), Nantes (2019), on line (2021) and Lille (2022), we want to give you a new opportunity to build up or strengthen collaborative networks in Strabourg (March 19th – 21rst 2024).”

“The CBRNE R&I Conference is specifically devoted to scientific updates, responders’ feedbacks and expression of needs. It also includes workshops and demonstrations of innovative materials, technologies and procedures, according to the following themes: DETECTION – IDENTIFICATION, PROTECTION – DECONTAMINATION, MEDICAL COUNTERMEASURES, RISKS & CRISIS MANAGEMENT.”

“Looking forward to your proposals for communication and to welcoming you at Strasbourg in March 2024!”

Learn more here.

Registration for GHS 2024 Now Open

Registration is now open for the Global Health Security 2024 conference in Sydney, Australia. This iteration will take place 18-21 June, 2024. The call for abstracts is also still open. “The mission of the Global Health Security conference is to provide a forum where leaders, researchers, policy-makers, and representatives from government, international organisations, civil society, and private industry from around the world can engage with each other, review the latest research and policy innovations, and agree solutions for making the world safer and healthier. To that end, our mission is to help foster a genuinely multidisciplinary community of practice that is committed to working collaboratively to enhance global health security and eliminate disease, irrespective of its origin or source.”

“Biodefense Budget Breakdown: Data Visualization of U.S. Biodefense Investments”

New from Council on Strategic Risks: “In recent years, U.S. strategies and policies have advanced greatly in addressing biological risks from all sources. We at CSR have marked several areas of progress through writings and analysis: the beginning of a pivot toward pathogen-agnostic approaches, requiring annual exercises on biological risks, and the creation of the Biodefense Council within the Department of Defense, and more…In September, CSR launched a scorecard process to track signs of implementation of stronger U.S. biodefense and biosecurity policies. CSR’s Biodefense Budget Breakdown will accompany the scorecard, tracking trends in resources and investments.”

“Before the launch of this tool, no publicly-accessible resource provided a detailed analysis of the total budget across the federal biodefense enterprise. By creating the Biodefense Budget Breakdown, we hope to provide a robust and user-friendly resource for the government, key stakeholders, and the general public.”

“This tool is intended to provide focused analyses of the biodefense budget, with multiple interfaces to understand and analyze the federal biodefense portfolio. This tool starts with the cumulative U.S. biodefense totals for each fiscal year dating back to 2019, progresses to agency-specific drill-downs, and culminates with a detailed line item index for biodefense budgets across key agencies. This tool reports biodefense investments across three steps in the budget cycle: requested (R), enacted (E), and actual (A) levels of funding.”

Call for Applications: Ecological Security Fellowship

“The Council on Strategic Risks is pleased to announce a call for applications for its Ecological Security Fellowship, a key part of its broader Ecological Security Program.”

“Tackling complex, converging risks arising from ecological degradation requires the development of resilient leaders spanning international, national, state, and local levels. This program will familiarize participants with novel ways of conceptualizing the security risks posed by ecological disruption driven by human activities, climate change, and other stressors. Participants will acquire expertise and build professional development through networking with experts and practitioners in different areas of ecological security.”

Learn more and apply here.

Pandora Report 12.01.2023

This week covers a wide range of topics, including chemical weapons, indictments for those involved in running the illegal laboratory in Reedley, CA, and more. Several new publications follow, as well new upcoming events and newly-available resources in the announcement section.

George Mason University’s Biomedical Laboratory Receives $12 Million in Funding from NIH

From GMU: “Farhang Alem, Interim Director of the Biomedical Research Laboratory, Institute for Biohealth Innovation, and Aarthi Narayanan, Professor, Biology, will receive more than $12 million from the National Institute for Health to support development of Mason’s Biomedical Research Laboratory, advancing the university’s research capabilities for infectious diseases.”

“George Mason University’s Biomedical Laboratory (BRL) is one of 12 Regional Biocontainment Laboratories (RBLs) established through the National Institute of Allergy and Infectious Diseases. The BRL offers Biosafety Level 3 (BSL-3) facilities that conduct cutting edge pathogen research and serve as resources to rapidly address emerging infectious disease outbreaks.”

“Funding will support a number of facility improvements including the implementation of a comprehensive BSL-3 facilities preventative maintenance and upgrade plan to ensure continuity of operations, compliance with federal regulations, and a safe and secure facility. Funding will also enhance safety and quality of BSL-3 laboratory practices and create two new research cores in high containment.”

Read more here.

DOD Chemical and Biological Defense Program Celebrates 30th Anniversary

The Department of Defense recently reached the 30-year anniversary of the formation of its Chemical and Biological Defense Program. “Congress created the DOD wide chemical and biological defense program in November 1993, after a government report noted U.S. forces were not sufficiently prepared to address Iraq’s chemical and biological warfare capabilities…Prior to the creation of the program under the Office of the Secretary of Defense, the military services were each responsible for developing their own chemical and biological defense capabilities.” 

Read more about the program here.

OPCW Adopts Measures Aimed at Ensuring Compliance with CW Ban in Syria and Elsewhere

The OPCW announced the adoption of new measures aimed at addressing non-compliance with the CWC yesterday, the Day of Remembrance for all Victims of Chemical Warfare. In a statement, the OPCW explained: “The Twenty-Eighth Session of the Conference of the States Parties to the Chemical Weapons Convention (CWC) today adopted a decision titled “Addressing the Threat from Chemical Weapons Use and the Threat of Future Use”, brought forward by 48 countries.”

“The Conference decided that the continued possession and use of chemical weapons by the Syrian Arab Republic, and its failures to submit an accurate and complete declaration and to destroy all its undeclared chemical weapons and production facilities, have caused serious damage to the object and purpose of the Chemical Weapons Convention.”

“In adopting the decision, States Parties condemned “in the strongest possible terms the use of chemical weapons by anyone, under any circumstances, emphasising that any use of chemical weapons anywhere, at any time, by anyone, and under any circumstances is unacceptable and contravenes international norms and standards”. States Parties reaffirmed their determination to continue to take action to address threats related to chemical weapons in Syria and elsewhere.”

“Today’s decision seeks to implement for the first time Paragraph 3 of Article XII of the Convention, which refers to measures States Parties can take in order to ensure compliance.”

Read more here.

Syrian Network for Human Rights Statement On the Day of Remembrance For All Victims of Chemical Warfare

The Syrian Network for Human Rights released its statement yesterday on the Day of Remembrance for all Victims of Chemical Warfare, highlighting CW attacks perpetrated by the Assad regime and the ongoing struggle for victims to hold the regime accountable. The statement is available below.

2023 OPCW-The Hague Award Recipients Announced

OPCW Director-General Amb. Fernando Arias and the Mayor of the Municipality of The Hague, Mr. Jan van Zanen, announced last week the three recipients of the 2023 OPCW-The Hague Award. These recipients are the Spiez Laboratory in Switzerland, Dr. Syeda Sultana Razia at the Bangladesh University of Engineering and Technology, and Mr. Hubert K. Foy at the African Centre for Science and International Security in Ghana.

‘“All three of these recipients have demonstrated that everyone has a role to play in ridding the world of chemical weapons and preventing their re-emergence,” said OPCW Director-General, Ambassador Fernando Arias. “We must together strive to continue to ensure that toxic chemicals are never used as instruments of harm and that our populations are protected.”’

Read more about the recipients and their work here.

NTI, NextGen, iGEM, SynBio Africa, GHSN, and 80,000 Hours Announce Winners of 7th Annual Next Generation for Biosecurity Competition

The winners of the Seventh Annual Next Generation for Biosecurity Competition were recently announced. They are Gupreet Dhaliwal, Ph.D. candidate in Synthetic Biology and Immunology at the University of Cambridge, Askar Kleefeldt, Ph.D. candidate in Synthetic Biology at the MRC Laboratory of Molecular Biology and the University of Cambridge, and Alexandra Klein, Ph.D. candidate in Science, Technology, Engineering and Public Policy at the University College London and research assistant at the Centre for the Study of Existential Risk, University of Cambridge.

“In their winning paper, Biosecurity-By-Design to Safeguard Emerging Bioeconomies: Integrating Biosecurity Considerations into the Full Biotechnology Innovation and Development Pipeline, the team proposes a ‘biosecurity-by-design’ approach to ensure that biosecurity is integrated into every stage of the life science research and development pipeline, especially project conceptualization. The three authors outline a set of recommendations to achieve this goal, including fostering a culture of responsibility among scientific communities through the adoption of the Tianjin Biosecurity Guidelines for Codes of Conduct for Scientists as a global standard in emerging bioeconomies. The authors emphasize the importance of engaging with the private sector and encourage governments to incentivize biosecurity in product design by using levers such as market access regulations or reputational rewards through seals of approval. The authors also propose that States Parties at the Biological Weapons Convention adopt a systematic review mechanism for science and technology to raise awareness of emerging biotechnology risks. Overall, these recommendations aim to make biosecurity an integral part of biotechnology innovation while allowing the bioeconomy to flourish.”

Read more here.

No Cost COVID-19 Tests Available in United States Again

The US Government is once more offering four at-home viral tests delivered via the US Postal Service. Those who did not order any in September can order up to eight of them during this round. Order tests at COVIDtests.gov.

ICYMI: Select Committee on the CCP Releases Report on Reedley Lab, DOJ Announces Indictment of Operator

Last month “Chairman Mike Gallagher (R-WI) of the House Select Committee on the Chinese Communist Party unveiled a report on its investigation into the illegal People’s Republic of China-tied biolab discovered in Reedley, CA. The members were joined by Rep. Jim Costa (D-CA), whose district includes Reedley, CA, Former Speaker Kevin McCarthy (R-CA), Rep. Dan Newhouse (R-WA), and Rep. Neal Dunn (R-FL).”

According to the report, the Committee’s main findings were:

  • “The illegal biolab was run by a PRC citizen who is a wanted fugitive from Canada with a $330 million Canadian dollar judgment against him for stealing American intellectual property.
  • This PRC citizen was a top official at a PRC-state-controlled company and had links to military-civil fusion entities.
  • The illegal biolab received millions of dollars in unexplained payments from PRC banks while running the illegal biolab.
  • The illegal biolab contained thousands of samples of labeled, unlabeled, and encoded potential pathogens, including HIV, malaria, tuberculosis, and Covid.
  • The illegal biolab also contained a freezer labeled “Ebola,” which contained unlabeled, sealed silver bags consistent with how the lab stored high risk biological materials. Ebola is a Select Agent with a lethality rate between 25-90%.
  • The biolab contained nearly a thousand transgenic mice, genetically engineered to mimic the human immune system. Lab workers said that the mice were designed “to catch and carry the COVID-19 virus.”
  • After local officials who discovered the lab sought help from the CDC and others, the CDC refused to test any of the samples.” 

Meanwhile, the Department of Justice announced a three-count indictment against operators of the lab, saying in a press statement “A federal grand jury returned a three-count indictment today against Jia Bei Zhu, aka Jesse Zhu, Qiang He, and David He, 62, a citizen of China who formerly resided in Clovis, charging him with distributing adulterated and misbranded medical devices in violation of the federal Food, Drug, and Cosmetic Act and for making false statements to the Food and Drug Administration (FDA), U.S. Attorney Phillip A. Talbert announced.”

“According to court documents, between January 2020 and March 2023, through the companies Universal Meditech Incorporated (UMI) and Prestige Biotech Incorporated (PBI), Zhu sold hundreds of thousands of COVID-19 test kits to companies throughout the United States. UMI and PBI were based in Fresno and Reedley and did not obtain pre-market approval, pre-market clearance, emergency use authorization, or other applicable exemption from the FDA as was required. UMI and PBI received millions of dollars for the sales of the test kits.”

“When questioned by FDA officials, Zhu made several false statements to them, including that (1) his name was Qiang “David” He, (2) he was hired by UMI as a COVID-19 consultant in 2021, (3) he was hired by PBI just a couple of weeks prior to meeting with the FDA to communicate with government agencies on PBI’s behalf, and (4) he did not know anything about the manufacturing or distribution histories for UMI or PBI.”

“This case is the product of an investigation by the FDA Office of Criminal Investigations with assistance from the Federal Bureau of Investigation and the California Department of Public Health – Food and Drug Branch. Assistant U.S. Attorneys Joseph D. Barton, Arelis M. Clemente, and Henry Z. Carbajal III are prosecuting this case.”

“Why AI-Assisted Bioterrorism Became a Top Concern for Open AI and Anthropic”

Louise Matsakis covers the now constant concern about the potential for AI to aid in bioterrorism, explaining in her introduction “In the spring of 1995, U.S. lawmakers were becoming concerned that material uploaded to the nascent internet might pose a threat to national security. The Oklahoma City bombing had happened several weeks earlier, drawing attention to publications circulating online like The Big Book of Mischief, which included instructions on how to build homemade explosives.”

“Worried the information could be used to orchestrate another attack, then-Senator Dianne Feinstein pushed to make publishing bomb recipes on the internet illegal. The effort sparked a national debate about “Open Access vs. Censorship,” as one newspaper headline put it at the time.”

“Nearly 30 years later, a similar debate is now unfolding about artificial intelligence. Rather than DIY explosives, some U.S. officials and leading AI companies say they are increasingly worried that large language models could be used to develop biological weapons. The possibility has been repeatedly cited as one reason to be cautious about making AI systems open source.”

Matsakis interviewed George Mason’s Sonia Ben Ouagrham-Gormley as well in writing this piece, writing ‘“With new technologies, we tend to project in the future as though their development was linear and straightforward, and we never take into consideration the challenges and the contingencies of the people using them,” said Sonia Ben Ouagrham-Gormley, an associate professor at George Mason University who has interviewed former scientists in both the U.S. and Soviet Union’s now-defunct biological weapons programs.”

And later: “Ben Ouagrham-Gormley said her research has shown that achieving each of these steps requires employing different, highly-trained experts, including people who specialize in the exact type of pathogen being used. An AI model might be able to replace some of their work in the future, but she argued it can’t replicate the hands-on wisdom that comes from working in a laboratory.”

‘“This kind of tacit knowledge exists everywhere, but in the bio field, it’s really important because of the fragility of the raw material,” Ben Ouagrham-Gormley said.”

“Artificial Intelligence and Synthetic Biology Are Not Harbingers of Doom”

David Bray provides an optimistic outlook on the potential of AI and synthetic biology in this policy memo for the Stimson Center. Bray writes, “Contrary to many people’s fears, artificial intelligence (AI) can be a positive force in advancing biological research and biotechnology. The assumption that AI will super-empower the risks that already exist for the misuse of biotech to develop and spread pathogens and fuel bioterrorism misses three key points. First, the data must be out there for either an AI or a human to use it. Second, governments stop bad actors from using bio for nefarious purposes by focusing on the actors’ precursor behaviors. Third, given how wrong large language models (LLMs) often are and their risk of hallucinations, any would-be AI intended to provide advice on biotech will have to be checked by a human expert. In contrast, AI can be a positive force in advancing biological research and biotechnology — and insights from biology can power the next wave of AI for the benefit of humankind. Private and public-sector leaders need to make near-term decisions and actions to lay the foundation for maximizing the benefits of AI and biotech. National and international attention should focus on both new, collective approaches to data curation and ensuring the right training approaches for AI models of biological systems.”

“Going Viral: Bioeconomy Defense”

This report from Johns Hopkins’ Applied Physics Lab summarizes the findings of a May tabletop exercise:

“The May tabletop exercise at APL revealed four key areas of action to ensure a safe and secure bioeconomy.

Trust in lab equipment performance and data is foundational to the bioeconomy. Recommendations include developing digital security standards for lab equipment, hardening waypoints at each step in the data life cycle, and introducing a system of tiered levels of compliance.

Awareness of vulnerabilities, cyber and physical, and the steps for prevention and intervention are needed. Recommendations include additional exercises to strengthen intra-agency coordination and training and extending this activity to private sector companies.

Responsibility for responding to threats in the bioeconomy, and the roles for each team member, need to be defined with a process workflow, using a shared responsibility model, and teams need regular training opportunities to practice.

Preparedness is lacking, and threat-mitigation strategies specific to the bioeconomy need to be identified, tested and distributed. The exercise pushed the limits of participants’ traditional threat-mitigation strategies and identified the need for assessments of critical infrastructure and functions, cross-domain training, and the establishment of policies and procedures for an inter-agency group to rapidly respond to threats.”

“Security Considerations At the Intersection of Engineering Biology and Artificial Intelligence”

New from the Engineering Biology Research Consortium: “This white paper describes three areas at the intersection of engineering biology and artificial intelligence that may yield significant security concerns: de novo biological design, closed-loop autonomous laboratories, and natural language Large Language Models. It describes each area, identifies potential security concerns, and offers ideas for the potential mitigation of those concerns, ultimately calling for an international forum to continually address this evolving issue.”

“Pascale Ferrier and the Threat of Bioterror”

Markus K. Binder recently published this piece in NCT’s CBNW: “Drawing upon the START CBRN Data Suite and other research, Markus Binder considers the five ricin bio-attacks directed at the U.S. President and other officials that have taken place since 2013 to assess what, if anything, they can tell us about bioterrorism.”

“Americans’ Trust in Scientists, Positive Views of Science Continue to Decline”

New work from the Pew Research Center has found that “…the share of Americans who say science has had a mostly positive effect on society has fallen and there’s been a continued decline in public trust in scientists.”

“Overall, 57% of Americans say science has had a mostly positive effect on society. This share is down 8 percentage points since November 2021 and down 16 points since before the start of the coronavirus outbreak.”

“About a third (34%) now say the impact of science on society has been equally positive as negative. A small share (8%) think science has had a mostly negative impact on society.”

Read the report here.

“A Systematic Review Of COVID-19 Misinformation Interventions: Lessons Learned”

Smith et al. recently published this article with Health Affairs: “Governments, public health authorities, and social media platforms have employed various measures to counter misinformation that emerged during the COVID-19 pandemic. The effectiveness of those misinformation interventions is poorly understood. We analyzed fifty papers published between January 1, 2020, and February 24, 2023, to understand which interventions, if any, were helpful in mitigating COVID-19 misinformation. We found evidence supporting accuracy prompts, debunks, media literacy tips, warning labels, and overlays in mitigating either the spread of or belief in COVID-19 misinformation. However, by mapping the different characteristics of each study, we found levels of variation that weaken the current evidence base. For example, only 18 percent of studies included public health–related measures, such as intent to vaccinate, and the misinformation that interventions were tested against ranged considerably from conspiracy theories (vaccines include microchips) to unproven claims (gargling with saltwater prevents COVID-19). To more clearly discern the impact of various interventions and make evidence actionable for public health, the field urgently needs to include more public health experts in intervention design and to develop a health misinformation typology; agreed-upon outcome measures; and more global, more longitudinal, more video-based, and more platform-diverse studies.”

“Coffee As a Dietary Strategy to Prevent SARS-CoV-2 Infection”

Wu et al.‘s recent article in Cell & Bioscience offers further validation for coffee drinkers (as if we needed it): “Background: To date, most countries lifted the restriction requirement and coexisted with SARS-CoV-2. Thus, dietary behavior for preventing SARS-CoV-2 infection becomes an interesting issue on a daily basis. Coffee consumption is connected with reduced COVID-19 risk and correlated to COVID-19 severity. However, the mechanisms of coffee for the reduction of COVID-19 risk are still unclear.”

“Results: Here, we identified that coffee can inhibit multiple variants of the SARS-CoV-2 infection by restraining the binding of the SARS-CoV-2 spike protein to human angiotensin-converting enzyme 2 (ACE2), and reducing transmembrane serine protease 2 (TMPRSS2) and cathepsin L (CTSL) activity. Then, we used the method of “Here” (HRMS-exploring-recombination-examining) and found that isochlorogenic acid A, B, and C of coffee ingredients showed their potential to inhibit SARS-CoV-2 infection (inhibitory efficiency 43–54%). In addition, decaffeinated coffee still preserves inhibitory activity against SARS-CoV-2. Finally, in a human trial of 64 subjects, we identified that coffee consumption (approximately 1–2 cups/day) is sufficient to inhibit infection of multiple variants of SARS-CoV-2 entry, suggesting coffee could be a dietary strategy to prevent SARS-CoV2 infection.”

“Conclusions: This study verified moderate coffee consumption, including decaffeination, can provide a new guideline for the prevention of SARS-CoV-2. Based on the results, we also suggest a coffee-drinking plan for people to prevent infection in the post-COVID-19 era.”

“WHO: ‘Collective Action’ Needed to Effectively Reduce Antimicrobial Resistance”

CIDRAP’s Chris Dall covers WHO officials’ answers to questions about AMR in this piece written in recognition of World AMR Awareness Week. Dall explains “Encouraging the medical community, world leaders, and other stakeholders to do their part in staving off that grim future is one of the goals of World AMR Awareness Week, a global campaign of the World Health Organization (WHO) this week aimed at raising public awareness and promoting practices that help mitigate the threat posed by drug-resistant infections…CIDRAP News recently submitted a series of questions to WHO officials about the themes of this year’s World AMR Awareness Week, their assessment of the progress that countries have made in addressing AMR, and the challenges that lay ahead. Responses were provided by Sarah Sheppard, the WHO’s communications lead for Medicines, Health Products & AMR.”

“The World’s Chemical-Weapons Stockpiles Are Gone – But a New Challenge Looms”

Peter J. Hotchkiss, science policy adviser to the OPCW’s Scientific Advisory Board, recently published this World View piece with Nature. He explains in part, “In 2019, the OPCW’s 193 member states decided unanimously, for the first time in history, to add compounds to the schedules, the lists of chemicals that are regulated under the convention. The four entries comprise toxic nerve agents with no known civilian use: three cover phosphorus-based agents (in the ‘novichok family’), and the fourth is a family of carbamates, another kind of nerve agent. The convention already prohibited using these (or any chemical) to intentionally kill or harm people through toxicity. Now, their production, transfer and storage are subject to stringent verification by the OPCW, through declarations and on-site inspections.”

“Yet some states have been reticent to share data on these chemicals with the OPCW. The lack of information on the newly scheduled chemicals is in jarring contrast to what we have on other weapons listed in the convention and on their precursors. To ensure the health and safety of staff members during inspections, the OPCW needs the best understanding of these chemicals’ properties, the types of personal protective equipment and medical countermeasures that are effective against them and the analytical methods for detecting them. These data would also help us to provide the best information and training to all member states, ensuring that they are prepared in the event that any of these chemicals are used as a weapon.”

“29 Morally Bankrupt Governments, Headed by Russia, Voted Against the OPCW’s Resolutions”

The Syrian Network for Human Rights recently released this report “…emphasizing that many states worldwide must bring cases against the Syrian regime before the International Criminal Court (ICC) over the regime’s repeated violations of the Chemical Weapons Convention (CWC).”

“In the 15-page report, SNHR notes that the Syrian regime has carried out 184 chemical attacks since ratifying the Convention in September 2013. The report outlines the decisions adopted by the Organization for the Prohibition of Chemical Weapons (OPCW), identifying the states that voted against those decisions, or in other words the states that support the continuation of the Syrian regime’s chemical weapons program. Through this action, it notes, these states are, in effect, encouraging the regime to use weapons of mass destruction – chemical weapons – and emboldening it to carry out more chemical weapons attacks against the Syrian people.”

“Scientific Experts Provide Key Recommendations on Biotoxin Analysis to the OPCW”

“The Scientific Advisory Board (SAB) of the Organisation for the Prohibition of Chemical Weapons (OPCW) endorsed a report outlining key recommendations on biotoxin analysis and investigations of their alleged use as weapons submitted by a SAB Temporary Working Group (TWG) earlier this year.”

“Biotoxins are toxic chemicals produced by living organisms, which vary widely in properties such as structure, size, and mechanisms of toxicity. Some biotoxins can  be more toxic than traditional nerve agents. There are two biotoxins subject to stringent verification measures under the Chemical Weapons Convention – ricin and saxitoxin – with many others also posing safety and security concerns.” 

“The risk of misuse of biotoxins as weapons requires the OPCW to be prepared to conduct various investigations and missions related to their alleged use. To ensure the Organisation’s readiness to do so, the TWG’s report makes critical recommendations to the OPCW…”

Read more here.

“2023 Catalogue of Civil Society Activities Supporting the Chemical Weapons Convention”

The Stimson Center recently released its 2023 Catalogue of Civil Society Activities Supporting the Chemical Weapons Convention, “a catalogue of civil society capacity-building, assistance, and/or research programs supporting the Chemical Weapons Convention (CWC). The catalogue highlights all interested parties, including the CWC States Parties, the Organisation for the Prohibition of Chemical Weapons (OPCW), the Global Partnership Against the Spread of Weapons and Materials of Mass Destruction, international organizations, and industry stakeholders, civil society’s contributions to strengthen reducing the threat of chemical weapons and promoting the peaceful use of chemistry. By providing a uniform product, interested parties will be able to easily identify programs, experts, and organizations that support the CWC and related chemical weapons nonproliferation instruments.”

“Emerging and Re-Emerging Chemical Threats (Part 2)”

MRIGlobal continues their discussion of CW threats with “Chemical Threats on the Battlefield and Home Front” in this blog post, explaining in part “Today’s conflicts around the world highlight the current and pressing need for continued research to help ensure the safety of anyone in danger. And though we touched on “Emerging and Re-emerging Chemical Threats” earlier in the year, because emerging and re-emerging chemical threats pose an ever-present challenge to both warfighters and civilians, we are revisiting the topic to share additional expertise. To learn more, we visited with Cristina Youngren and Evan Durnal, subject matter experts in MRIGlobal’s Integrated Defense Solutions division.”

“What Does a French Arrest Warrant Mean for Normalization With Assad?”

Julia Neumann discusses what France’s arrest warrants for Bashar al-Assad and several associates mean in practice and for regional normalization in this piece for Syria Direct.

“Why Cheap Drones Pose a Significant Chemical Terrorism Threat”

Zachary Kallenborn recently published this piece with The Bulletin of the Atomic Scientists, writing in part “Relatively cheap drones are becoming a mainstay of conflicts, from the war in Ukraine to the Israel-Hamas conflict in Gaza. Though drones were once the purview of rich and powerful militaries, it’s now possible to use cheap consumer drones in battle. With a few tweaks, they can whistle past even sophisticated air defenses. As Al-Bared’s case highlights, they may also present a significant chemical terrorism threat. Drones can be equipped with sprayers to deliver chemical weapons, or they could be used in an attack on a chemical plant. They could also provide critical attack support, helping with reconnaissance to plan out and conduct an attack, monitor law enforcement response, and create propaganda to highlight terrorist activities.”

“Stanford Emerging Technology Review: Reporting on Key Technology Areas and Their Policy Implications”

“Emerging technologies are transforming societies, economies, and geopolitics. This moment brings unparalleled promise and novel risks. In every era, technological advances buoy nations that develop and scale them—helping to save lives, win wars, foster greater prosperity, and advance the human condition. At the same time, history is filled with examples where slow-moving governments stifled innovation in ways policymakers never intended, and nefarious actors used technological advances in ways that inventors never imagined. Technology is a tool. It is not inherently good or bad. But its use can amplify human talent or degrade it, uplift societies or repress them, solve vexing challenges or exacerbate them. These effects are sometimes deliberate but often accidental.”

“The stakes of technological developments today are especially high. Artificial intelligence (AI) is already revolutionizing industries, from music to medicine to the military, and its impact has been likened to the invention of electricity. Yet AI is just one among many technologies that are ushering in profound change. Fields like synthetic biology, materials science, and neuroscience hold potential to vastly improve health care, environmental sustainability, economic growth, and more. We have experienced moments of major technological change before. But we have never experienced the convergence of so many technologies with the potential to change so much, so fast.”

The Stanford Emerging Technology Review (SETR) is the first product of a major new Stanford technology education initiative for policymakers. Our goal is to help both the public and private sectors better understand the technologies poised to transform our world so that the United States can seize opportunities, mitigate risks, and ensure that the American innovation ecosystem continues to thrive.”

ICYMI: FBI Director Statement Before the House Committee on Homeland Security

FBI Director Christopher Wray delivered this statement to the House Committee on Homeland Security last month, highlighting the work of his agency across several mission areas, including emerging technologies and counter WMD. Wray explained in part of this statement that, “In addition to fighting terrorism, countering the proliferation of weapons-of-mass-destruction materials, technologies, and expertise, preventing their use by any actor, and securing nuclear and radioactive materials of concern are also top national security priority missions for the FBI. The FBI considers preventing, mitigating, investigating, and responding to weapons of mass destruction (“WMD”) terrorism a “no-fail” mission because a WMD attack could result in substantial injuries, illness, or loss of lives, while yielding significant social, economic, political, and other national security consequences. In collaboration with federal, state, local, tribal, territorial, and other partners, the FBI integrates complementary efforts to counter WMD terrorism. An example of this collaboration is the FBI-led Weapons of Mass Destruction Strategic Group. This interagency crisis action team spans more than 15 departments and agencies to coordinate the federal government’s response to WMD threats and incidents. Alongside the FBI, the Department of Homeland Security maintains the largest footprint on the strategic group.”

Read the full statement here.

NEW: Looking Ahead in Ukraine: What Could Increase the Risk of Escalation?

“As U.S. lawmakers debate the question of continued defense and humanitarian aid to Ukraine, the Ukrainian fight to expel Russian invaders continues with no end in sight. The stalemate on the front lines in Ukraine masks continued intense fighting and demands for resources on both sides that may drive longer-term changes—on the battlefield, inside Russia, and beyond. This could lead to further escalation, including the potential to turn the conflict into a wider war. Understanding which circumstances and policies may risk escalation in Ukraine is paramount: not only are decisions about supporting Ukraine critical to the long-term trajectory of the conflict but also the United States confronts a broad set of challenges across the globe.”

“Please join RAND’s National Security Research Division on Tuesday, December 5, 2023, 9:30 – 11:00 am ET, for a moderated panel discussion about which circumstances or policies may risk escalation in Ukraine—either deliberate or inadvertent—and the potential triggers and restraining factors likely to shape Russian escalation decisions in particular.”

“Missy Ryan, a national security reporter at the Washington Post, will moderate the discussion.”

Learn more and register here.

NEW: Threat Agnostic Biodefense Webinar: Assessing the Zoonotic Risk of Pre-Emergent Viruses

From PNNL: “Exploration of the “virosphere” is in its golden age. The sheer number of new viruses discovered daily, and the fact that most cannot be cultured, creates enormous uncertainty about where to allocate attention and resources. It is not an intractable problem, however, to distinguish those few viruses that are likely to emerge as zoonoses from the many others that are not. This talk describes two diametric approaches to addressing this problem. The first approach involves a field-to-lab investigative methodology that, when combine with biologically informed predictive computational models, can assess the zoonotic risk of viruses that have not yet been identified in humans. The second approach relies on the power of modern methods in anthropology and ethnography to identify zoonotic transmission pathways, even before the identification of any pathogens that might traverse those pathways. A unifying example is simian hemorrhagic fever virus and its relatives in the family Arteriviridae, which cause important animal diseases but have never been documented to infect humans. Both approaches identify these viruses as high-risk pre-emergent zoonoses.”

Learn more and register for this December 6 event here.

NEW: Bio & Beer

“As a rising global leader in the bioeconomy, investments in the future STEM workforce are critical in order to secure the U.S.’s position as a world resource for biohealth technology and innovations. Join us and our three guest speakers as we discuss the importance of a diverse, skilled STEM workforce to address rapidly increasing industry demand. We will also talk about training and other opportunities designed to prepare individuals for STEM careers. Enjoy an evening of networking, drinks, and fun!”

Learn more and RSVP here.

Meeting the Moment: Biodefense Policy, Procurement, and Public Health

From the Bipartisan Commission on Biodefense: “As the Nation continues to endure the consequences of recent pandemics, and with continued interest in biological weapons by nation states and other enemies, the federal government has an opportunity to address vulnerabilities in the biodefense enterprise. At this meeting, titled Meeting the Moment: Biodefense Policy, Procurement, and Public Health, the Commission intends to further explore : (1) biodefense policies and activities at the Department of Defense; (2) federal stockpile evaluation and decision-making for smallpox medical countermeasures; (3) needed authorities of the Department of Health and Human Services, including the Centers for Disease Control and Prevention; and (4) biodefense leadership.”

This meeting will take place on December 5, from 10:30 am until 4 pm ET. Register here.

2023 EPA International Decontamination Research and Development Conference-“Advancing Preparedness through Science and Collaboration”

“The clean-up of chemical, biological, or radiological (CBR) contamination incidents and natural disasters is a critical challenge for the United States. Understanding how to characterize and remediate affected areas of environmental contamination and waste is necessary for daily life to return.”

“The Decon Conference is designed to facilitate presentation, discussion, and further collaboration of research and development topics focused on an all-hazards approach to remediate contaminated indoor and outdoor areas, critical infrastructure, water distribution systems, and other environmental areas/materials.”

“This conference is free and open to the public. Content and presentations are geared towards the emergency response community, including local and state emergency managers, homeland security officials, first responder coordinators, private sector industry, risk managers, educators in the field of emergency management, and others.”

This event will take place December 5-7 in Charleston, SC. Learn more and register here.

Mitigating Arboviral Threats and Strengthening Public Health Preparedness

“Arboviruses are a broad group of viruses that are spread by arthropods, such as ticks and mosquitoes. Diseases caused by arboviruses, like dengue, chikungunya, Zika, and yellow fever, present a significant public health burden and threaten billions of people worldwide. Despite the global recognition of the devastating health and economic impacts of these diseases, the need persists for improved integration of mitigation efforts into public health systems and environmental and urban planning.”

“The National Academies Forum on Microbial Threats will conduct a two-day workshop that will identify lessons learned from previous outbreaks, outline current arbovirus surveillance capacities, and describe novel approaches to arbovirus mitigation. The workshop will include perspectives from researchers, public health practitioners, and environmental management experts from across the globe.”

This event will take place on December 12 and 13. Learn more here.

Presidential Advisory Council on Combating Antibiotic-Resistant Bacteria (PACCARB) Virtual Meeting

“The Presidential Advisory Council on Combating Antibiotic-Resistant Bacteria (PACCARB) provides advice, information, and recommendations to the U.S. Secretary of Health and Human Services (HHS Secretary). The council supports and evaluates U.S. government activities focused on fighting antimicrobial resistance (AMR) in human health, animal health, and environmental health. Using this One Health approach, members of the PACCARB have expertise from a range of backgrounds, including academia, industry, public health, advocacy, veterinary, and agricultural production.”

“The PACCARB was established under Executive Order 13676 and included in the Pandemic and All-Hazards Preparedness and Advancing Innovation Act of 2019 (PAHPAIA). Since 2019, the President has given authority to the HHS Secretary as the primary recipient of PACCARB recommendations. Additional information on the authority and activities of the PACCARB can be found on the About Us page in the charter.”

“As a federal advisory committee, the PACCARB looks to engage with the public and all AMR stakeholders. The council holds several public meetings every year both in-person and live streamed on the HHS.gov website. These meetings are open to anyone with an interest in combating AMR. See how to get involved!”

This virtual meeting will take place on December 20 from 9-4 EST. Learn more here.

61st ISODARCO Course: Nuclear Order and International Security after Ukraine

“The war in Ukraine has had an enormous impact on global security, reviving nuclear fears, undermining the prospects for arms control, and shattering many of the norms and constraints that were the foundation of European security.  ISODARCO 2024 will examine the global nuclear order in light of the Ukraine war, focusing on the states, the policies and the technologies that will shape the future in a much more difficult environment.  How will we cope with this more dangerous world?”

This course will take place January 7-14, 2024, at the University of Trento. Learn more and register here.

International Conference, CBRNE Research & Innovation

“The last 40 years have demonstrated that both military and civilian populations could be exposed to highly hazardous CBRNE agents following conflicts, natural outbreaks and disasters, industrial incidents or terrorist attacks.”

“Worldwide, researchers, responders and industrial capacities have been commited to provide adapted response to these challenges.”

“Building on the success of the first 5 International Conferences « CBRNE Research and Innovation » which took place in Antibes (2015), Lyon (2017), Nantes (2019), on line (2021) and Lille (2022), we want to give you a new opportunity to build up or strengthen collaborative networks in Strabourg (March 19th – 21rst 2024).”

“The CBRNE R&I Conference is specifically devoted to scientific updates, responders’ feedbacks and expression of needs. It also includes workshops and demonstrations of innovative materials, technologies and procedures, according to the following themes: DETECTION – IDENTIFICATION, PROTECTION – DECONTAMINATION, MEDICAL COUNTERMEASURES, RISKS & CRISIS MANAGEMENT.”

“Looking forward to your proposals for communication and to welcoming you at Strasbourg in March 2024!”

Learn more here.

Registration for GHS 2024 Now Open

Registration is now open for the Global Health Security 2024 conference in Sydney, Australia. This iteration will take place 18-21 June, 2024. The call for abstracts is also still open. “The mission of the Global Health Security conference is to provide a forum where leaders, researchers, policy-makers, and representatives from government, international organisations, civil society, and private industry from around the world can engage with each other, review the latest research and policy innovations, and agree solutions for making the world safer and healthier. To that end, our mission is to help foster a genuinely multidisciplinary community of practice that is committed to working collaboratively to enhance global health security and eliminate disease, irrespective of its origin or source.”

Council on Strategic Risks Launches the Nuclear Weapon Systems Project

“How states view the roles and relevance of nuclear weapons is changing. While these perspectives have been dynamic since the dawn of the atomic age, the changes occurring today and drivers of these changes are particularly worrisome—in particular given that they seem to be on the cusp of reversing a period heavily characterized by arms control agreements, reductions in global arsenals, and advances in international cooperation to reduce nuclear weapons risks.” 

“CSR’s core nuclear policy work to address this challenging time has focused largely on qualitative approaches to reducing the risks of nuclear miscalculations, uses of these weapons, arms racing behavior, and other dangerous trends. Going beyond numbers of weapons—which has been a major policy focus given numerical limitations in past nuclear treaties—a qualitative view of the nuclear weapons landscape is done through the lens of the nuclear capabilities nations seek, and associated policies and postures. This can help to show where multiple nations might find areas for potential cooperation that would be mutually beneficial. It can also help to show where nations currently possess the capabilities they claim to need, and thereby in what ways cooperative or unilateral measures of restraint are the most appropriate.”

“In order to facilitate this work by CSR and by others, we are launching The Nuclear Weapon Systems Project to help visualize how the types of nuclear capabilities fielded in the world have evolved since the advent of these weapons.”

“This project seeks to document and characterize every deployed nuclear weapons system that NPT-recognized nuclear states have developed in history. More than just a list of bombs, missiles, and artillery shells, the resulting dataset illustrates a complex story of risks, strategies, and lessons learned—and lost. We consider this data to be a living resource, and encourage outside contributions and feedback.”

Read more here.

“Georgetown Global Health Center Launches First Open-Access Wildlife Disease Database”

Georgetown University Medical Center’s Center for Global Health Science and Security recently announced “the launch of a first-of-its-kind wildlife disease database — a system for collecting records of viruses, bacteria, fungi, parasites, etc. — designed to support an early warning system for potential viral emergence. The Pathogen Harmonized Observatory, or PHAROS, is open to the global community and free to access.”

“Scientists in GHSS’ Verena program, a collaborative institute comprising a global team of scientists, designed PHAROS to advance research and education around viral emergence — the process of viruses jumping from animals to humans. Verena co-founder and director Colin Carlson, PhD, says most platforms designed to track diseases in wild animals are very limited and are developed only in response to a major outbreak, such as birds dying off suddenly due to avian flu.”

‘“Our goal is to build a data sharing system that lets us eventually predict pandemics like the weather,” Carlson says. “When we collect data on wildlife viruses, it gets published in journals and then lost forever, because it isn’t ever standardized or compiled. After COVID, there’s no excuse to keep working that way.”’

Texas A&M Research Assistant Professor (Pandemic Preparedness/Biosecurity) Openings

Texas A&M University’s Scowcroft Institute of International Affairs is seeking up to two Research Assistant Professors with expertise in pandemic preparedness and/or biosecurity. The Research Assistant Professor will be in the Scowcroft Institute of International Affairs, Bush School of Government & Public Service, and will work with the Pandemic Preparedness & Biosecurity Policy Program. Responsibilities include teaching graduate courses, conducting research, and writing policy-relevant publications on biosecurity, global health security, bio and agro-defense, federal life sciences policy, one health, biotechnology, or related policy topics. 


Learn more and apply here.

Pandora Report 4.21.2023

This week is another mixed bag highlighting recent alumni achievements and program happenings, discussing the release of annual State Department reports on global compliance with the NPT, CWC, and BWC, and Senate Republicans’ latest report on the origins of SARS-CoV-2. Several new publications and upcoming events are included, as well as open calls for experts and fellowship opportunities.

Fairfax County Health Department Recognizes Mason for Pandemic Response

Recently, “George Mason University was recognized by the Fairfax County Health Department (FCHD) for being an outstanding system partner in managing and operationalizing the university’s pandemic planning, response, and recovery. The partnership, which began long before the COVID-19 pandemic, has been vital in enhancing the health and well-being of the shared communities.”

The same piece announcing this interviewed a Biodefense PhD alumna, Julie Zobel, who is currently associate vice president of Safety, Emergency, and Enterprise Risk Management and Mason’s COVID director-“Julie Zobel…expressed her gratitude for the partnership between Mason and FCHD. “We are honored to have worked alongside the Fairfax County Health Department to serve our community during these challenging times,” said Zobel. “The success of our pandemic response would not have been possible without this partnership. We look forward to continuing our collaboration and commitment to public health”’

Pathogens Project Convenes Meeting in Geneva

The initiative on “Creating the Framework for Tomorrow’s Pathogen Research” hosted a public meeting in Geneva, Switzerland this week. This conference included Pathogens Project taskforce members, policy leaders, journalists, scientists, and civic leaders, among others.

The conference featured both private and public (recorded) workshops. Furthermore, according to the Project’s site, “It will produce a final summary report with recommendations, along with individually prepared papers focused on risk assessment and mitigation of high-risk pathogen research. Conference papers will be published in a special edition of the Bulletin of the Atomic Scientists and made available on the Bulletin’s website.”

Biodefense Graduate Program Director Dr. Gregory Koblentz was on a panel at the event, “Empirical studies tracking risks”, alongside Dr. Rocco Casagrande (Founder and Chair of the Board, Gryphon Scientific), Dr. Weiwen Zhang (Distinguished Professor of Synthetic Biology and Biochemical Engineering, Tianjin University of China), and Dr. Sandra López-Vergès (Senior Health Researcher and Chief, Gorgas Memorial Institute of Health Sciences). Koblentz discussed ongoing work from the Global BioLabs project, which he co-leads with Dr. Filippa Lentzos of King’s College London. Global BioLabs offers an interactive map of BSL-4 and BSL-3+ facilities globally and recently released Global BioLabs Report 2023.

Biodfense Graduate Program Director Dr. Gregory Koblentz on the “Empirical studies tracking risks” panel
Visit https://www.globalbiolabs.org/ to access this interactive map feature

State Department Releases Arms Control, Nonproliferation, and Disarmament Compliance Reports

The State Department’s Bureau of Arms Control, Verification, and Compliance recently released the 2023 Annual Report on Compliance with the Chemical Weapons Convention (CWC) and the 2023 Adherence to and Compliance with Arms Control, Nonproliferation, and Disarmament Agreements and Commitments Report. The latter notes BWC compliance issues in the People’s Republic of China, Islamic Republic of Iran, Democratic People’s Republic of Korea, and the Russian Federation. This includes discussion of the lack of information needed to assess if China has eliminated its BW program, concerns about Iran’s ability to produce lethal BW agents, knowledge of North Korea’s BW program, and Russia’s violations of Articles I and II of the BWC.

The report also notes concerns about lack of transparency in Myanmar’s nuclear work (though evidence does not indicate that the country violated the NPT). The appended report on CWC compliance discusses further concerns with Myanmar and other countries’ compliance with the treaty. The report explains that “Four States Parties – Burma, Iran, Russia, and Syria – are certified in non-compliance with the CWC. Russia and Syria were first certified in non-compliance in April 2018. Iran was first certified in non-compliance in November 2018. Burma was first certified in non-compliance in 2019. Additional information is available in the 2023 classified Condition (10)(C) Reports. The United States also cannot certify the People’s Republic of China’s compliance, which was first reported in 2021.”

Dr. Gregory Koblentz and Madeline Roty (Biodefense MS ’21) authored a piece in the Bulletin of the Atomic Scientists in 2020 discussing Myanmar’s past with CW and US efforts to get the country to reconcile and come into compliance with the CWC. Following the 2021 coup d’état and the ouster of Aung San Suu Kyi, Myanmar is unlikely to meet the requirements needed to be in compliance, despite the progress outlined by Koblentz and Roty.

Senate Republicans Release COVID Origins Report

Senate Republicans have released their report exploring the origins of the COVID-19 pandemic, building on the short interim report released in October 2022. Two documents titled “Muddy Waters: The Origins of COVID-19” were released; one by the Muddy Waters Group and another prepared by Senator Roger Marshall alongside Dr. Bob Kadlec, Bob Foster, and members of the 117th GOP Health, Education, Labor & Pensions (HELP) Committee’s staff. The report was a product of the work of former Senator Richard Burr of North Carolina, who commissioned the report and oversaw the release of the October HELP committee interim report. Readers may recall the controversy that accompanied the release of that interim report, which coincided with the release of articles by Vanity Fair and ProPublica that were widely criticized for poor quality translations and other inaccuracies we discussed in November.

That troubled trend seems to continue in this new report, with admitted circumstantial evidence used to find that “The preponderance of information affirms the plausibility of a research-related incident that was likely unintentional resulting from failures of biosafety containment during vaccine-related research.”

Axios explains that the report “…argues that scientists haven’t found any naturally occurring viruses with the same composition of the coronavirus, and that there’s evidence the virus was circulating in Wuhan before the first known cases connected to the wet market were reported…It also argues that it appears Chinese researchers began development of at least two COVID vaccines in November 2019, including at the WIV, which “means SARS-CoV-2 would have been present at the WIV before the known outbreak of the pandemic,” and “It also documents numerous instances of lab safety concerns throughout 2019, including around the time when the virus may have first appeared.”

Much of this, however, relies on the same previously disputed points made in the interim report and the accompanying ProPublica and Vanity Fair pieces. Furthermore, as Caitlin Owens highlights in another piece for Axios, the reports rely on circumstantial evidence which means “The absence of evidence pointing, for example, to a precise transmission route from animals to humans will lead to very different interpretations of the same information.”

Dr. Angela Rasmussen, a virologist who has worked on high-profile studies supporting the idea of a natural origin of SARS-CoV-2 told Owens that the report “…demonstrates, in my view, a political agenda that’s meant to bolster the idea that the lab leak hypothesis is more supported than it is. But also it is so full of just factual errors.” Rasmussen also counters a number of key assertions made in the new report, including those such as the presence of a furin cleavage site on SARS-CoV-2’s spike protein is in itself suspicious and that the Wuhan Institute of Virology was dealing with substantial biosafety problems that Party leadership was concerned about.

All told, this report seems unlikely to change much or anything in this ongoing public debate.

Understanding Cyber-Warfare: Politics, Policy and Strategy

Chris Whyte and Brian Mazanec (a Biodefense PhD alumnus) are pleased to announce the publication of the second edition of their textbook Understanding Cyber-Warfare: Politics, Policy and Strategy (Routledge, 2023).  This second edition of their popular textbook offers an accessible introduction to the historical, technical, and strategic context of global cyber conflict. The second edition has been revised and updated throughout, with three new chapters, to include coverage of the role of cyber in the war in Ukraine as well as a discussion of the role of emerging information technologies like artificial intelligence and quantum computing in shaping the dynamics of global cyber conflict.  The second edition has recieved positive reviews. For example James R. Clapper, the former Director of National Intelligence, called it “an authoritative tutorial on the arcane complexities of cyber warfare” and said this edition “updates a previous version and makes the book more contemporary. It is a must-read for those who are serious about mastering this unique medium of combat, in all its dimensions.”  More details can be found here.

“Artificial Intelligence and Machine Learning for Bioenergy Research: Opportunities and Challenge”

New from the US Department of Energy’s Genomic Science Program: “The integration of artificial intelligence and machine learning (AI/ML) with automated experimentation, genomics, biosystems design, and bioprocessing represents a new data-driven research paradigm poised to revolutionize scientific investigation and, particularly, bioenergy research. To identify the opportunities and challenges in this emerging research area, the U.S. Department of Energy’s (DOE) Biological and Environmental Research program (BER) and Bioenergy Technologies Office (BETO) held a joint virtual workshop on AI/ML for Bioenergy Research (AMBER) on August 23–25, 2022.”

“Approximately 50 scientists with various expertise from academia, industry, and DOE national laboratories met to assess the current and future potential for AI/ML and laboratory automation to advance biological understanding and engineering. They particularly examined how integrating AI/ML tools with laboratory automation could accelerate biosystems design and optimize biomanufacturing for a variety of DOE mission needs in energy and the environment.”

The report describing the workshop findings is now available here.

“The Making of a Biosafety Officer”

David Gillum discusses the roles of biosafety professionals in this piece for Issues in Science and Technology, writing in part “The question of how the biosafety community generates and transmits knowledge is interesting in itself, but it is also an urgent issue. The need for biosafety workers is growing just as current professionals are skewing older: an estimated 54% are over 50 and one of the few surveys of the field suggests there are six times as many biosafety officers over 70 as there are under 30. Preparing more of us—and keeping the public safe as the complexity of biological research, health, and manufacturing projects burgeons—is made more difficult by the importance of tacit knowledge in our education. Methods for understanding, communicating, and mitigating risk are difficult to transfer to others. To enhance public health and safety, people in my line of work should ease this transfer by considering how the profession might be standardized and formalized.”

“Viral Families and Disease X: A Framework for U.S. Pandemic Preparedness Policy”

In this policy brief for the Center for Security and Emerging Technology, Schuerger et al. explain that “Pandemic threats are increasing as globalization, urbanization, and encroachment on animal habitats cause infectious outbreaks to become more frequent and severe. It is imperative that the United States build a pipeline of medical countermeasure development, beginning with basic scientific research and culminating in approved therapies. This report assesses preparedness for families of viral pathogens of pandemic potential and offers recommendations for steps the U.S. government can take to prepare for future pandemics.”

“Integrating Public and Ecosystem Health to Foster Resilience: Proceedings of a Workshop”

“Ecosystems form the foundation upon which society can survive and thrive, providing food, water, air, materials, and recreation. The connections between people and their environments are under stress from human-driven climate change, pollution, resource exploitation, and other actions that may have implications for public health. Existing intellectual frameworks including One Health, Planetary Health, ecosystem services, and nature-based solutions help to connect different elements related to the resilience of public health and ecological health systems. However, because of the breadth of this issue, many implications regarding public health are not well characterized, leading to gaps in understanding the interconnections between public health and ecosystem health systems and how ecosystem resiliency may affect public health.”

“The National Academies of Sciences, Engineering, and Medicine held a workshop in September 2022 focused on the integration of public and ecosystem health to foster resilience. This workshop was designed to inform the development of a research agenda aimed at bridging the knowledge-to-action gap and spur a move from research to policy and practice. Participants included a broad range of interdisciplinary researchers and practitioners from the public health, natural resource management, and environmental protection communities. The workshop provided a forum for the exchange of knowledge, discussion of critical gaps in understanding and practice, and identification of promising research that could support the development of domestic and international policy and practice.”

“The proceedings summarizing the workshop is now available for free download, and a public webinar exploring the workshop topics will take place virtually in early May. Click below to download the proceedings, register for the webinar, and visit the project page to more about this publication.”

“The Right People and the Right Question: Getting Chemical Weapons Out of Syria”

In this recent video story for the Stanley Center for Peace and Security, Tom Countryman discusses his tenure as the Assistant Secretary of State for Non-Proliferation as the Department navigated concerns about Syria’s chemical weapons. He highlights key lessons learned in doing this, including the need to mind the political context one is operating in, the importance of knowing who the right people are and being able to motivate and mobilize them, appropriately identifying goals and what is needed to achieve them, and, finally, not allowing the difficulties of political relationships to overshadow common interests.

“Reducing the Problem: Eliminating Syria’s Chemical Weapons”

Andy Weber discusses elimination of the Syrian CW stockpile in this video story for the Stanley Center. He covers how he came to be the Assistant Secretary of Defense for Nuclear, Chemical, and Biological Defense Programs and more, saying in part “Sometimes, whether it’s Gaddafi in Libya, or Assad in Syria, it’s unsavory characters, who have these horrific weapons. And you have to work with them sometimes, and it’s hard, and it’s challenging, and you have to keep your eyes open. You need to make sure you’re not indirectly helping them in another area. But that’s where good oversight comes in, and you have to think about the objective of all these programs. The objective is to save lives, to prevent mass casualties in any country, anywhere in the world. These are global programs that improve global security.”

“Armed Conflict and Nuclear Security: Implications for Europe”
Muhammed Ali Alkiş discusses the efficacy of the traditional approach to nuclear security in this recent publication for SIPRI: “The traditional approach to nuclear security is unlikely to be effective against the full spectrum of current threats, including those posed by state actors. The lessons learned from the Russian occupation of Ukrainian nuclear power plants, the potential radiological consequences of armed attacks against nuclear facilities and the potential increase in the number of nuclear power states in the future underscore the need for a strong international framework to address nuclear security challenges.”

“The European Union (EU) is committed to implementing the highest international standards for nuclear security and may therefore be in a position to lead efforts to address threats of armed attacks against nuclear installations. This paper provides a range of potential policy recommendations and actionable steps that the EU and its member states could take at legal, institutional and operational levels to minimize the nuclear security threats posed by armed conflict in the future. While they may appear politically challenging or even unrealistic at present, the conflict in Ukraine highlights the very real need for the types of actions recommended by this paper.”

“Technology Primer: Artificial Intelligence & Machine Learning”

Checkout this new report from the Harvard Belfer Center: “Artificial Intelligence (AI), can be defined as the theory and application of machines—especially computer programs—to perform tasks that typically require human intelligence, such as image captioning and generation, speech recognition and synthesis, natural language understanding and production, tool assembly and utilization, as well as various other perception-action based engagements. AI, in its current technological state, is being applied in various industries and domains, such as online advertising, financial trading, healthcare, pharmaceutical, and robotics. The lucrative market opportunities offered by AI applications have attracted investments from tech giants like Alphabet, Apple, Meta, Amazon, and Microsoft, as well as research universities and startups.”

“Machine Learning (ML), commonly categorized as a subfield of AI, is a field of study concerning the automatic discovery of historical patterns in data using statistical algorithms. ML’s driving principle is that historical patterns are likely to reappear in the future. The discovered historical patterns can therefore be leveraged to make accurate predictions on data that has not been seen before. Once an algorithm is trained, it can be applied to new, larger streams of data. ML is already an integral component of many deployed commercial applications, such as content generation (e.g., text, image, audio, video generation), virtual assistants, social media feed ranking, content recommendation systems, financial market prediction, and healthcare screening and diagnostic tools, as well as administrative applications. In addition, ML is foundational in various other emerging technologies, such as autonomous vehicles and next-generation cybersecurity.”

“Currently, United States policy with regards to AI often derives from interpretations of various pre-existing legislations and legal precedents. However, with the increased awareness of AI-related risks (e.g., bias, accountability, misuse, etc.), and the potential size of their impact, over the last decade, the number of proposed bills containing AI provisions significantly increased at both the state and federal levels (i.e., from two bills in 2012 to 131 in 2021), with 2% of them becoming law at the federal level and 20% of them becoming law at the state level. Similarly, policies and regulatory frameworks are being crafted to guide the development and application of AI in other continents too, with Europe and Asia leading the process. Acknowledging the potential impact of this technology on human life and societal dynamics, there is a pressing need for U.S. legislators and policymakers to remain engaged in the ethical and practical development of artificial intelligence.”

Lessons From the COVID War: An Investigative Report

The independent, nonpartisan Covid Crisis Group has spent two years investigating the causes and consequences of the COVID-19 pandemic. The Schar School of Policy and Government and Biodefense Graduate Program are proud to host two members of the group, Andrew Kilianski and Melissa Harvey, for an in-depth discussion of the group’s long-awaited report on what went wrong—and right—with America’s response to the pandemic: Lessons from the Covid War: An Investigative Report (Public Affairs, 2023).

The Covid Crisis Group is a remarkable group of 34 distinguished practitioners and scholars from a variety of backgrounds who came together determined to learn and share the most valuable lessons from the worst peacetime catastrophe of modern times. Lessons from the Covid War is plain-spoken and clear-sighted. It cuts through the jumble of information to make some sense of it all and answer: What just happened to us, and why? And crucially, how, next time, could we do better? Because there will be a next time.

Register here: https://gmu.universitytickets.com/w/event.aspx?id=1471 

Book Event: Open Source Investigations in the Age of Google 

From the Center for Strategic and International Studies: “How did a journalist find out who was responsible for bombing hospitals in Syria without leaving his desk in New York? How can South Sudanese activists safely track and detail the weapons in their communities, and make sure that global audiences take notice? What are policy makers, lawyers, and intelligence agencies doing to keep up with and make use of these activities? A team of authors tackle these questions in their new book “Open Source Investigations in the Age of Google.”‘ 

“This new interdisciplinary book seeks to answer these questions and more, with contributions by prize-winning practitioners, experts, and rising stars from across the open source investigation community. Painting a comprehensive picture of the digital information space today, it explores the manner and methods in which current open source investigations are conducted, as well as examines the opportunities and challenges they present to salient issues to the information environment such as trust and transparency, accountability, justice, amongst others.”‘

“Please join CSIS virtually on April 24, 1-2 pm EDT for a panel discussion on open-source investigations moderated by Diane Cooke, visiting fellow with the International Security Program. The conversation will include Hans Kristensen, Director of the Nuclear Information Project, Federation of American Scientists; Christiaan Triebert, journalist on the New York Times Visual Investigation Team; and Henrietta Wilson, Senior Analyst for the Strategic Concept for the Removal of Arms and Proliferation, SOAS University of London & King’s College London.”

Register here.

Online Event: Civil Society at the 5th CWC Review Conference

From the CWC Coalition: “The Fifth Five-Year Review Conference (RC-5) for the 1997 Chemical Weapons Convention will be held in the Hague from May 15-19, 2023.”

“At the CWC RevCon, member states and the broader chemical weapons disarmament community will gather to assess past achievements, treaty implementation and compliance, and discuss plans to strengthen the CWC in the years ahead.”

“You are invited to join a virtual discussion on the upcoming Fifth Five-Year CWC Review Conference (RC-5), major issues to be addressed, and the role of civil society and non-governmental organizations.”

“We will be joined by Elisabeth Waechter, Head of Public Affairs at the OPCW. Paul Walker, the Chair of the CWC Coalition, will moderate.”

This event will take place on April 26 at 10 am EST. Register here.

National Biodefense Science Board Public Meeting

The NBSB will meet virtually on May 4 at 2 pm EST to discuss lessons from COVID-19 and will present recommendations on several topics, including collection, analysis, and sharing of operational health data, uses of virtual healthcare during disaster response, and disaster response challenges specific to rural and underserved communities. Register here.

Virtual Workshop: Prioritizing Actions for Epidemic and Pandemic Preparedness

From the National Academies: “Please join us May 4 & 18, 2023 from 8 a.m. to 12 p.m. ET for a virtual symposium examining how to strengthen the evidence-based prioritization of epidemic and pandemic preparedness and response capabilities.

The symposium will convene global health planning stakeholders, including those in government and academia, and across health- and non-health sectors to:

  • Review assessment tools and how, independently and together, they relate to national action planning.
  • Gain insight into how countries and organizations currently select priorities in funding for epidemic prevention, detection, and response.
  • Assess evidence for effective prioritization approaches to building disease surveillance and risk communication capabilities.
  • Identify governance structures that can support robust and reliable systems for epidemic and pandemic preparedness and response investments.

This symposium is in collaboration with the Division on Earth and Life Studies. Learn more about this workshop by visiting the event webpage.”

Nobel Prize Summit-Truth, Trust and Hope

Taking place May 24-26 this year in DC and virtually, this Nobel Prize Summit asks “How can we build trust in truth, facts and scientific evidence so that we can create a hopeful future for all?”

“Misinformation is eroding our trust in science and runs the risk of becoming one of the greatest threats to our society today.”

“Join us at this years’ Nobel Prize Summit which brings together laureates, leading experts and you in a conversation on how we can combat misinformation, restore trust in science and create a hopeful future.”

Learn more and register here.

CSWMD 2023 Annual Symposium: WMD in the Decisive Decade

“The National Defense University’s Center for the Study of Weapons of Mass Destruction (CSWMD) invites you to join us on 14 June 2023 for the virtual Annual CSWMD Symposium, titled WMD in the Decisive Decade.”

“This year’s symposium will explore the cognitive impacts WMD has on strategic decision making and the challenges associated with operating in an environment where WMD has been employed. It will be an opportunity for the WMD community to engage with officials and thought leaders on current WMD challenges at the unclassified level, including keynote addresses by Richard Johnson, Deputy Assistant Secretary of Defense for Nuclear and CWMD Policy and Rebecca Hersman, Director of the Defense Threat Reduction Agency.”

“For more information and to register for this event click here. Please RSVP by 9 JUNE 2023.”

“We look forward to hosting you for the event. For more information about the WMD Center and reference our research, please visit our website at https://wmdcenter.ndu.edu/ and follow us on Twitter and on LinkedIn.”

Gordon Research Conference: Cross-Cutting Science Facilitating Collaboration Across the Threat-Science Research Community

“The Nonproliferation, Counterproliferation and Disarmament Science GRC is a premier, international scientific conference focused on advancing the frontiers of science through the presentation of cutting-edge and unpublished research, prioritizing time for discussion after each talk and fostering informal interactions among scientists of all career stages. The conference program includes a diverse range of speakers and discussion leaders from institutions and organizations worldwide, concentrating on the latest developments in the field. The conference is five days long and held in a remote location to increase the sense of camaraderie and create scientific communities, with lasting collaborations and friendships. In addition to premier talks, the conference has designated time for poster sessions from individuals of all career stages, and afternoon free time and communal meals allow for informal networking opportunities with leaders in the field.”

This conference will take place July 9-14 in Ventura, CA. Learn more and register here.

Call for Applications: Early-Career Fellowship for Reducing Nuclear Weapons Risks

The Council on Strategic Risks “is announcing a continuation of its Early-Career Fellowship for Reducing Nuclear Weapons Risks. Through this six-month program, early-career professionals will work with leading experts from CSR’s team and network to develop a better understanding of practical risk reduction concepts and to generate new ideas regarding:

  • Nuclear strategic stability
  • Strengthening norms against nuclear weapons threats and use
  • Avoiding miscalculations and preventing accidents/incidents
  • Preventing and addressing nuclear proliferation
  • Responsibilities of nuclear weapons-capable states”

Learn more and apply here.

Seeking Subject Matter Expert(s) (SMEs) with Experience Educating Global Audiences on the Importance of Securing Emerging Technologies

“CRDF Global is seeking subject matter expert(s) (SMEs) to engage and educate global audiences. The expert(s) will work on deliverables relating to building a culture of security in the private sector. These deliverables will include the development of an online asynchronous course and four hybrid hackathons, which will take place at local incubator hubs in several countries.”

“The expert(s) will design and develop an asynchronous course to counter misuse and raise awareness of emerging technologies with potential weapons of mass destruction (WMD)-related applications by state and non-state actors. The audience for this course will be individuals in the private sector (particularly in start-ups, innovation hubs, and incubator spaces) in various countries globally. This asynchronous course should train key stakeholders on how to develop and foster a culture of security.”

Learn more here.

Weekly Trivia Question

You read the Pandora Report every week and now it’s time for you to show off what you know! The first person to send the correct answer to biodefense@gmu.edu will get a shout out in the following issue (first name last initial). Our question this week is: “In 1984, what group spread Salmonella enterica at restaurants and shops in Dulles, Oregon in an attempt to influence local elections?”

Last week, our question was: “In the 2011 film Contagion, Dr. Erin Mears (played by Kate Winslet) is an officer in which CDC program?” The answer is the Epidemic Intelligence Service.

Pandora Report: 11.4.2022

Happy Friday! This week focuses heavily on China and Russia, covering the recent ProPublica piece on the Wuhan Institute of Virology, Shanghai’s lockdown, Russia’s failed attempt at creating a UN Security Council committee to investigate its false claims about supposed US biological weapons facilities in Ukraine, and more. We also cover new publications, a new podcast release from the University of Bath’s Dr. Brett Edwards, upcoming events, and an exciting fellowship opportunity from the WHO.

About That ProPublica Piece

Late last week, ProPublica and Vanity Fair released a piece in conjunction with the Senate HELP Committee minority’s interim report, claiming to have unveiled new information from the Wuhan Institute of Virology (WIV) supporting the lab leak theory of COVID-19’s origin. In it, Katherine Eban and Jeff Kao rely heavily on the work of a single self-proclaimed polyglottal State Department political officer to translate Chinese Communist Party (CCP) “party speak,” which he claims native speakers “can’t really follow…” Now, the piece some have described as a train wreck is being heavily criticized for having faulty translations, mis-matched dates, misrepresenting the sources of the documents discussed in it, not understanding how common VPN usage is in China-related research, and more. ProPublica is reportedly scrambling to review critical details of their piece, but is it too late? Let’s talk about some core issues with the article and what they might mean long term.

‘Party Speak’ or Just Lost in Translation?

The first half of the ProPublica piece is dominated by glowing discussion of Toy Reid, a former RAND Corporation employee and East Asia political officer at the US Department of State, covering his blue collar origins and attendance at Harvard. The authors then discuss how Reid spent over a year working for the Senate HELP Committee, using a VPN to search “dispatches” on the WIV’s website from Hart Senate Office Building and his Florida home. They write, “These dispatches remain on the internet, but their meaning can’t be unlocked by just anyone. Using his hard-earned expertise, Reid believes he unearthed secrets that were hiding in plain sight.”

Plain sight is right! These “dispatches” were updates posted to the Wuhan Institute of Virology’s (WIV) homepage on the general news tab. In fact, you can go look through this whole tab here to see mundane entries ranging from a recent day reflecting on the 20th National Congress to a July post about WIV celebrating the 101st anniversary of the Party, to general updates about different trainings and publications related to the institute. Therein lies one of the fundamental problems with this piece-these were not secretive dispatches internal to the Party. These are essentially press releases meant to face outward. Yes, they are laden with mentions of comrades, references to struggles and frontlines, and key Chinese leaders, including Xi Jinping and the recently ousted Li Keqiang. They are, after all, written by Party members in a major facility of the Chinese Academy of Sciences. They are going to have this kind of language by default, especially around times like national congresses and major anniversaries.

To be clear, the CCP does use euphemisms and round-about language at times to describe high-level concepts and goals. In fact, some scholars spend the bulk of their careers conducting political discourse analysis and understanding leaders’ officialease or government-speak. Some do focus on CCP party speak, which has become especially interesting in the Xi years. However, this is definitely not unique to the CCP as one can find scholars dissecting and analyzing any number of world leaders’ speeches and government lexicons. It is also important to recognize that this concept is not some niche or extremely esoteric concept known only to a few in China watching circles. Students studying Chinese politics overwhelmingly have to learn things like “crossing the river by touching the stones” or “socialism with Chinese characteristics” as a Chinese-specific form of Marxism-Leninism throughout the periods of Dengism, Three Represents, Scientific Outlook on Development, and now Xi Jinping Thought. It it core to understanding national agendas throughout different leadership periods.

However, with this comes the understanding that Party documents are laden with this kind of jargon and narrative furthering. This also is not unique to the CCP. In fact, Harry Hodgkinson wrote an entire guide in 1955 on Soviet jargon and unique meanings Communist parties give to particularly terms. While this jargon and overarching nationalistic narratives offer important context for the WIV posts, they do not represent some in-between-the-lines version of Chinese that “even native Mandarin speakers can’t really follow…” Rather, they help explain why the language in the posts seems so dramatic and nationalistic.

What’s in a Narrative?

In October 1949, Mao Zedong declared the official founding of the People’s Republic of China. With Chiang Kai-shek and the remainder of the KMT exiled to the island of Taiwan and the decades long civil war over, Mao was left to figure out how to actually lead the new PRC. Central to this were narratives of overcoming the century of humiliation, protecting the sovereignty and integrity of Chinese territory, bringing justice for China against those who subjugated it, and building a strong, advanced country. These ideas were central to nationalism at the time and drove pushes to modernize like the infamous Great Leap Forward. As Dr. Kerry Brown of King’s College London writes, “That self-designated task of bringing about justice for China was the main justification for the Party’s many mistakes under Mao when the second resolution on its own history was produced a few years after his death in 1981.” Themes of struggle against western imperial powers and self-determination were critical political tools wielded by the Party, even in the face of wildly unpopular, destructive policies.

Though it looks different today, narratives of national struggle and rejuvenation are still important features of CCP rhetoric, even for Party members at a CAS laboratory. Brown discusses the power of narrative in modern China, writing, “For the current dominant leader Xi Jinping, the notion that the Party is a kind of epistemic community, one uniquely placed to carry China forwards to the fulfilment of its great quest for a just outcome to history, is becoming more powerful by the day.  Seen in these terms, the Party is not so much about power per se – but power to deliver this historic outcome. That perhaps explains why, despite the many challenges and problems with its practice and its own history, it still remains so dominant in China.” Today, concepts like the Chinese dream, national rejuvenation, and the goal of becoming fully modernized by 2049 are central themes Party rhetoric uses, even in discussing day-to-day work at different lower-level organizations.

In the context of the Wuhan Institute of Virology posts, this is seen in the framing of work at the lab as some kind of grand struggle. In one of the first WIV posts referenced by ProPublica and Vanity Fair (available here in its original format), the authors claim to have found a dispatch that “…referenced inhumane working conditions and “hidden safety dangers.” On Nov. 12 of that year, a dispatch by party branch members at the BSL-4 laboratory appeared to reference a biosecurity breach: “These viruses come without a shadow and leave without a trace.”

However, as a number of Mandarin speakers and China watchers have pointed out online, this was actually a very general post about how the facility went from humble beginnings at its founding to now being a training hub and “fighting fortress” of China’s research and public health. It is written not unlike other fictional and non-fictional works describing BSL-4 facilities in other countries (The Hot Zone, anyone?)-hours are long in these space suit-like positive pressure suits, the pathogens are unimaginably dangerous, and those doing the work are brave, hardworking, brilliant scientists.

Much of Toy Reid’s interpretation of this post depends on a misinterpretation of “每当这时” (Měi dāng zhè shí, “whenever”) in the context of a description of Party members leading by example whenever handling BSL-4 pathogens. Reid instead took this as “whenever there are biosafety breaches,” and not some inspirational statement about Party members. Other portions of the article focus on visits from Chinese Academy of Sciences officials and seminars on the importance of biosafety and commonly noted issues during safety inspections. However, these were updates about high-level visitors and general efforts to ensure the facility maintained safety standards, much like those any organization anywhere might make.

James Palmer, deputy editor at Foreign Policy and author of Foreign Policy’s China Brief, discussing the normal workplace nature of the WIV posts

The Wuhan Institute of Virology boasts the PRC’s first BSL-4 (P4) facility, which opened in 2018, marking a major milestone for the country. A boastful post about how it came from humble beginnings but, through the work of very dedicated personnel, is now doing important, taxing work and striving to always be better is very par for the course. There is even a corny word play in the post about how Party members “infect” (Gǎnrǎn, “感染”) others with their practical actions and safety-conscious attitudes. As many have now pointed out, this is just the Party bragging about how dedicated their members are, how far the facility has come, and how personnel are constantly working to better themselves and their organization. In other words, it is furthering the Party narrative, not hinting at secret internal problems.

References throughout the posts cited by ProPublica to General Secretary Xi Jinping and his discussion of technology as a weapon make sense in the context of Party-authored news posts. Xi Jinping has achieved power unlike any previous leader, capturing himself a historic third term after the country removed presidential term limits in 2018. Xi Jinping Thought (“Xi Jinping Thought on Socialism with Chinese Characteristics for a New Era”) was also formally enshrined in the Party’s constitution that year, further cementing Xi’s unique power over the Party with the CCP describing it as “Marxism of contemporary China and of the 21 century.” With this context in mind, it makes sense for Party members at WIV to frequently reference Xi and his national goals and speeches. However, Reid instead took this as literal input directly from Xi to the lab following the biosafety incident he claims a previous post references.

Zhihua Chen’s thread on translation and dating issues in the ProPublica article

Finally, even if this was all true-the WIV had a 2019 biosafety incident and Xi Jinping was personally concerned enough to send an urgent message about it to WIV himself-why would any of that be posted on the institute’s website? As was just discussed, the narrative matters a lot in Chinese politics; image is everything and the Party is very secretive as a result. As the country continues to compete internationally in all areas, including the bioeconomy, it does not make sense for the Party to air dirty laundry about a supposed biosafety incident and workers’ concerns in a public space. If the core argument is that China is covering up a lab leak, the question of “Why would the Party allow the facility in question to publicly hint at mismanagement and safety issues on its own website?” must be answered.

Implications

Ultimately, bad faith takes on China, COVID-19, and biosafety hurt us all. There is a fundamental difference between calling for an in-depth investigation, holding the PRC accountable for its failures, working towards making sure we are better prepared for the next time something like this happens, and inappropriately equating mischaracterized and poorly translated press releases to some kind of damning evidence of a lab leak origin of SARS-CoV-2. The US-PRC relationship is in a very dangerous place and, while criticism of the CCP’s handling of COVID-19 is absolutely warranted, this article is likely to become political fodder for the Party. In fact, the Chinese government has already condemned the piece, claiming that it was driven by US politics.

While ProPublica claimed to have corroborated Reid’s work with unnamed “experts” on CCP communications, the swift backlash and ProPublica’s moves to reach out to other translators cast further doubt on the caliber and motivations of those consulted initially. This is in addition to concerns about the experts they claim to have consulted on the WIV’s claims about biosafety and time researchers spend in BSL-4. In the end, one can be both critical of the CCP and its practices while not resorting to an overly hawkish view that leads to finding suspicion in the mundane.

Finally, this points to a need for interdisciplinary collaboration and competent understanding of the political realities of the PRC in assessing issues like biosafety. What may look to someone with little knowledge of Chinese political discourse as alarming messages are actually pretty par for the course in terms of statements and news updates on an official website. Outside of debates on SARS-CoV-2’s origin in the scientific community, scholars in the social sciences and humanities and experts working in all sorts of fields can offer important context that, in this case, marks the difference between recognizing standard Party rhetoric and sounding alarm bells over normal updates on the WIV’s website.

For more on this, including discussions of the scientific debate about COVID-19’s origin as discussed in the Senate report and ProPublica article, check out Michael Hiltzik’s opinion piece on this article in the LA Times and Max Tani’s work in Semafor.

It’s the Happiest Place on Earth, Until You’re Stuck There-Welcome to Shanghai Disney

As China continues to cling to its zero-COVID policy, tourists at Shanghai Disney Resort now find themselves trapped in the park until they can test negative for COVID-19 amid yet another snap lockdown. South China Morning Post explains “…new variants have tested local officials’ ability to snuff out flare-ups faster than they can spread, causing much of the country to live under an ever-changing mosaic of Covid curbs.” The city announced Monday that it was going into lockdown and that visitors to the park would not be allowed to leave “until on-site testing returns a negative result.” SCMP writes, “It added that those who had visited the park since Thursday must obtain three negative Covid tests over three successive days and “avoid participating in group activities.’ The announcement came after Disney said it was “temporarily closing with immediate effect … in accordance with disease control requirements”.”

Turns Out the PRC Is Not the Only Place with Biosafety Issues

The discovery of vials labeled “smallpox” in a Merck & Co. facility near Philadelphia last year, last month’s controversy over Boston University’s NEIDL’s COVID-19 work using chimeric viruses, that time the Department of Defense accidentally mailed live anthrax spores to a US base in South Korea…the US is no stranger to biosafety issues and scares. This is the subject of a three part series of The Intercept, “Experimenting with Disaster,” focused on undisclosed biosafety incidents in the US. The first part focuses on a university lab accident, the second on work with the 1918 flu pandemic’s H1N1 virus, and the third on risky work with avian influenza. The Schar School’s Dr. Gregory Koblentz is quoted throughout the series as he provides context to the political and oversight issues surrounding these and other incidents.

Russia Fails (Again) to Garner International Sympathy for Bogus BW Claims

On Wednesday, the UN Security Council (UNSC) squashed Russia’s attempt to create a formal inquiry into its claims that the US and Ukraine are running a biological weapons program in Ukraine. Of the five permanent UNSC members, only China voted in support of Russia’s draft resolution on the measure. The US, UK, and France all voted against it while the other 10 UNSC members abstained from voting. According to the UN “Through the draft resolution, the 15-member Council would have decided to set up a commission to investigate the complaint of the Russian Federation in the context of the activities of biological laboratories in the territory of Ukraine, as well as present to the 15-member organ a report on the issue containing recommendations by 30 November 2022 and inform the States parties to the Convention at its Ninth Review Conference to be held in Geneva on 28 November–16 December 2022 of the results of the investigation.”

“The draft would also have the Council request the Secretary-General and the Biological Weapons Convention Implementation Support Unit provide, within their respective mandates, all necessary assistance to the commission.”

Cholera Outbreaks on the rise Globally

In case more COVID-19 variants, monkeypox, polio, and Ebola weren’t enough for you this year, the New York Times reports that a “…record number of [cholera] outbreaks have been reported after droughts, floods and wars have forced large numbers of people to live in unsanitary conditions.” So far, outbreaks have been reported in the Caribbean, Africa, the Middle East, and South Asia. NYT also explains “Cholera is typically fatal in about 3 percent of cases, but the World Health Organization says it is killing at an accelerated rate in recent outbreaks, even though it is relatively cheap and easy to treat. It is most often fatal in children, who progress swiftly to severe illness and organ failure.”

However, as case counts grow, vaccine supplies are coming up short. The WHO has already suspended its two-dose recommendation in favor of a single dose regimen that can help stretch supplies. “We have never had to make a decision like this about vaccination before, that’s the severity of this crisis,” Dr. Philippe Barboza, head of the WHO’s cholera team, said.

NYT explains part of why this is an issue, writing “The bulk of the world’s cholera vaccine is made by a South Korean company called EuBiologics. Some 15 percent of the global stockpile was produced by Shantha Biotechnics, a wholly owned Indian subsidiary of the French drugmaker Sanofi, but the company decided two years ago to stop production of its cholera vaccine by the end of this year and end supply by the end of 2023. That planned exit from the market coincides with the spike in demand…Dr. Barboza said that EuBiologics was producing at capacity and working to expand its production, and that another drugmaker would soon begin to produce the vaccine.”

“A Multinational Delphi Consensus to End the COVID-19 Public Health Threat”

Lazarus et al.’s new Nature article discusses findings of a Delphi study focused on the COVID-19 pandemic response: “Despite notable scientific and medical advances, broader political, socioeconomic and behavioural factors continue to undercut the response to the COVID-19 pandemic1,2. Here we convened, as part of this Delphi study, a diverse, multidisciplinary panel of 386 academic, health, non-governmental organization, government and other experts in COVID-19 response from 112 countries and territories to recommend specific actions to end this persistent global threat to public health. The panel developed a set of 41 consensus statements and 57 recommendations to governments, health systems, industry and other key stakeholders across six domains: communication; health systems; vaccination; prevention; treatment and care; and inequities. In the wake of nearly three years of fragmented global and national responses, it is instructive to note that three of the highest-ranked recommendations call for the adoption of whole-of-society and whole-of-government approaches1, while maintaining proven prevention measures using a vaccines-plus approach2 that employs a range of public health and financial support measures to complement vaccination. Other recommendations with at least 99% combined agreement advise governments and other stakeholders to improve communication, rebuild public trust and engage communities3 in the management of pandemic responses. The findings of the study, which have been further endorsed by 184 organizations globally, include points of unanimous agreement, as well as six recommendations with >5% disagreement, that provide health and social policy actions to address inadequacies in the pandemic response and help to bring this public health threat to an end.”

“Lessons Learned from the COVID-19 Outbreak”

New from the RAND Corporation, a volume on COVID-19 that includes chapters on the need to prioritize biosafety and biosecurity, and GOF research: “The coronavirus disease 2019 pandemic that began in late 2019 and continues as of the writing of this Perspective in summer 2022 has been the cause of both tremendous tragedy—in lives lost and economic hardship—and great triumph in the rapid development of effective vaccines. Many nations around the world have scrambled to respond to a once-in-a-century event that has exposed many weaknesses in response planning and capabilities, including those of the United States. Even as the pandemic continues, it is not too early to reflect on the missteps that have been made and lessons that can be learned so that the United States and nations worldwide can be better prepared for the future.”

“This volume contains a collection of essays that explores topics of critical importance toward that aim and identifies actions that can be taken to not only improve pandemic preparedness but also help prevent the occurrence of future pandemics. The essays center on U.S. challenges and experiences, but the solutions, in many cases, require collaborative efforts that reach across national boundaries.”

“The Global Inequality in COVID-19 Vaccination Coverage Among Health and Care Workers”

Nabaggala et al. discuss COVID-19 vaccinations in HCWs in their new article in the International Journal for Equity in Health. Using WHO data, they found that “Despite being considered a priority group, more than a third of countries did not achieve 70% vaccination coverage of their HCWs at the end of 2021. Large inequities were observed with low income countries lagging behind. Additional efforts should be dedicated to ensure full protection of HCWs through vaccination.”

“Bolstering Arms Control in a Contested Geopolitical Environment”

Michael Moodie and Jerry Zhang’s recent issue brief published by the Stimson Center: “For decades, arms control has constituted one of the cornerstone frameworks for global governance and served as a critical tool for bolstering international security and stability. The global arms control regime is now under unprecedented pressure, due to heightened competition between major powers, rapidly deteriorating security environment, and emerging technologies. Nevertheless, cooperation on arms control is important in today’s contested geopolitical environment as it can encourage responsible competition broadly between great powers, avoid the proliferation of advanced weaponry, and reduce the risk of unintended military escalation. This paper recommends three measures to reinvigorate arms control: sustaining long-term engagement between major powers; adopting a multi-stakeholder approach by including smaller states and non-government entities in the process; and reconceptualizing the fundamentals of arms control.”

“Addressing the Global Shortage of Biosafety and Biosecurity Professionals through Education”

The International Federation of Biosafety Associations recently published this white paper discussing their efforts to build undergraduate degree programs designed to create competent biosafety professionals. They write: “Biosafety and biosecurity professionals provide an essential role in safeguarding infectious disease agents in clinical and research laboratories and other settings where biological materials are handled. The COVID-19 pandemic has brought into focus the significant demand on the profession and many countries face an overall shortage of these specialized individuals. Given that biosafety and biosecurity professionals work in laboratories behind the scenes of the frontline response, the profession remains largely unknown to students interested in pursuing a career in the sciences. As such, students tend to be steered towards more visible education paths in the biological and health sciences.”

“To address this gap, the IFBA is leading a multisectoral effort towards a future sustainable workforce by formalizing a biosafety & biosecurity career path within the higher education system. Now is the right time since the recent lived COVID-19 experiences of youth have motivated them to become involved. Over the past 6 months, and with funding support from Global Affairs Canada, the IFBA has been collaborating with Kenya’s Masinde Muliro University of Science and Technology (MMUST) to develop and pilot a new undergraduate BSc degree program specifically in Biosafety and Biosecurity. This new BSc program leverages MMUST’s existing programs in the Department of Medical Laboratory Sciences. All students undertake related core courses in microbiology and related disciplines in the first two years followed by specialized biosafety & biosecurity courses, practical laboratory and field experience and a capstone project in their later academic years.”

“The lessons learned from this pilot program will be used for future program roll out to additional universities across Africa and globally. This project presents a recommended solution towards a sustainable future global workforce of biosafety and biosecurity professionals. Supporting this approach are multisectoral partnerships committed to biosafety and biosecurity education and our common vision of more graduates and young scientists entering the profession.”

“A Plea for Making Virus Research Safer”

Dr. Jesse Bloom’s guest essay in the New York Times offers an overview of notable pathogen research, efforts over the years to make it more secure, and current concerns. In it she writes “The French statesman Georges Clemenceau said, “War is too important to be left to the generals.” When it comes to regulating high-risk research on potential pandemic viruses, we similarly need a transparent and independent approach that involves virologists and the broader public that both funds and is affected by their work.”

“How to Detect a Man-Made Biothreat”

This Wired piece discusses US government funding to develop test that would detect engineered pathogens: “To guard against these potential threats, the US government is funding the development of tests to detect dangerous bioengineered organisms before they have a chance to cause significant harm. The effort was announced in 2017 by the Intelligence Advanced Research Projects Activity, or Iarpa, within the Office of the Director of National Intelligence. In a livestreamed update in October, Iarpa program manager David Markowitz announced that two platforms developed under the program were both 70 percent accurate at identifying the presence of bioengineering. “We simply never know what sample is going to come through the door in a government lab, and we need to be prepared for anything,” Markowitz said during the news briefing.”

“Why Climate Change Matters for Pandemic Preparedness”

Check out this Nature Outlook piece with computational ecologist Xavier Rodó on climate change’s role in pandemic planning: “Numerous studies over more than two decades have demonstrated a robust relationship between climate and the dynamics of human diseases, such as cholera, malaria and dengue. Changes in climate, including both long-term warming trends and short-term climate variability, might affect patterns of disease. Xavier Rodó, a computational ecologist and climate dynamics specialist at the Barcelona Institute for Global Health and the Catalan Institution for Research and Advanced Studies in Spain, spoke to Nature about how climate modelling could be used to help prepare for future disease outbreaks — and the obstacles he has faced in implementing such systems.”

“Chemical Security Experts Call for Multisector Cooperation Against Terrorism”

From INTERPOL: “The devastating impact of chemical weapons and explosives used in acts of terrorism continues to affect civilian populations and is well known for its destructive and long-term harm.”

“Last year over 1,000 improvised explosive device (IED) attacks were conducted by non-state actors, injuring over 7,150 people in more than 40 countries. Many attacks come from chemicals that criminals acquired through weak points in the supply chain – from manufacturing to storage and retail– and made into weapons.”

“To counter this threat, some 220 chemical security practitioners from more than 70 countries met at INTERPOL’s 3rd Global Congress on Chemical Security and Emerging Threats (25-27 October) to find ways of reducing vulnerabilities by enhancing multisector cooperation and collaboration.” Read more here.

What We’re Listening To 🎧

THE RETORT: EPISODE 4 Gain of Function Experiments

The latest episode of Dr. Brett Edwards’ podcast, The Retort, offers “A straightforward introduction to the past decade of discussion of international oversight of gain of function pandemic research,” with Dr. Nariyoshi Shinomiya of Japan’s National Defense Medical College. This episode and previous ones are available on Dr. Edwards’ YouTube channel. His other podcast project, Poisons and Pestilence, also recently reached 7,000 listens. In celebration, he is hosting a t-shirt give away, so be sure to check that out here.

Conversations Before Midnight

The Bulletin of the Atomic Scientists is hosting its Bulletin Annual Gathering on November 9, 2022, at 5 pm CDT virtually. This is the Bulletin’s “signature event” and it aims to allow guests to engage in high-level conversations with influential voices tracking man-made threats. At the event, “Each virtual table has an expert, established and up-and-coming specialists in the fields of nuclear risk, climate change, disruptive technologies, and biosecurity. These discussion leaders include members of the Bulletin’s Science and Security Board, Board of Sponsors, and invited experts from around the world. Below are a few samples for this year’s gathering.”‘ Table experts include our own Dr. Greg Koblentz, so be sure to check out this event’s info page here.

Briefings in Preparation for the Ninth BWC Review Conference

From UNIDR: “The 1972 Biological Weapons Convention (BWC) is a cornerstone in the regime to prevent the hostile use of biology. The Ninth BWC Review Conference will take place in late November 2022 and presents an important opportunity to take stock of the past and chart a course for the future of this increasingly important agreement. In support of preparations for the Ninth BWC Review Conference and beyond, UNIDIR has recently published several reports intended to stimulate thinking on substantive issues related to the BWC.”

“This virtual event will bring together the authors of the latest UNIDIR publications on BWC topics to provide short outlines of the key insights and ideas in their respective reports for State Parties to consider ahead of the Review Conference. These include verification, advances in science and technology, international cooperation, and potential outcomes of the Review Conference. The presentations will be followed by a moderated interactive discussion with the participants.” This event will take place on November 7 at 2 pm CET, online. Learn more and register here.

Infection Prevention and Control: Incorporating Lessons Learned in Managing Special Pathogens

“After nearly three years responding to the COVID-19 pandemic, hospitals and other healthcare facilities have learned many lessons about the management of special pathogens and essential infection prevention and control practices. The U.S. Department of Health and Human Services (HHS) Administration for Strategic Preparedness and Response’s Technical Resources, Assistance Center, and Information Exchange (ASPR TRACIE) and the National Emerging Special Pathogens Training and Education Center (NETEC) invite you to learn more about some of those lessons. Speakers will share their perspectives on how our approach to outbreaks has changed since the pandemic began. They will address issues such as infection prevention for healthcare workers and patients and mitigating disease spread. Speakers will also highlight newly developed tools and resources. This webinar will take place November 7 at 2:00 pm ET. Register today!”

WHO/AFRO Fellowship Programme on Public Health Emergencies in Africa

“The World Health Organization Regional Office for Africa (WHO AFRO) invites interested and eligible candidates to submit applications for a fellowship programme on improving the management of public health emergencies in Africa under the COVID-19 Incident Management Support Team (IMST).” Learn more and apply here.

Pandora Report: 10.28.2022

Happy Halloween! This week we haves lots of scares for you, including even more misuse of international organizations to further disinformation narratives! This week, we focus on Russia’s request for a UNSC investigation of its bogus BW claims and complaint lodged in accordance with Article VI of the BWC, the Senate Health, Education, Labor and Pensions minority report on SARS-CoV-2 origins, and ongoing debates about the SARS-CoV-2 experiments conducted at Boston University. We also cover new publications, upcoming events, and new announcements ahead of One Health Day.

Russia Criticized Heavily After Calling for UNSC Resolution on “Secret Biolabs in Ukraine”

In yet another massive waste of everyone’s time, Russia has continued to press its false claims that the US runs “secret military biological programs” in Ukraine with the UN Security Council, this time drafting a resolution that would establish a commission (comprised of all 15 UNSC members) to investigate the claims. This comes amid a new wave of “transparently false allegations” on the part of Moscow, most recently regarding alleged Ukrainian plans to use a dirty bomb in its own territory. In response to this latest effort at the Security Council, the UK’s Ambassador to the UN, Dame Barbara Woodward, asked the question on everyone’s mind-“How much more of this nonsense do we have to endure?”

This newest attempt includes an official complaint to the UNSC, filed in accordance with article VI of the BWC, in addition to the request for the formation of a formal commission to investigate the October 24 complaint. The complaints continue to center on efforts between the US and Ukraine, largely under the Cooperative Threat Reduction program, to support public health research and diagnostic facilities, though Russia insists these facilities are not for peaceful purposes.

In a Thursday briefing before the Security Council, the UN Office for Disarmament Affairs (UNODA) reiterated again that it is not aware of any biological weapons programs in Ukraine, echoing its previous statements on the matter made in March and May. In response, Russia’s Ambassador Vassily Nebenzia said, “Do you really think that we’re that naïve?…Do you really think that we think that the Pentagon is going to inform the high representative of the Office of Disarmament Affairs within the UN about their secret biological programs in Ukraine?”

US Ambassador to the UN, Linda Thomas-Greenfield, summarized the absurdity of Russia’s claims, explaining “We hear Russia raise alarms that biological weapons will be delivered by birds and bats and now even mosquitoes. Birds and bats. Russia knows public health laboratories routinely study migratory animal species to assess and counter animal-borne pathogens. Bear in mind, much like Russia, birds and bats don’t tend to observe or respect sovereign borders. Russia’s assertions are absurd for many reasons, including because such species, even if they could be weaponized, would pose as much a threat to the European continent and to Ukraine itself as they would to any other country.”

Thomas-Greenfield also described the meeting as a “…colossal waste of time… an attempt to distract from the atrocities Russian forces are carrying out in Ukraine and a desperate tactic to justify an unjustifiable war.” She later added, “It doesn’t matter how many meetings Russia tries to call on this subject. And it doesn’t matter how hard it ratchets up its propaganda machine. We must not divert UN resources toward a baseless investigation. And we must not allow Russia’s tactics to distract us from its brutal war of aggression.”

Senate HELP Committee Minority Interim Report Released on SARS-CoV-2 Origins

This week, the Senate Health, Education, Labor and Pensions (HELP) Committee Minority oversight staff released their interim report-“An Analysis of the Origins of the COVID-19 Pandemic”. The report makes a number of claims, including “While it remains possible that SARS-CoV-2 emerged as a result of a natural zoonotic spillover, facts and evidence found in previous documented zoonotic spillover events have not, to date, been identified in relation to this pandemic,” “Substantial evidence suggests that the COVID-19 pandemic was the result of a research-related incident associated with a laboratory in Wuhan, China,” and “This investigation’s interim report concludes that SARS-CoV-2 and the resulting COVID-19 global pandemic was, more likely than not, the result of a research-related incident associated with coronavirus research in Wuhan, China.”

The 35-page report does not completely rule out a market origin and, importantly, it does not claim that SARS-CoV-2 was engineered as a bioweapon-a popular conspiracy theory. One interesting element it does focus on is that Chinese scientists began testing their COVID-19 vaccines in humans about a month before the United States did. The report implies this means the Chinese had some sort of advanced (pre-January 11, 2020) access to genomic sequencing, though it does still ask “What additional steps, processes, or novel techniques did AMMS [PLA Academy of Military Medical Sciences] researchers take that advanced the development of their vaccine faster than the Operation Warp Speed timeline?” The report states, “While mRNA vaccine candidates were able to design their vaccine construct in two days, because mRNA vaccines only need the coronavirus’ genetic sequence to make a vaccine and no virus has to be cultivated in labs, traditional vaccine platforms take longer.” It continues, highlighting that the first Operation Warp Speed (OWS) vaccine candidates to enter human clinical trials were non-mRNA vaccines-AstraZeneca-Oxford’s offering and Johnson & Johnson’s, both viral vector vaccines.

It then contrasts the 8 months it took for OWS viral vector candidates to human clinical trials with the 67 days it took one AMMS team to do the same, writing “Given Operation Warp Speed’s success, it is unusual that the two AMMS COVID-19 vaccine development teams were able to reach early milestones in vaccine development even more quickly. The Chen AMMS team beat AstraZeneca-Oxford to phase I clinical trials by 38 days. The Zhou AMMS team built and validated the effectiveness of its COVID-19 candidate vaccine 44 days after the sequence of SARS-CoV-2 was released. The extremely accelerated vaccines development timelines achieved by the AMMS teams pose the following two outstanding questions:”

  • “What additional steps, processes, or novel techniques did AMMS researchers take that advanced the development of their vaccine faster than the Operation Warp Speed timeline?”
  • “If no additional steps were taken to speed up the development timeline, when did researchers in China have access to the genomic sequence? Was it before January 11, 2020? If so, how far in advance of January 11, 2020?”

This argument does not address differences in the regulatory environments of the US and PRC. Rather, it seems to imply that this is evidence the Chinese had advance knowledge of this outbreak with no discussion of drug and therapeutic approval reforms in recent years that aim to improve the country’s ability to compete in pharmaceutical manufacturing globally and incentivizes development of vaccines and drugs for rare diseases. The CCP has identified competition in global biopharmaceutical manufacturing as a top priority, so the implication that the faster timeline to clinical trials supports the lab leak theory is unsatisfactory as presented.

It also does not appear to have even won over prominent supporters of the lab leak theory, including Dr. Richard Ebright, a molecular biologist at Rutgers University. The New York Times explains, “Dr. Ebright, who was interviewed by the report’s authors, said he supported the argument that evidence pointed to a laboratory origin. But the only new element, he said, appeared to be questions raised about how China could have developed a vaccine so quickly, which he did not find persuasive. Otherwise, he said, “there was no information in the report that has not been publicly presented in the media and discussed in the media previously.”

“This image depicted a test tube with viral transport media that contained a patient’s sample to be tested for the presence of SARS-CoV-2, the virus that causes COVID-19.” Source: CDC PHIL

Naturally, this interim report has been heavily criticized. The conclusion reached in this report obviously differs from the two peer-reviewed Science articles published earlier this year that found 1) the Huanan Seafood Wholesale Market was the epicenter of the initial outbreak and 2) that there were at least two distinct spillovers from animals sold at the market. Scientists supporting the market origin still have not identified which animals were infected or where they came from, as no animals were tested before the market was shut down early in 2020. Of this, the report states “Critical corroborating evidence of a natural zoonotic spillover is missing. While the absence of evidence is not itself evidence, the lack of corroborating evidence of a zoonotic spillover or spillovers, three years into the pandemic, is highly problematic.”

Dr. Michael Worobey, Department Head of Ecology and Evolutionary Biology at the University of Arizona and a co-author of both the Science articles, addressed the report with Science news, with the news team writing “Michael Worobey, an evolutionary biologist at the University of Arizona who has co-authored scientific reports examining data from the early days of the pandemic that provide some of the strongest support for a jump from animals to humans, speculates that the timing of the report’s release could be “a cynical effort to try to win Republican votes” in the upcoming midterm congressional and state elections.  Or, Worobey says, “it could just be a bunch of staffers with no ability to understand the science who stumbled across a bunch of misinformation and disinformation-filled tweets.” (“Senator Burr felt enough compelling, open-source information had been gathered during staff’s comprehensive review of the facts that an interim report was appropriate,” a senior aide to the minority staff told Science.)”

After the minority interim report was released, Senator Patty Murray, Chair of the Senate HELP Committee, issued a statement on “continuing bipartisan oversight efforts into the origins of the virus that causes COVID-19” that did not address the minority report. Sen. Murray stated “COVID-19 has caused so much pain, hardship, and loss for people in Washington state, across our country, and all across the globe. As I’ve said time and again, it is absolutely critical we learn the lessons from this pandemic so that we never find ourselves in a similar situation again—and that, of course, includes undertaking a full examination of how COVID-19 first emerged.”

“That’s why I made it a top priority as Chair to craft bipartisan legislation to strengthen our public health and pandemic preparedness systems with the PREVENT Pandemics Act—which, among so many other vital steps, would establish an independent task force to conduct a comprehensive review of COVID’s origins and the federal response to the pandemic. And it’s why, in 2021, I announced a bipartisan oversight effort with Senator Burr into the origins of this virus. The HELP Committee is continuing bipartisan work on this oversight report, and I remain committed to passing the PREVENT Pandemics Act, which advanced out of Committee with overwhelming bipartisan support.”

More on the Boston University Controversy

While the controversy surrounding experiments conducted on SARS-CoV-2 at Boston University has subsided some, attention has shifted to how such research is regulated. The New York Times explains the concerns, writing “But the uproar highlighted shortcomings in how the U.S. government regulates research on pathogens that pose a risk, however small, of setting off a pandemic. It revealed loopholes that allow experiments to go unnoticed, a lack of transparency about how the risk of experiments is judged and a seemingly haphazard pattern in the federal government’s oversight policy, known as the P3CO framework.” It also notes “Even as the government publicly reprimanded Boston University, it raised no red flags publicly about several other experiments it funded in which researchers manipulated coronaviruses in similar ways. One of them was carried out by the government’s own scientists.”

“Colorized scanning electron micrograph of a cell infected with a variant strain of SARS-CoV-2 virus particles (green), isolated from a patient sample.” Source: NIH Image Library

Nature explains the issue further, writing “At issue is whether — and when — researchers modifying SARS-CoV-2 or other deadly pathogens need to keep regulators and funding agencies such as the US National Institutes of Health (NIH) informed about their work, even if the agencies didn’t fund the experiments in question. Studies that make pathogens more transmissible or virulent are sometimes called ‘gain of function’ research.”

The issue now being discussed is if federal guidance is too vague in explaining what disclosures are required after a proposal is approved and research is progressing. Dr. Greg Koblentz told The New York Times “The government should be providing the guidance to help people figure this out,” and explained to Grid that “Pandemic prevention and lab safety rules “only move in fits and starts,” said biodefense professor Gregory Koblentz of George Mason University, pointing to the long list of past controversies. “And we only make progress where there is some crisis, or perceived crisis, that grabs people’s attention.”

Koblentz also commented on the confusion surrounding “gain of function”, telling Grid “‘Gain of function’ — we should retire that term, it really doesn’t help us in that debate,” said Koblentz. “It has become shorthand for a class of research that people are worried about because of the risks it poses, but it is a term that really has outlived its usefulness.” The term garnered attention during a number of political debates, including back-and-forths between Senator Rand Paul and Dr. Anthony Fauci.

Grid also noted that, though many experts disagree on the utility of the term “gain of function, “There’s one point all of the experts who spoke to Grid agreed on — the Boston University chimera experiments do point to a need for stronger federal government oversight of potentially dangerous bugs. The fact that we are still debating whether to review genetically altering known pandemic pathogens, not even potential ones, said Koblentz, “is an indictment of both the self-governance model that the virology community largely supports and the current policy.”

NCT Magazine

In this issue focused on 4th generation chemical weapons, several experts offer their perspective on existing and emerging issues. Drs. Stefano Costanzi and Gregory Koblentz authored a piece for this issue, “Controlling Novichok Nerve Agents After the Skripal and Navalny Incidents”. They cover the history of this family of nerve agents and international disarmament and nonproliferation attempts before discussing the Skripal and Navalny incidents as evidence that both the Chemical Weapons Convention and Australia Group Chemical Weapons Precursors list need to be revised to better address Novichok agents. They conclude “The ability of the CWC and AG to adapt to the new challenge posed by these fourth-generation nerve agents demonstrates the resilience of the chemical weapon nonproliferation regime. However, further measures need to be implemented to reduce the opportunities for proliferators to develop and use Novichok nerve agents. Embracing a family-based approach to listing chemicals of proliferation concern would strengthen the nonproliferation regime and the adoption of technologies such as cheminformatics can facilitate the transition to this new approach to containing the threat posed by chemical weapons.”

“Designation of Three Syrian Military Officials Due to Involvement in Gross Violations of Human Rights”

On the topic of chemical weapons, the US State Department recently designated multiple military officials from the Syrian regime, it declared in a press release this week. The statement reads in part, “Of the atrocities committed by the Assad regime, some of which rise to the level of war crimes and crimes against humanity, few are as inhumane and abhorrent as the repeated use of chemical weapons against civilians.  In August 2013, the Syrian Artillery and Missile Directorate of the Syrian Armed Forces launched rockets carrying the nerve agent sarin, a deadly chemical, on Ghouta, a suburb of Damascus, killing at least 1,400 people, many of them children.  Today, we are taking additional action to promote accountability.”

“The Department of State is designating three Syrian regime military officials involved in these airstrikes, pursuant to Section 7031(c) of the Department of State, Foreign Operations, and Related Programs Appropriations Act, 2022.  Brigadier General Adnan Aboud Hilweh, Major General Ghassan Ahmed Ghannam, and Major General Jawdat Saleebi Mawas were involved in gross violations of human rights, namely the flagrant denial of the right to life of at least 1,400 people in Ghouta. As a result of today’s action, Hilweh, Ghannam, and Mawas as well as their immediate family members are ineligible for entry into the United States.”

“To Fix American’s Biodefense Strategy, Think Smaller”

From Breaking Defense: “It’s a natural reflex for the US government to try to develop strategies to deal with issues as broadly as possible, to handle a wide array of contingencies. But in the op-ed below, Al Mauroni of Air University’s Center for Strategic Deterrent Studies argues that the Biden administration’s biodefense strategy, expanding on past strategies, has grown too cumbersome and is in need of a cure of its own.”

ASPR TRACIE on Major Radiological or Nuclear Incidents

ASPR’s Healthcare Emergency Preparedness Information Gateway (TRACIE) recently released this updated document providing an “overview of health and medical response and recovery needs following a radiological or nuclear incident…” It also outlines resources for planners. Other relevant resources can also be found on the TRACIE CBRN page.

“Preventing and Preparing for Pandemics with Zoonotic Origins”

This piece from the Council on Foreign Relations discusses how factors that drive pathogen emergence and spread should influence decisions on investments in pandemic preparedness and response. It discusses priority pathogens, primary pandemic prevention, and secondary pandemic prevention and pandemic preparedness, concluding that “There is unprecedented support at the highest levels of government to enhance global pandemic prevention and preparedness. The recent decision to create a new fund for pandemics out of the World Bank and the ongoing negotiation for a pandemic agreement within the World Health Organization are potentially transformational. It is critical that comprehensive action be taken quickly through these efforts before the world’s collective attention moves on to the next crisis. Failure to do so means future generations will live less healthy and productive lives than we have today.”

“COVID-19 Genomic UK (COG-UK) Consortium: Final Report”

In this article from RAND Health Quarterly, Marjanovic et al. write in their abstract “The ability to sequence and understand different variants of the SARS-CoV-2 virus and their impact is crucial to inform policy and public health decisions. Soon after the UK went into its first lockdown in March 2020, the CCOVID-19 Genomics UK (COG-UK) Consortium was launched. COG-UK is a collaboration of experts in pathogen genomics including academic institutions, public health agencies, the Wellcome Sanger Institute, NHS Trusts and Lighthouse Labs. RAND Europe evaluated how COG-UK delivered against its objectives, for example how it contributed to advancing scientific knowledge about SARS-CoV-2, informing public health decisions, and providing information that can be used to evaluate the effectiveness of vaccines and treatments. The evaluation also examined the diverse factors that influenced COG-UK progress and impact, including enablers and challenges, and considered implications for the future.”

Coronavirus Vaccines R&D Roadmap

From CIDRAP: “CIDRAP, with support from the Bill & Melinda Gates Foundation and The Rockefeller Foundation, has led an international collaborative effort to develop a coronavirus vaccines research and development (R&D) roadmap (CVR). The CVR aims to serve a strategic planning tool to facilitate R&D, coordinate funding, and promote stakeholder engagement aimed at generating broadly protective coronavirus vaccines.”

“A key component of roadmap development is gathering feedback via a public comment period. The draft CVR is now available for a 4-week public comment period from October 24 – November 18, 2022. Feedback gathered during the public comment period will be used to refine the roadmap, resulting in a final roadmap made available in early 2023.”

“The draft CVR may be downloaded in PDF format. Comments should be submitted via this survey, which will be available through November 18, 2022. The survey offers the opportunity to share general and specific comments on the roadmap; the team welcomes as little or much feedback as you would like to provide.”

“The Future of Infodemic Surveillance as Public Health Surveillance”

In this recent piece from a supplement issue of Emerging Infectious Diseases, Chiou et al. write “Public health systems need to be able to detect and respond to infodemics (outbreaks of misinformation, disinformation, information overload, or information voids). Drawing from our experience at the US Centers for Disease Control and Prevention, the COVID-19 State of Vaccine Confidence Insight Reporting System has been created as one of the first public health infodemic surveillance systems. Key functions of infodemic surveillance systems include monitoring the information environment by person, place, and time; identifying infodemic events with digital analytics; conducting offline community-based assessments; and generating timely routine reports. Although specific considerations of several system attributes of infodemic surveillance system must be considered, infodemic surveillance systems share several similarities with traditional public health surveillance systems. Because both information and pathogens are spread more readily in an increasingly hyperconnected world, sustainable and routine systems must be created to ensure that timely interventions can be deployed for both epidemic and infodemic response.”

COVID Taking the Fun Out of Fungi?

The WHO recently released its first fungal priority pathogens list (FPPL)- “the first global effort to systematically prioritize fungal pathogens, considering their unmet research and development (R&D) needs and perceived public health importance.” The WHO explains that “The WHO FPPL aims to focus and drive further research and policy interventions to strengthen the global response to fungal infections and antifungal resistance. The WHO FPPL list is divided into three categories: critical, high and medium priority. The report presents these categories and proposes actions and strategies for policymakers, public health professionals and other stakeholders; targeted at improving the overall response to these priority fungal pathogens including preventing the development of antimicrobial resistance. Three primary areas for action are proposed, focusing on: (1) strengthening laboratory capacity and surveillance; (2) sustainable investments in research, development, and innovation; and (3) public health interventions.”

This comes amid a spike in certain fungal diseases during the COVID-19 pandemic. Additionally, the report found that “Currently, fungal infections receive less than 1.5% of all infectious disease research funding,” and that “most treatment guidelines are informed by limited evidence and expert opinion.”

Opinion: “To Fight Misinformation, We Need to Teach That Science Is Dynamic”

In this piece for Scientific American, Dr. Carl Bergstrom, Daniel Pimentel, and Dr. Jonathan Osborne discuss public ignorance of the scientific community, identifying ways this can be rectified. They write, “It’s easy to see why so many of us struggle to distinguish trustworthy science from what is flawed, speculative or fundamentally wrong. When we don’t learn the nature of consensus, how science tends to be self-correcting and how community as well as individual incentives bring to light discrepancies in theory and data, we are vulnerable to false beliefs and antiscience propaganda. Indeed, misinformation is now a pervasive threat to national and international security and well-being.”

They discuss the need to develop a population of competent outsiders, explaining “Giving people more facts is insufficient. Instead, we need a populace that can tell which sources of information are likely to be reliable, even if the science itself is beyond what they learned in school, so that they can identify when they need scientific information to make decisions in their own lives. Just as critically, people must understand enough about how science attempts to minimize error. In other words, every member of our society needs to be what science education researcher Noah Feinstein calls a “competent outsider.”

What We’re Listening To 🎧

This Week in Virology 948: Breathless with David Quammen

“David Quammen returns to TWiV to discuss how he wrote his new book ‘Breathless’, a story about the science and the scientists behind the race to understand the pandemic coronavirus SARS-CoV-2.” Listen here.

Conversations Before Midnight

The Bulletin of the Atomic Scientists is hosting its Bulletin Annual Gathering on November 9, 2022, at 5 pm CDT virtually. This is the Bulletin’s “signature event” and it aims to allow guests to engage in high-level conversations with influential voices tracking man-made threats. At the event, “Each virtual table has an expert, established and up-and-coming specialists in the fields of nuclear risk, climate change, disruptive technologies, and biosecurity. These discussion leaders include members of the Bulletin’s Science and Security Board, Board of Sponsors, and invited experts from around the world. Below are a few samples for this year’s gathering.”‘ Table experts include our own Dr. Greg Koblentz, so be sure to check out this event’s info page here.

Briefings in Preparation for the Ninth BWC Review Conference

From UNIDR: “The 1972 Biological Weapons Convention (BWC) is a cornerstone in the regime to prevent the hostile use of biology. The Ninth BWC Review Conference will take place in late November 2022 and presents an important opportunity to take stock of the past and chart a course for the future of this increasingly important agreement. In support of preparations for the Ninth BWC Review Conference and beyond, UNIDIR has recently published several reports intended to stimulate thinking on substantive issues related to the BWC.”

“This virtual event will bring together the authors of the latest UNIDIR publications on BWC topics to provide short outlines of the key insights and ideas in their respective reports for State Parties to consider ahead of the Review Conference. These include verification, advances in science and technology, international cooperation, and potential outcomes of the Review Conference. The presentations will be followed by a moderated interactive discussion with the participants.” This event will take place on November 7 at 2 pm CET, online. Learn more and register here.

Infection Prevention and Control: Incorporating Lessons Learned in Managing Special Pathogens

“After nearly three years responding to the COVID-19 pandemic, hospitals and other healthcare facilities have learned many lessons about the management of special pathogens and essential infection prevention and control practices. The U.S. Department of Health and Human Services (HHS) Administration for Strategic Preparedness and Response’s Technical Resources, Assistance Center, and Information Exchange (ASPR TRACIE) and the National Emerging Special Pathogens Training and Education Center (NETEC) invite you to learn more about some of those lessons. Speakers will share their perspectives on how our approach to outbreaks has changed since the pandemic began. They will address issues such as infection prevention for healthcare workers and patients and mitigating disease spread. Speakers will also highlight newly developed tools and resources. This webinar will take place November 7 at 2:00 pm ET. Register today!”

From One Health Commission-World Bank Open Call

“Open Call for Experts to serve on the Technical Advisory Panel to the Governing Board of the Pandemic Prevention, Preparedness and Response Financial Intermediary Fund (“PPR FIF”)”- November 3 Deadline

“World Bank has posted a call for experts to serve on the Technical Advisory Panel (TAP) to the Governing Board of the Pandemic Prevention, Preparedness and Response Financial Intermediary Fund (“PPR FIF”).”

“The TAP will comprise a multidisciplinary pool of up to 20 experts, bringing a diverse range of independent technical and financial expertise relevant to PPR FIF-supported projects and activities. To register your interest in being considered for the PPR FIF TAP, please submit documents to ppr_fif_secretariat@worldbank.org using the subject line “Expression of interest for the PPR FIF TAP

Speaking of One Health…November 3 is One Health Day

Mark your calendars for this year’s One Health Day on November 3. One Health Day is an international campaign that was launched in 2016. The One Health Commission explains that “The goal of One Health Day is to bring attention around the world to the need for One Health interactions and for the world to ‘see them in action’. The One Health Day campaign is designed to engage as many individuals as possible from as many arenas as possible in One Health education and awareness events, and to generate an inspiring array of projects worldwide.” If you are hosting an event on this day, you can register your event here with the Commission. A list of registered One Health Day events for 2022 is also available here.

Pandora Report: 10.21.2022

It’s Friday again and this time we are kicking it off with some great news from our program. We then discuss the Biden administration’s new National Biodefense Strategy and the Boston University preprint controversy. As always, we finish the week out with new publications and upcoming events, including an entire issue supplement of Clinical Infectious Diseases dedicated to anthrax. Finally, mark your calendars, because November 3 is One Health Day (more on that in the announcements section).

First, Some Good News from the Biodefense Program!

Biodefense Faculty Member Joins Council on Strategic Risks and Wins Schar School of Policy and Government Distinguished Alumni Award…All in One Week!

This week, Dr. Saskia Popescu, an epidemiologist, prominent infection prevention consultant, an assistant professor at the Schar School, and more (No, seriously, she does all that AND more.) was named a Senior Fellow at the Janne E. Nolan Center on Strategic Weapons at the Council on Strategic Risks. In case that somehow was not enough for one week, she is also being honored today as this year’s Schar School of Policy and Government Distinguished Alumni Award winner. Read all about Dr. Popescu’s hero origin story here on the Schar School site.

Biodefense PhD Student Named Bulletin of the Atomic Scientists Editorial Fellow

Kimberly Ma, a first year Biodefense PhD student and senior analyst with the Preparedness division at the Association of State and Territorial Health Officials, was recently named an Editorial Fellow at the Bulletin of the Atomic Scientists. Over the next year, she will author a number of pieces on biosecurity for the Bulletin, so keep an eye out for her upcoming work!

The Biden Administration Releases New National Biodefense Strategy

This week, the White House announced the release of the new National Biodefense Strategy and President Biden’s intent to sign National Security Memorandum 15-“Countering Biological Threats, Enhancing Pandemic Preparedness, and Achieving Global Health Security”. The strategy takes a comprehensive approach, aiming to make improvements in these areas-“detect pandemic and other biological threats, “prevent outbreaks from becoming epidemics and prevent biological incidents before they can happen,” “prepare for pandemics and other biological incidents,” “rapidly respond to outbreaks when they occur,” and “recover from a pandemic or biological incident.”

Among other points about the strategy, the Nuclear Threat Initiative explains that “The new strategy’s requirement that the National Security Council and the Office of Science and Technology Policy conduct an interagency policy review regarding biosafety and biosecurity norms and oversight for life sciences research also is valuable. As the largest funder of bioscience and biotechnology research and development in the world, the U.S. Government has a responsibility to put guardrails in place to prevent laboratory accidents or deliberate misuse of the tools of modern bioscience and biotechnology. Doing so can have a profound direct impact in reducing global biological risks and serve as a valuable example for other funders around the world.”

National Security Memorandum 15, “National Security Memorandum on Countering Biological Threats, Enhancing Pandemic Preparedness, and Achieving Global Health Security,” directs the heads of agencies addressed to:

  1. “implement the Biodefense Strategy, as well as related strategies such as the U.S. Global Health Security Strategy, and include biodefense-related activities, including resourcing and achieving the goals of the Biodefense Strategy and the priorities, targets, and actions of its Implementation Plan, within their strategic planning and budgetary processes;
  2. in the event of the determination of a nationally or internationally significant biological incident, implement Federal response efforts in accordance with Homeland Security Presidential Directive 5 of February 28, 2003 (Management of Domestic Incidents), Presidential Policy Directive 8 of March 30, 2011 (National Preparedness), Presidential Policy Directive 44 of November 7, 2016 (Enhancing Domestic Incident Response), and Federal Government response and recovery frameworks and operational plans;
  3. coordinate their biodefense policies with other agencies that have responsibilities or capabilities pertaining to biodefense, as well as with appropriate non-Federal entities;
  4. share information and coordinate decision-making related to the biodefense enterprise; and
  5. monitor, evaluate, and hold their respective agencies accountable for the implementation of section 3(a) of this memorandum.”

The memorandum also states that “To facilitate effective implementation of the Biodefense Strategy, within 90 days of the date of this memorandum and at least quarterly thereafter, the NSC staff Directorate for Global Health Security and Biodefense shall convene lead agencies identified in the Biodefense Strategy’s Implementation Plan at the Assistant Secretary level.  These agencies shall brief the NSC staff on progress towards key milestones and timelines, as well as on critical gaps and barriers to progress.  The NSC staff Directorate for Global Health Security and Biodefense shall provide updates quarterly to the APNSA based off of these briefs, summarizing progress towards the implementation of the Biodefense Strategy by highlighting the extent to which the goals and objectives are being met, outlining major gaps and impediments to timely and effective implementation, and presenting options for overcoming these gaps.  The APNSA shall provide to the President, on an annual basis, a memorandum summarizing these updates.”

Transcripts of the background call on this new strategy are available here, and check out the Council on Strategic Risks discussion of the strategy here.

Boston University Controversy

Last week, researchers from Boston University’s (BU) National Emerging Infectious Diseases Laboratories (NEIDL) posted results from their controversial work on BA.1 variant spike proteins in preprint. As Science explains, “They took the gene for Omicron’s surface protein, or spike protein, which SARS-CoV-2 uses to enter cells and added it to the genome of a “backbone” virus—a variant of SARS-CoV-2 from Washington state that was identified soon after the pandemic first emerged in Wuhan, China, in early 2020. The objective was to tease apart whether Omicron’s spike protein explains why it is less pathogenic (meaning it causes less severe disease). The answer could lead to improved COVID-19 diagnostic tests and better ways to manage the disease, the preprint authors say.”

“This illustration, created at the Centers for Disease Control and Prevention (CDC), reveals ultrastructural morphology exhibited by coronaviruses. Note the spikes that adorn the outer surface of the virus, which impart the look of a corona surrounding the virion, when viewed electron microscopically. A novel coronavirus, named Severe Acute Respiratory Syndrome coronavirus 2 (SARS-CoV-2), was identified as the cause of an outbreak of respiratory illness first detected in Wuhan, China in 2019. The illness caused by this virus has been named coronavirus disease 2019 (COVID-19).”; Source: CDC PHIL

By Monday, a UK tabloid, Daily Mail, ran with the story, indicating in their headline that the lab had created a strain of SARS-CoV-2 with an “80 percent kill rate,” and had created a much more dangerous strain of the virus. While the Daily Mail piece is very clearly from a tabloid, this did spark debate online, as this preprint describes what some argue is gain of function research. This work was not approved by the National Institutes of Health, though it was approved by the institutional biosafety committee at NEIDL. Critics argue that this study lacks scientific value and that its potential risks were not properly reviewed before it was conducted. Some, including Francois Balloux, a virologist at University College London, expressed concern over the study’s relevance to human health, noting that findings in mice frequently do not carry over to humans. Others, however, are far less alarmed, generally arguing that the hybrid virus is far less lethal than the original, pointing to the extreme sensitivity of the mice used in the study, and highlighting that similar SARS-CoV-2 variants have already emerged before later fading away.

The university responded to accusations made in the Daily Mail, stating “We want to address the false and inaccurate reporting about Boston University COVID-19 research, which appeared today in the Daily Mail,” said the BU statement. “First, this research is not gain-of-function research, meaning it did not amplify the Washington state SARS-CoV-2 virus strain or make it more dangerous. In fact, this research made the virus replicate less dangerous.” BU also explained that “The animal model that was used was a particular type of mouse that is highly susceptible, and 80 to 100 percent of the infected mice succumb to disease from the original strain, the so-called Washington strain,” says Corley. “Whereas Omicron causes a very mild disease in these animals.” On the topic of funding, BU said the lab “…did not amplify the [backbone] SARS-CoV-2 virus strain or make it more dangerous. In fact, this research made the virus replicate less dangerous,” as reason for not reporting the study to NIH. They also stated this work did not need to be cleared by NIH as it was not directly funded by the agency as the lab used NIAID grants only to pay for tools and platforms.

Science reports that “Emily Erbelding, director of the NIAID division that helped fund the work, said the hybrid virus experiments weren’t described in BU’s grant proposal or progress reports. But she said if BU had informed NIAID about its plans, the institute probably would have evaluated it to determine whether it qualified for review by a special Department of Health and Human Services (HHS) committee.”

NIH also released a statement this week: “The National Institute of Allergy and Infectious Diseases (NIAID), part of the National Institutes of Health, did not review nor issue awards for experiments described in a pre-print article on SARS-CoV-2 research at Boston University’s National Emerging Infectious Diseases Laboratories (NEIDL). NIH is examining the matter to determine whether the research conducted was subject to the NIH Grants Policy Statement or met the criteria for review under the HHS Framework for Guiding Funding Decisions about Proposed Research Involving Enhanced Potential Pandemic Pathogens (HHS P3CO framework)…”

While the debate is sure to keep raging, it is also likely to add fuel to the ongoing review of federal oversight policies for GoF research led by the National Science Advisory Board for Biosecurity (NSABB). According to Science, “In September, an NSABB task force issued a draft report that recommended the review policy be expanded to sweep in some kinds of research, and some pathogens, that are now exempt. And experts on all sides of the GOF debate have said the criteria for review need to be clearer. The government is expected to release new rules as early as next year. (For more, see this week’s feature in Science.)”

However, as Science has also previously written, “A U.S. clampdown will have no sway over privately funded GOF research or what happens in other countries, which typically lack policies like the P3CO framework. In Japan and most of Europe, for example, oversight is limited to rules on biosafety and, sometimes, biosecurity along with voluntary self-regulation, say biosecurity experts Gregory Koblentz of George Mason University and Filippa Lentzos of King’s College London. It’s too soon to say how a 2020 Chinese biosafety law will affect PPP research, they say.”

“National Security Snapshot: Department of Defense and Intelligence Community Preparedness for Biological Threats”

The Government Accountability Office (GAO) recently released this National Security Snapshot co-authored by Dr. Brian Mazanec, an alumnus of the Biodefense PhD program. This snapshot discusses core issues like biopreparedness and the PRC’s intent to exploit US genetic data. The authors write, “We made several key recommendations to improve how DOD and the Intelligence Community prepare for and respond to biological threats. DOD is taking a number of positive steps, such as coordinating with partners to research and develop vaccines. But, DOD doesn’t have a comprehensive strategy that, for example, shows where biodefense resources are needed.”

“Public Health Preparedness: HHS Should Address Strategic National Stockpile Requirements and Inventory Risks”

GAO also recently released this report discussing the Department of Health and Human Services’ inventory planning reports and their failure to “meet most legal requirements enacted in 2019 or communicate risks associated with not meeting recommended inventory levels. This is partly because HHS hasn’t updated its processes for completing the reports and a key advisory body was inactive.” This report makes a number of recommendations while also noting that HHS’s leadership and coordination of public health emergencies is on the office’s high risk list.

“COVID-19: A Warning – Addressing Environmental Threats and the Risk of Future Pandemics in Asia and the Pacific”

From the UN Environment Programme: “This scientific review begins with the history of humans and zoonoses and provides clarity on the issues of zoonoses and emerging infectious diseases. It then presents the seven anthropogenic drivers of zoonotic disease emergence as well as the concept of viral mixing. After providing rich context, this review continues to outline solutions that address the intricate link between nature and human health and strategies to prevent future zoonotic outbreaks.”

“”It was Compromised”: The Trump Administration’s Unprecedented Campaign to Control CDC and Politicize Public Health During the Coronavirus Crisis”

The House Select Subcommittee on the Coronavirus Crisis recently released its third installment of staff reports detailing the Trump administration’s response to the COVID-19 pandemic. In the report, the committee explains its findings from its investigation into the Trump administration’s “rampant political interference with the federal public health response to the coronavirus pandemic.” Chairman Clyburn released this statement about the report: “The Select Subcommittee’s investigation has shown that the previous administration engaged in an unprecedented campaign of political interference in the federal government’s pandemic response, which undermined public health to benefit the former president’s political goals. As today’s report shows, President Trump and his top aides repeatedly attacked CDC scientists, compromised the agency’s public health guidance, and suppressed scientific reports in an effort to downplay the seriousness of the coronavirus. This prioritization of politics, contempt for science, and refusal to follow the advice of public health experts harmed the nation’s ability to respond effectively to the coronavirus crisis and put Americans at risk. As we continue to recover from the coronavirus crisis, we must also continue to work to safeguard scientific integrity and restore the American people’s trust in our public health institutions.”

Clinical Infectious Diseases “Issue Supplement 3, Anthrax Preparedness”

This issue supplement of Clinical Infectious Diseases is all about anthrax, including articles ranging from “Responding to the Threat Posed by Anthrax: Updated Evidence to Improve Preparedness” to “Risk Factors for Severe Cutaneous Anthrax in a Retrospective Case Series and Use of a Clinical Algorithm to Identify Likely Meningitis and Evaluate Treatment Outcomes, Kyrgyz Republic, 2005-2012”. So, if it has been a while since you were deeply concerned about anthrax, this issue is for you!

“How SARS-CoV-2 Battles Our Immune System”

If you like medical illustrations and interactive timelines, this one is for you. This new story available from Science walks readers visually through SARS-CoV-2’s interaction with the human immune system, offering detailed yet easily understood, general explanations along the way. Readers can even learn about the virus’s different proteins and their specific effects on the immune system.

What We’re Listening To 🎧

This Podcast Will Kill You: Episode 107: Sepsis: It’s a Mess

“Over the years of the podcast, we have often struggled with questions of why: why pathogens act the way they do, why certain people get sick while others don’t, or why we know little about some diseases. This episode is no exception – sepsis certainly inspires many “whys”. But for perhaps the first time on the pod, we find ourselves grappling not only with “why?” but also with “what?”. What, indeed, is sepsis? Ask a dozen doctors and you may get a dozen different answers. Our first goal for this episode is to sift through the various definitions of sepsis and what we know about its pathology to get a firm handle on this deadly consequence of infection. We then turn our sights to a thrilling period of sepsis history – Joseph Lister and his carbolic acid spray – before attempting to address the status of sepsis around the world today. By the end of the episode, your picture of sepsis may not be crystal clear, but hopefully the edges are a little less blurry.” Listen here on Spotify or wherever you listen to podcasts!

Project Responder 6: Evolving Response Environment Webinar

From DHS: “You’re invited to join the Department of Homeland Security (DHS) Science & Technology Directorate (S&T) for a briefing on the Project Responder 6 report, designed to document emergency response capability needs across significant changes in the operating environment. The innovative approach this data collection effort—now in its sixth generation—takes is to bring together S&T’s First Responder Resource Group (FRRG), which includes responders from traditional (fire service, law enforcement, emergency medical services, emergency management) and non-traditional (public health, public works, medical examiner/coroner, search and rescue) response agencies, to focus on identifying and validating needs across disciplines.” Learn more and register here. Download the report here. This event will take place on October 24, at 11 am ET.

Addressing Health Inequities by Strengthening Antibiotic Stewardship

From NCEZID: “Please join The National Center for Emerging and Zoonotic Infectious Disease (NCEZID) on Tuesday, October 25, 2022, at 10 a.m. EDT for the next AMR Exchange webinar on addressing health inequities by strengthening antibiotic stewardship entitled Addressing health inequities by strengthening antibiotic stewardship. The discussion will feature experts from CDC, The Pew Charitable Trusts, the Federal Office of Rural Health Policy, and Emory University School of Medicine who work to strengthen antibiotic use and prescribing and improve the quality of health care across the United States. Please register here.”

South Korea as a Global Vaccine Hub

The Korea Economic Institute of America is hosting this event October 27, at 3 pm EST virtually: “Early in the pandemic, South Korea drew widespread praise for the speed and efficiency of its response to slowing the spread of the virus and saving lives. However, despite this initial success, South Korea faced vaccine nationalism and other access challenges in its effort to secure Covid-19 vaccines. Spurred by these challenges, South Korea established a national strategic policy to become a global vaccine hub, not only to meet the current and future public health needs of its own population but also to assist low- and middle-income countries (LMICs) facing even starker obstacles in accessing safe and effective vaccines.”

“Please join KEI for a discussion with the Thomas Byrne, Claire Callahan, Irene Kyoung, and Salomé Da Silva Duarte Lepez about how global vaccine access and equity was hindered by the shortcomings of national and bilateral vaccine diplomacy and multilateral mechanisms during the Covid-19 pandemic, and how South Korea’s demonstrated capabilities to rise as global vaccine development, manufacturing and training hub will help bolster global public health capacities in the future.” Register here.

The Case for the Use of “Red Lines” in the Governance of Life Sciences Research with David Relman

From CISAC: “The nature of evolving risks in life sciences research, a brief history of risk governance, and the case for the use of so-called “red lines” in the governance of life sciences research will be presented. The goals of this presentation are to elicit discussion about the benefits and pitfalls of red lines, or guardrails, in general, including a historical perspective, and options for public policy recommendations to address concerns about the present and future risks arising from life sciences research.” This event will take place on October 27, at 3:30 pm PT. Register here.

Infection Prevention and Control: Incorporating Lessons Learned in Managing Special Pathogens

“After nearly three years responding to the COVID-19 pandemic, hospitals and other healthcare facilities have learned many lessons about the management of special pathogens and essential infection prevention and control practices. The U.S. Department of Health and Human Services (HHS) Administration for Strategic Preparedness and Response’s Technical Resources, Assistance Center, and Information Exchange (ASPR TRACIE) and the National Emerging Special Pathogens Training and Education Center (NETEC) invite you to learn more about some of those lessons. Speakers will share their perspectives on how our approach to outbreaks has changed since the pandemic began. They will address issues such as infection prevention for healthcare workers and patients and mitigating disease spread. Speakers will also highlight newly developed tools and resources. This webinar will take place November 7 at 2:00 pm ET. Register today!”

ICYMI: IARPA, Gingko Bioworks and Draper Announce New Technologies to Detect Engineered DNA

This week, Gingko Bioworks, Draper, and IARPA held an event to announce the completion of IARPA’s Finding Engineering-Linked Indicators (FELIX), a program aimed at improving existing biodetection and surveillance capabilities. “The event featured a panel with Catherine Marsh, IARPA Director; David A. Markowitz, IARPA Program Manager; Joshua Dunn, Head of Design, Ginkgo Bioworks; Laura Seaman, Principal Scientist and Machine Intelligence Group Leader, at Draper; and Erin Rosenberger, Senior Member of Technical Staff, Biological Microsystems Group, at Draper. During the panel, the panelists discussed the program findings and also featured a demo of the research results.” A recording of the livestream is available here.

November 3 is One Health Day

Mark your calendars for this year’s One Health Day on November 3. One Health Day is an international campaign that was launched in 2016. The One Health Commission explains that “The goal of One Health Day is to bring attention around the world to the need for One Health interactions and for the world to ‘see them in action’. The One Health Day campaign is designed to engage as many individuals as possible from as many arenas as possible in One Health education and awareness events, and to generate an inspiring array of projects worldwide.” If you are hosting an event on this day, you can register your event here with the Commission. A list of registered One Health Day events for 2022 is also available here.

Pandora Report: 10.14.2022

Happy Friday! This week we discuss the release of the Biden administration’s National Security Strategy and new findings about the prevalence and challenges of long COVID. We also cover a number of new publications, a German podcast episode on the 1979 anthrax outbreak in Sverdlovsk (featuring our own Dr. Sonia Ben Ouagrham-Gormley!), and upcoming events.

Biden Administration Releases National Security Strategy

The Biden administration released its National Security Strategy (NSS)this week, building on the 2021 Interim NSS. This iteration of the NSS re-incorporates climate change as a national security threat, continues to define the threats China and Russia pose to the US, and includes “Triad” with a capital “T” to make sure there’s plenty of discussion about the document here in the Beltway. As the NSS has in the past, this version includes a section dedicated to pandemics and biological threats, which estarts by explaining that “COVID-19 has killed nearly 6.5 million people around the world, including more than 1 million Americans, but the next pandemic could be much worse—as contagious but more lethal. We have a narrow window of opportunity to take steps nationally and internationally to prepare for the next pandemic and to strengthen our biodefense.”

This section also discusses the notion that “no one is safe until everyone is safe,” and acknowledges that “some of our international institutions have fallen short in the past and need to be reformed.” It concludes with a paragraph discussing the need to address risks posed by deliberate and accidental biological risks “including through our ability to rapidly detect, identify, and attribute agents, and to develop medical countermeasures,” by working to strengthen the BWC, prevent terrorist acquisition of BW, and reinforcing “norms against biological weapons’ development and use.”

This comes on the heels of statements released this week by the US State Department and German Federal Foreign Office on the need to better cooperate to reduce biological threats globally. Both statements discuss the multi-faceted nature of these problems, including challenges created by mis- and disinformation and the need for increased global cooperation in the face of these threats, again highlighting the increasing importance of these issues.

Long COVID Gaining Recognition…Finally

This week, Hastie et al.’s article in Nature Communications discussing long COVID made waves in the media and online. The authors conducted a study in a Scottish cohort consisting of 33,281 laboratory-confirmed SARS-CoV-2 infections and 62,957 never-infected individuals. Participants were issued questionnaires at 6, 12, and 18 months. The authors found that “Of the 31,486 symptomatic infections,1,856 (6%) had not recovered and 13,350 (42%) only partially.” They also found that “Asymptomatic infection was not associated with adverse outcomes. Vaccination was associated with reduced risk of seven symptoms.” Notably, participants with previous symptomatic COVID-19 infections reported long-lasting symptoms like breathlessness, heart palpitations, difficulty focusing, and confusion at rates more than double that of those who were not previously infected. They also reported other related symptoms, like muscle aches and other heart problems.

There were some challenges in the study, however. For example, approximately 90% of participants were white, which is not helpful in trying to better understand risks and burdens of long COVID in other groups. Furthermore, only 4% were vaccinated (most with just one dose) before they were infected. However, this study does more concretely demonstrate the breadth of this problem and what it could mean for future pandemics.

A German study was also published this week in BMJ that found a “considerable burden of long-COVID symptoms, especially fatigue and neurocognitive impairment (“brain fog”), at 6 to 12 months—even among young and middle-aged adults who had mild infections,” according to CIDRAP. This study found that women were at higher risk for developing long COVID and “The researchers said the study revealed long-COVID symptom clusters with individually and societally relevant implications that also affected younger adults with mild initial infections. “Given the individual and societal burden of post-covid sequelae, the underlying biological abnormalities and causes need urgent clarification to define adequate treatment options and develop effective rehabilitation measures,” they concluded.”

Other studies have also linked long COVID to conditions like postural tachycardia syndrome (POTS). In the case of POTS, 41% of people diagnosed with the syndrome already reported a viral infection preceding the onset of POTS symptoms pre-pandemic. Because of this connection, the UK’s National Institute for Health and Care Excellence now even recommends testing for POTS in patients with long COVID. These studies build on mountains of anecdotal evidence from patients and providers alike, demonstrating that long COVID is a very real and serious danger that has already impacted many of us.

The WHO Director General, Dr. Tedros Adhanom Ghebreyesus, recently authored a piece in The Guardian discussing long COVID, what WHO is doing about it, and what countries around the world should do to support those suffering with it. He explains, “Mostly data is only available from high-income countries, which means that we don’t currently have a clear picture on how many people are actually suffering. Current estimates suggest that tens of millions, and perhaps more, have contracted long Covid, and about 15% of those diagnosed with the condition have experienced symptoms for at least 12 months.”

He also discussed the shift in investment strategies this requires of countries, writing “Early in the pandemic, it was important for overwhelmed health systems to focus all of their life-saving efforts on patients presenting with acute infection. However, it is critical for governments to invest long-term in their health system and workers and make a plan now for dealing with long Covid. This plan should encompass, providing immediate access to antivirals to patients at high risk of serious disease, investing in research and sharing new tools and knowledge as they’re identified to prevent, detect and treat patients more effectively. It also means supporting patients physical and mental health as well as providing financial support for those who are unable to work.”

WHO/Europe also issued a factsheet discussing the need for rehabilitation, recognition, and research focused on lingering COVID symptoms that is available here.

WHO Europe Factsheet Discussing Long COVID, Source: https://www.who.int/europe/news/item/10-10-2022-rehabilitation–recognition-and-research-needed-for-people-living-with-long-covid–new-who-europe-factsheet

“COVID Prompts Global Surge in Labs That Handle Dangerous Pathogens”

Smriti Mallapaty’s recent article in Nature News discusses the growing number of BSL-3 and 4 certified facilitates globally and rising concerns about the costs and risks they present. This article covers new facilities across Asia as well as Russia’s promise that it will build 15 new BSL-4 facilities. Mallapaty also quoted GMU’s Dr. Greg Koblentz in the article, writing “Since the COVID-19 pandemic began, plans to build 27 BSL-4 labs have been announced worldwide, say Gregory Koblenz, a biodefence researcher at George Mason University in Arlington, Virginia, and Filippa Lentzos, a biosecurity researcher at King’s College London, who have tracked the number and distribution of BSL-4 facilities globally. “These will likely take several years to design, build and commission,” says Lentzos.”

“Pandemic Origins and a One Health Approach to Preparedness and Prevention: Solutions Based on SARS-CoV-2 and Other RNA Viruses”

In this recent Proceedings of the National Academy of Sciences article, Keusch et al. discuss the importance of One Health in improving and integrating biosafety and biosecurity. Their abstract explains “COVID-19 is the latest zoonotic RNA virus epidemic of concern. Learning how it began and spread will help to determine how to reduce the risk of future events. We review major RNA virus outbreaks since 1967 to identify common features and opportunities to prevent emergence, including ancestral viral origins in birds, bats, and other mammals; animal reservoirs and intermediate hosts; and pathways for zoonotic spillover and community spread, leading to local, regional, or international outbreaks. The increasing scientific evidence concerning the origins of Severe Acute Respiratory Syndrome Coronavirus-2 (SARS-CoV-2) is most consistent with a zoonotic origin and a spillover pathway from wildlife to people via wildlife farming and the wildlife trade. We apply what we know about these outbreaks to identify relevant, feasible, and implementable interventions. We identify three primary targets for pandemic prevention and preparedness: first, smart surveillance coupled with epidemiological risk assessment across wildlife–livestock–human (One Health) spillover interfaces; second, research to enhance pandemic preparedness and expedite development of vaccines and therapeutics; and third, strategies to reduce underlying drivers of spillover risk and spread and reduce the influence of misinformation. For all three, continued efforts to improve and integrate biosafety and biosecurity with the implementation of a One Health approach are essential. We discuss new models to address the challenges of creating an inclusive and effective governance structure, with the necessary stable funding for cross-disciplinary collaborative research. Finally, we offer recommendations for feasible actions to close the knowledge gaps across the One Health continuum and improve preparedness and response in the future.”

Science published a news article discussing this paper, writing “‘Our paper recognizes that there are different possible origins, but the evidence towards zoonosis is overwhelming,” says co-author Danielle Anderson, a virologist at the University of Melbourne. The report, which includes an analysis that found the peer-reviewed literature overwhelmingly supports the zoonotic hypotheses, appeared in the Proceedings of the National Academy of Sciences (PNAS) on 10 October.”

The article continued with “The panel’s own history reflects the intensity of the debate. Originally convened as a task force of the Lancet COVID-19 Commission, a wide-reaching effort to derive lessons from the pandemic, it was disbanded by Columbia University economist Jeffrey Sachs, the commission’s chair. Sachs alleged that several members had conflicts of interest that would bias them against the lab-origin hypothesis.”

“WHO’s Response to COVID-19 – 2022 Mid-Year Report”

“This mid-year report provides a consolidated update on WHO’s response to the COVID‐19 pandemic between January and July 2022, against the objectives laid out in the Strategic Preparedness and Response Plans (SPRP) for 2021 and 2022.”

“With the aim of ending the acute phase of the pandemic by the end of the year, WHO, in collaboration with partners, has supported countries to further strengthen their surveillance systems; ensure more equitable access to tests, treatments, and essential supplies worldwide; make health systems more resilient; and reduce exposure to the disease by empowering and enabling communities.”

“The report highlights the role of WHO at the global, regional, and local levels, and across the key elements of an effective emergency response – from implementation and operational support, to developing evidence and research, and providing strong coordination and planning. By working with partners, including multi-agency and multi-partner operational platforms, regional and national public health and scientific institutes, governments, communities, donors, UN organizations and NGOs and the private sector, WHO helped bring the world together to provide direct technical and operational support to countries implementing their national COVID-19 response plans.”

“Epidemics That Didn’t Happen”

On a much more cheerful note, check out Prevent Epidemics’ online feature, “Epidemics That Didn’t Happen”. This page explores six epidemics that were prevented thanks to solid cooperation and good public health responses, including averted epidemics of Ebola, Nipah, cholera, rabies, influenza, and dengue. As the page notes, these cases present common themes, including “Speed is essential,” “Well-coordinated action at the local level is crucial to preventing epidemics,” “Community engagement pays off,” and “Health care workers need to be trained, supported, and provided with access to resources and assistance to stop epidemics.”

“Russia’s Alleged Bioweapons Claims Have Few Supporters”

Jez Littlewood and Dr. Filippa Lentzos recently published this piece in this Bulletin of the Atomic Scientists discussing the outcome of September’s Article V Formal Consultative Meeting requested by Russia. They write “For the fourth time this year, Russia accused the United States and Ukraine of being in non-compliance with the Biological and Toxins Weapons Convention (BTWC)—and once again found little support for its allegations. At the conclusion of the Article V Formal Consultative Meeting in September, no other state formally accused these two nations of non-compliance. Russia stands alone in its allegations, with limited support from eight other states. In contrast, more than five times as many backed the United States and Ukraine in rejecting the allegations; the meeting ended with a procedural report that noted no consensus regarding the outcome.”

“Addressing Inaccurate and Misleading Information About Biological Threats Through Scientific Collaboration and Communication in Southeast Asia”

From the National Academies: “Misinformation about outbreaks, epidemics, and pandemics is a decades-old problem that has been exacerbated by the rise of the internet and the widespread use of social media. Some false claims may be addressed through sound scientific analysis, suggesting that scientists can help counter misinformation by providing evidence-based, scientifically defensible information that may discredit or refute these claims. This report explains how scientists can work collaboratively across scientific disciplines and sectors to identify and address inaccuracies that could fuel mis- and disinformation. Although the study focused on a scientific network primarily in Southeast Asia, it is relevant to scientists in other parts of the world. A companion “how-to-guide”, available in print and in digital form, outlines practical steps that scientists can take to assess mis- or disinformation, determine whether and how they should address it, and effectively communicate the corrective information they develop.”

“Counterfeit PPE: Substandard Respirators and Their Entry Into Supply Chains in Major Cities”

This recent article from Urban Crime was co-authored by the Schar School’s Dr. Louise Shelley and discusses challenges in ensuring legitimate PPE is available and what this means for definitions of threats to human life. The abstract reads “Over 58 million counterfeit respirators of substandard quality unable to protect individuals from infection have been seized globally since the start of the COVID-19 pandemic. These seizures have primarily occurred in urban warehouses and ports around the world according to analysis of public and corporate data shared with the authors. The presence of tens of millions of respirators in storage facilities prior to distribution demonstrates that urban areas are key elements of illicit supply chains. Data suggests that the concept of urban insecurity needs to be reconsidered in light of illicit supply chains for counterfeit respirators and their role in facilitating disease transmission in urban areas. The analysis presented in this article suggests that threats to human life should not be confined narrowly to violent acts or the consumption of drugs. Human life can also be threatened through the massive distribution of counterfeit N95 masks during a pandemic, a problem that has become more acute with more contagious mutations of COVID-19.”

Dr. Shelley is the Omer L. and Nancy Hirst Endowed Chair and a University Professor at George Mason University. She is in the Schar School of Policy and Government and directs the Terrorism, Transnational Crime and Corruption Center. She is a leading expert on the relationship between terrorism, organized crime, and corruption as well as human trafficking, transnational crime, and terrorism with a particular focus on the former Soviet Union. She also specializes in illicit financial flows and money laundering. 

What We’re Listening To 🎧

Waffen der Wissenschaft – Die Spur der Sporen

For our German-speaking readers, a Viertausendhertz podcast episode on the 1979 outbreak of anthrax in Sverdlovsk: “Im Frühjahr 1979 sterben in der geschlossenen sowjetischen Stadt Sverdlovsk Dutzende Menschen an Milzbrand. Ein ungeheurer Verdacht kommt auf: Handelt es sich um einen Unfall mit Biowaffen? Der Forscher Matthew Meselson und der Journalist Peter Gumbel erzählen von ihren Nachforschungen vor Ort. Das Team spricht außerdem mit den Biowaffen-Experten Filippa Lentzos, Sonia Ben Ouagrham-Gormley und Andrew Weber.”

Translation: “In the spring of 1979, dozens of people died of anthrax in the closed Soviet city of Sverdlovsk. A tremendous suspicion arose: was it an accident involving biological weapons? The researcher Matthew Meselson and the journalist Peter Gumbel discuss their investigations on site. The team also speaks with bioweapons experts Filippa Lentzos, Sonia Ben Ouagrham-Gormley, and Andrew Weber.”

Event Summaries

Check out event summaries written by Geoffrey Mattoon, a Biodefense MS student, for two recent events from the Council on Strategic Risks-“Building Capacities for Addressing Future Biological Threats” and “The American Pandemic Preparedness Plan: One Year of Progress & the Path Forward”.

Schar School Master’s and Certificate Virtual Open House

Join us for next week’s Master’s and Certificate Virtual Open House on Wednesday, October 19, at 7 pm ET, to learn more about the Schar School of Policy and Government and the Biodefense Graduate Program. The online session will provide an overview of our programs, student services, and admissions requirements. Our admissions staff will be available afterward to answer any questions you may have. Register here!

Infection Prevention and Control: Incorporating Lessons Learned in Managing Special Pathogens

“After nearly three years responding to the COVID-19 pandemic, hospitals and other healthcare facilities have learned many lessons about the management of special pathogens and essential infection prevention and control practices. The U.S. Department of Health and Human Services (HHS) Administration for Strategic Preparedness and Response’s Technical Resources, Assistance Center, and Information Exchange (ASPR TRACIE) and the National Emerging Special Pathogens Training and Education Center (NETEC) invite you to learn more about some of those lessons. Speakers will share their perspectives on how our approach to outbreaks has changed since the pandemic began. They will address issues such as infection prevention for healthcare workers and patients and mitigating disease spread. Speakers will also highlight newly developed tools and resources. This webinar will take place November 7 at 2:00 pm ET. Register today!”

Disinformation: An Emerging War Weapon

“Hosted by the National Defense University Foundation and Moderated by President and CEO, James Schmeling, join us for this interactive virtual discussion. Brief Talk Description: Explore how Russia, China and other entities use misinformation, disinformation, and malinformation as weapons of war and their impact on global security and American democracy.” This online webinar will be hosted on October 20 at 12 pm EST. Register here.

Reflections on Science Communication & Human Rights Amid Public Health Emergencies

“On October 20 (10:30-11:30 am ET),  join Dr. Bina Venkataraman, Editor-at-Large for The Boston Globe, and Dr. Chris Beyrer, Director of Duke University’s Global Health Institute, for a virtual discussion of science communication during public health emergencies, the role of public health researchers and journalists in advancing human rights, and emerging lessons from the COVID-19 pandemic.”

“The conversation will be moderated by Prof. Helle Porsdam, Professor of Law and Humanities and UNESCO Chair in Cultural Rights, Centre for Interdisciplinary Studies of Law, Faculty of Law, University of Copenhagen.” Register here.

Third International Summit on Human Genome Editing

The Third International Summit on Human Genome Editing will take place March 6-8, 2023, at the Francis Crick Institute, London, UK. “Building on previous events held in Washington, DC (2015) and Hong Kong (2018), this Summit will continue the important dialogue around human genome editing. It will facilitate a global discussion on somatic and germline genome editing, including developments in clinical trials and genome editing tools such as CRISPR/Cas9. Earlier this year a three-part series of online events Looking Ahead to the Third Human Genome Editing Summit discussed some of the key topics of the meeting. The three-day summit is being organised by the Royal Society, the UK Academy of Medical Sciences, the US National Academies of Sciences and Medicine and The World Academy of Sciences.”

“Find out more about the Summit’s Planning Committee, chaired by Professor Robin Lovell-Badge FRS FMedSci. Further information about the Summit agenda will be released soon, and registration to attend the event in person and online is now open.”

Pandora Report: 10.7.2022

The three day weekend is almost here and we have enough content to keep you busy the whole time! This week we cover updates on the Biden administration’s response to the growing Ebola outbreak in Uganda, continued concerns about polio in New York, and international containment efforts. We also discuss a ton of new publications, including multiple new books and articles from our own program alumni. As always, upcoming events and announcements round us out for the week.

Ebola in Uganda, US on Alert

The Biden administration announced this week that all travelers entering the United States from Uganda will be redirected to airports where they can be screened for Ebola virus disease (EVD). Physicians were also warned to be on the lookout for potential cases entering the country. According to The New York Times, “The director of the Centers for Disease Control and Prevention ordered the airport screenings, and the State Department issued an alert saying the measures would apply to all passengers, including U.S. citizens… Screenings were expected to begin on Thursday for some passengers, but the travel restrictions will not go into effect until next week, according to an official familiar with the plan, who stressed that both the restrictions and the alert to doctors were issued as precautions.”

Passengers entering the US from Uganda will be redirected to New York City’s John F. Kennedy International Airport, New Jersey’s Newark Liberty International Airport, Chicago’s O’Hare International Airport, Hartsfield-Jackson Atlanta International Airport, and Dulles International Airport near Washington, D.C. According to the administration, 62% of passengers entering the country from Uganda already arrive through these airports. They will undergo temperature checks and complete questionnaires before continuing to their final destinations.

According to the advisory, “On September 20, 2022, the Ministry of Health of Uganda officially declared an outbreak of EVD due to Sudan virus (species Sudan ebolavirus)in Mubende District, Central Uganda.”

“The first confirmed case of EVD was a 25-year-old man who lived in Mubende District and quickly identified as a suspect case of viral hemorrhagic fever (VHF) and isolated in the Mubende Regional Referral Hospital. Blood collected from this patient tested positive for Sudan virus by real-time reverse transcription polymerase chain reaction (rRT-PCR) on September 19, 2022, at the Uganda Virus Research Institute (UVRI). The patient died the same day, and a supervised burial was performed by trained staff wearing proper personal protective equipment (PPE). Further investigation into this case revealed a cluster of unexplained deaths occurring in the community during the previous month. As of October 6, 2022, a total of 44 confirmed cases, 10 confirmed deaths, and 20 probable deaths of EVD have been identified in Uganda.”

Much of this is reminiscent of the 2014-2016 outbreak, during which the US reported the first case outside Africa in a Liberian national who traveled to Dallas through four different airports without being stopped. At the time, NPR explained that “Ebola symptoms can lay dormant for two to 21 days, and during that time, the disease wouldn’t show up on a blood test, let alone a thermometer. There was no way to know that this particular passenger was at risk. The good news, says Thomas Frieden, director of the CDC: “Ebola doesn’t spread before someone gets sick, and he didn’t get sick till four days after he got off the airplane. So we do not believe there is any risk to anyone who was on the flight at that time.” Fever is one of the first symptoms to appear, so for now, thermometers remain a good way of catching infected travelers.”

The Liberian patient, Thomas Eric Duncan, died on the morning of October 8 at Texas Health Presbyterian Hospital in Dallas, a little over two weeks after he arrived in the US from West Africa. Two nurses who treated him, Nina Pham and Amber Vinson, were infected too, though they both later recovered. The hospital was later criticized in an independent report detailing miscommunication, poor information handling, and a lack of focus on patient safety that contributed to Duncan’s initial misdiagnosis and the nurses’ exposure. Later in October 2014, a medical aid worker who had volunteered in Guinea was hospitalized in New York City with suspected EVD, which was later confirmed by CDC. This patient also later recovered. An additional seven others were treated in the US after they were exposed and became ill while in West Africa, the majority of whom were medical workers. They were transported to the US on chartered aircraft. All but one recovered.

According to CDC, “The 2014-2016 Ebola epidemic was the first and largest epidemic of its kind, with widespread urban transmission and a massive death count of more than 11,300 people in Guinea, Liberia, and Sierra Leone. The epidemic took a devastating toll on the people of West Africa. Ending it took an extraordinary international effort in which the U.S. government played a major role.”

However, unlike this and other recent outbreaks, the cases in Uganda are of the Ebola Sudan strain. The WHO explains of this strain that “According to the International Classification of Disease for filoviruses (ICD-11) released in May 2019, Ebola disease is now sub-categorized depending on the causative virus. Outbreaks of Ebola disease caused by Sudan virus are named Sudan Virus Disease (SVD) outbreaks. Prior to May 2019 all viruses causing Ebola disease were grouped together. Based on the results of laboratory tests, this outbreak is caused by Sudan virus.”

“Sudan virus disease is a severe, often fatal illness affecting humans. Sudan virus was first reported in southern Sudan in June 1976, since then the virus has emerged periodically and up to now, seven outbreaks caused by SUDV have been reported, four in Uganda and three in Sudan. The estimated case fatality ratios of SVD have varied from 41% to 100% in past outbreaks.”

The WHO also explains that “The diagnosis of SVD can be difficult, as early nonspecific manifestation of the disease may mimic other infectious diseases such as malaria, typhoid fever and meningitis. Confirmation is made using numerous diagnostic methods including RT-PCR. Supportive care – rehydration with oral or intravenous fluids – and treatment of specific symptoms improve survival.”

Importantly, in contrast to the Zaire strain, there are no licensed vaccines or therapeutics for this strain of Ebola. The CDC’s HAN advisory explains that “This is the fifth outbreak of EVD caused by Sudan virus in Uganda since 2000. The current outbreak is in the same area as Uganda’s most recent EVD outbreak caused by Sudan virus, which occurred in 2012. During the 2012 outbreak, limited secondary transmission was reported, and the outbreak was effectively contained.”

“This image depicted Quarantine Public Health Officer, Máire Kirley, awaiting the arrival of an aircraft during a Live Full-Scale Ebola exercise at Minneapolis-St. Paul International Airport, in April 2017. This Department of State-led exercise tested our nation’s ability to repatriate Americans exposed to, or sick from Ebola while in foreign countries, upon their return to the United States, and transfer them to appropriate care. Partners from local, state, federal, healthcare, EMS, and non-governmental organizations (NGOs) collaborated and participated in this exercise.” Source: Arnold Vang, CDC Public Health Image Library

Marco…Polio (Again)

In 1921, FDR contracted poliomyelitis at 39 years old, becoming seriously ill before eventually recovering, though he remained paralyze from the waist down for the rest of his life. He was by no means unique-the early 20th century saw thousands upon thousands of Americans infected with the virus. The disease left an average of 35,000 Americans disabled annually throughout the 1940s. In just 1952 alone, 60,000 American children were infected; thousands were left paralyzed while over 3,000 died. Late summer was commonly known as “polio season” back then. However, as the years went on, the United States began vaccinating for this disease widely, ridding the country of wild cases by 1979. In the last 50 years, polio has increasingly come to feel for many in the US like a thing of the past and a problem only for far away countries where it is endemic.

Today, however, New York is grappling with its first polio case since 1990 (you know…as it also tries to juggle monkeypox, COVID-19, and the threat of imported Ebola cases). In July this year, a young man reported to an ER in a New York City suburb with weakness in his lower legs, having experienced a fever, stiff neck, and other symptoms for several days prior. This person is unvaccinated for polio, and it is believed his samples appear related to those from countries that use oral polio vaccine. While one case of vaccine-derived polio would be shocking enough in the US today, it gets worse. Wastewater surveillance in New York State has detected the virus in Rockland County (where the case was diagnosed this summer), Orange and Sullivan Counties, and, as of late last month, Nassau County on Long Island. It has also been detected in New York City itself. The AP explains of the detection in Nassau County that “The sample is genetically linked to the polio case from Rockland and provides further evidence of expanding community spread, state health officials said.”

“On polio, we simply cannot roll the dice,” state Health Commissioner Dr. Mary T. Bassett said in a prepared statement. “If you or your child are unvaccinated or not up to date with vaccinations, the risk of paralytic disease is real. I urge New Yorkers to not accept any risk at all.”

While New York Governor Kathy Hochul has declared a disaster to increase resources allocated to her state’s effort to contain polio, this is likely part of a much larger problem. While 92.5% of children in the US have received three or more doses of the polio vaccine by the age of two, overall rates are declining nationally. For example, in Rockland County, NY, just 60% of residents were vaccinated for polio by August 1 of this year. CDC’s data shows that the national childhood vaccination rate for US kindergarteners declined 1% between 2019 and 2021, from 95% to 94%. While 1% may seem small, this means that about 211,000 kindergarteners in the US did not have all required vaccines in 2021, up from about 201,000 in 2019. This was even with enrollment in 2021 down 10% total. It is no small matter.

The pandemic has contributed to declining vaccination rates, particularly earlier on as people shied away from visiting their doctors for routine and preventative care. WHO announced earlier this year that about 25 million infants missed lifesaving vaccines in 2021 primarily because of disruptions caused by COVID-19. However, experts also worry that vaccine hesitancy is driving this and that it may lead to a future resurgence of previously controlled diseases like polio, pertussis, and measles. In the case of polio, large numbers of paralytic cases are unlikely, even if large numbers of unvaccinated people catch the disease. However, this is a very much vaccine preventable disease, making this problem particularly frustrating.

While this issue in the US is a concerning set-back, global eradication and containment efforts continue. Today, two of three strains of wild poliovirus have been eradicated globally. As a result, WHO is working with members states to help reduce the number of countries holding samples of polioviruses to a minimum and helping destroy unnecessary stocks. The WHO’s Global Polio Eradication Initiative recently released an update on Canada’s efforts to improve safeguards for work with poliovirus, explaining “As one of 25 countries retaining the eradicated type 2 poliovirus strain, Canada is putting in place the necessary safeguards to minimize this risk. In fact, the country is the first to have one of its facilities move to the second stage of WHO’s Containment Certification Scheme, through receiving an ‘Interim Certificate of Containment’, or ICC.”

“There are three stages of containment certification and ICC is the second,” said Liliane Boualam, WHO containment technical officer and co-chair of the GPEI’s Containment Management Group. “Effectively, this means the facility in question has been audited against WHO containment guidance by its National Authority for Containment, and has met a certain threshold of containment requirements. The validity of the ICC is limited to three years and the facility has two options: to either address any non-conformities identified through the audit, so as to be compliant with WHO containment guidance (GAP), or to decommission the facility and destroy or transfer virus materials to another (facility) undergoing certification within those three years,” she added. “WHO and GPEI commend Canada and its facility for being the first to achieve ICC status, and we look forward to their next steps, and progress by other countries retaining (polio)virus,” she said.”

“We are very pleased to have this Canadian facility advance to the next step in the containment certification process,” said Andréanne Bonhomme, Director, Biosafety and Biocontainment Operations at the Public Health Agency of Canada, and National Authority for Containment chair. “Canada appreciates the responsibility that comes with the ongoing handling and storage of poliovirus, and is committed to ensuring safe and secure containment of these viruses as essential functions continue,” she added.”

The piece continued by explaining hurdles in sticking to the international schedule: “Containment of type 2 poliovirus came into effect in 2016, following the declaration of its eradication in 2015. In 2018, WHO Member States recognizing the importance of the work, committed to acceleration of containment action globally. Significant advances have been made however many countries are behind on implementation timelines*. In part, the pandemic complicated matters, diverting resources away from containment and slowing implementation.”

“COVID-19 certainly hindered poliovirus containment efforts,” said Professor David Salisbury, chair of the Global Commission for the Certification of Eradication of Poliomyelitis and final signatory for containment certification certificates. “Encouragingly, we have seen improvements since individual country situations have stabilized, but progress is considerably behind schedule and we need to reprioritize this important work,” he added. “The goal is to have all facilities retaining polioviruses to have achieved full containment certification by 2026 and this means a great amount of work, and indeed much catching-up, needs to take place now,” he added.

Tech Wars: Transforming U.S. Technology Development

Dr. Daniel Gerstein (a GMU Biodefense PhD alumni) recently published his latest book, Tech Wars. “Tech Wars offers a narrative to describe the technology competition being waged throughout the world today and offers some thoughts on how the U.S. must adapt to be successful in this rapidly evolving, technology rich environment. Early in the book, the question of whether we will characterize this as a competition, conflict, or war was considered. In the end, I have chosen to depict it as a tech war to signify the magnitude and urgency of the issue at hand.”
“Today, the U.S. is not prepared for waging this war. Absent fundamental changes, our current science and technology advantages will continue to erode. To respond to this urgency, new strategies, organizational changes and resource allocations to our research and development (R&D) enterprise will be required to better posture us to take advantage of the opportunities and respond to the challenges that are on the horizon. Tech Wars provides recommendations for focused approaches to research, development, and innovation to promote U.S. economic prosperity and national security well into the latter decades of the 21st century.” You can order a copy here.

Understanding Cyber-Warfare: Politics, Policy and Strategy

Drs. Christ Whyte (GMU Political Science PhD, 2017) and Brian Mazanec (GMU Biodefense PhD, 2014) have updated their popular textbook on cyber conflict, Understanding Cyber-Warfare: Politics, Policy and Strategy; Routledge will be publishing the second edition in early 2023.  As with the first edition, the textbook offers an accessible introduction to the historical, technical, and strategic context of global cyber conflict. The 2nd edition has been revised and updated throughout, with three new chapters.  Whyte and Mazanec’s book has received praise from senior leaders, with General Michael V. Hayden, former Director of the Central Intelligence Agency and National Security Agency, saying “‘This book is a great contribution to the cyber canon and offers a comprehensive reference for both students and policymakers. The authors cover down on the many dynamic facets of cyber conflict, providing a strong foundation for anyone interested in this critical aspect of international relations.”  James R. Clapper, former Director of National Intelligence also offered praise, calling the book “An authoritative tutorial on the arcane complexities of cyber warfare. This edition updates a previous version and makes the book more contemporary. It is a must-read for those who are serious about mastering this unique medium of combat, in all its dimensions.” You can preorder a copy here.

“The New Science that Could Help Spot the Next Pandemic Before It Begins”

Dr. Yong-bee Lim (yet another Biodefense PhD alumni!) recently published his latest article as an Editorial Fellow with The Bulletin of the Atomic Scientists. In it he discusses new and developing ways to monitor emerging infectious disease risks and the benefits of threat-agnostic biodefense. He writes, “As the world continues to face biological event after biological event, significant action must be taken to curtail the worst potential outcomes. New and evolving technologies leveraged towards pathogen-agnostic approaches to biodefense and public health may offer new ways to detect, characterize, and mitigate the risks associated with the emergence of novel pathogens in a wide variety of settings, from farm fields and cities to overseas military bases and hospitals. Some useful technologies and ideas—like pathogen agnostic biodefense–are still in their infancy, others, like whole-genome sequencing remain costly and out of reach, especially in poorer countries.”

“What’s Old Is New Again: Cold War Lessons for Countering Disinformation”

In this article for the Texas National Security Review, Calder Walton discusses how modern strategies to combat disinformation can be informed by history, focusing on the KGB’s targeting of race relations at the 1984 Olympics in Los Angeles and KGB claims that the US engineered the human immunodeficiency virus. He writes “This paper makes three principal arguments. First, applied history is a valuable field of public policy research, as demonstrated by the history of intelligence, disinformation, and international security. Second, the history of Soviet disinformation targeting U.S. domestic racial protests and Washington’s use of bioweapons to cause pandemics shows how and why hostile foreign states use disinformation to attack liberal democracies. Contrary to past and present claims about foreign malign “hidden hands” in U.S. domestic affairs, in fact the Soviet Union’s disinformation strategy, and its impact, were limited: It targeted and amplified existing divisions within American society, doing nothing more than magnifying them. Third, the U.S. government devised policies for countering Soviet disinformation about race and pandemics that are still applicable, even in today’s digital information landscape, where cyber interconnectivity and the prevalence of social media mean that citizens and policymakers drink from a daily firehouse of information. Although the digital revolution has offered unprecedented capabilities through which states can disseminate disinformation, the history of what came before is still relevant and applicable. In fact, it is impossible to understand contemporary foreign state disinformation strategies without appreciating their past. This will become an increasingly important subject as societies become more interconnected this century. The digitized 21st century will witness “infodemic” events, producing so much information that it will be difficult, if not impossible, for audiences to distinguish facts from state-sponsored lies.”

“Fear and Loathing in Moscow: The Russian Biological Weapons Program in 2022”

In this piece for the Bulletin of the Atomic Scientists, Dr. Robert Petersen, an analyst at Denmark’s Centre for Biosecurity and Biopreparedness, offers a comprehensive overview of the history of the Soviet and Russian BW threat, modern Russian biodefense concerns, and the probable state of Russian BW research and development today. He writes, “The Russian accusations and the fears they evoked raise an important question: What is the status of Russia’s own biological weapons program? The Russian government inherited a substantial part of the Soviet biological weapons program following the collapse of the Soviet Union, and what happened to this large program is a mystery. According to the US State Department, the Russian government continues to have a biological weapons program, and the US government did impose sanctions on several Russian military-biological facilities in 2021.”

He continues with, “Although Russia is highly secretive with regard to its biological research enterprise, and there is no definitive proof of an extant bioweapons program, the public record strongly suggests that Russia has maintained and modernized the surviving parts of the Soviet biological weapons program. For instance, the Russian government repeatedly admitted and then, in subsequent years, repeatedly denied inheriting a large part of the Soviet biological weapons program. Also, there are public signs of continuing research into biological weapons (including non-lethal biological weapons) at several locations in Russia. Meanwhile, discussion and policy decisions regarding so-called genetic weapons demonstrate the Russian leadership’s obsession with the idea of a new generation of advanced bioweapons.”

Breathless: The Scientific Race to Defeat a Deadly Virus

David Quammen is back in his latest book, Breathless, which covers the emergence of COVID-19. Erin Garcia de Jesús explains in her review that “The book is a portrait of the virus — SARS-CoV-2’s early days in China, how decades of science helped researchers craft effective vaccines within a year, the arrival of highly mutated variants. It’s not about the societal upheaval or the public health failures (and successes). While Quammen acknowledges the importance of those aspects of the pandemic, he chooses to focus on the “firehose” of scientific studies — both good and bad — that drove our understanding of COVID-19.”

“Protecting U.S. Technological Advantage”

The National Academies recently released this free eBook discussing the importance of technology innovation and leadership for US national security-“U.S. leadership in technology innovation is central to our nation’s interests, including its security, economic prosperity, and quality of life. Our nation has created a science and technology ecosystem that fosters innovation, risk taking, and the discovery of new ideas that lead to new technologies through robust collaborations across and within academia, industry, and government, and our research and development enterprise has attracted the best and brightest scientists, engineers, and entrepreneurs from around the world. The quality and openness of our research enterprise have been the basis of our global leadership in technological innovation, which has brought enormous advantages to our national interests.”

“In today’s rapidly changing landscapes of technology and competition, however, the assumption that the United States will continue to hold a dominant competitive position by depending primarily on its historical approach of identifying specific and narrow technology areas requiring controls or restrictions is not valid. Further challenging that approach is the proliferation of highly integrated and globally shared platforms that power and enable most modern technology applications.”

“To review the protection of technologies that have strategic importance for national security in an era of openness and competition, Protecting U.S. Technological Advantage considers policies and practices related to the production and commercialization of research in domains critical to national security. This report makes recommendations for changes to technology protection policies and practices that reflect the current realities of how technologies are developed and incorporated into new products and processes.”

“Visualizing Potential Pathogen Early Warning for Force Health Protection and Biothreat Response”

“A layered biosurveillance strategy is an essential component of a biodefense strategy for detecting and deterring infectious disease cases and other biological threats. The Council on Strategic Risks has detailed key elements of a biosurveillance network and their interoperability in providing force health protection on a military installation. Additionally, we explore the workflow of an infectious disease outbreak and how the biosurveillance network would be put into practice across the U.S. government.” 

“Dr. Natasha Bajema of the Converging Risks Lab and Brian G. Payne of aTON created these illustrations as a unique visual tool for understanding the scope of equipment, strategy, and people necessary for a successful biosurveillance network.” Learn more and access the illustrations here.

“Baseline Biosurveillance and Early Detection Windows” Credit: Council on Strategic Risks

“Anticipating Rare Events of Major Significance”

This abbreviated proceedings of a workshop is available from the National Academies. It explains that “The Intelligence Community Studies Board of the National Academies of Sciences, Engineering, and Medicine convened a 1- day classified workshop on March 2, 2022, to discuss the Defense Threat Reduction Agency’s (DTRA’s) methodologies and rare event anticipatory models and share insights from the unclassified Workshop on Anticipating Rare Events of Major Significance held on December 17 and 21, 2021. A major goal of both workshops was to examine the methodologies and experiences of other disciplines in dealing with significant rare events with a view to aiding DTRA in examining and further developing its own methodologies to address rare events of particular concern to that agency. In accordance with procedures established by the National Academies for classified activities, this abbreviated version is an unclassified summary of a classified Proceedings of a Workshop—in Brief.”

“Long-Term Impacts of COVID-19 on the Future Academic Careers of Women in STEM”

The National Academies also recently released this proceedings of a workshop-“On March 23-24, 2022, the National Academies of Sciences, Engineering, and Medicine held a virtual workshop to explore the long-term impact of COVID-19 on the future careers of women in STEM. Workshop participants represented multiple sectors (i.e., higher education, government, and non-profit) as well as various career paths and stages (e.g., assistant, associate, and full professors; graduate students; program officers; directors; and policy advisors). The two-day workshop convened experts and leaders to outline a national research agenda that ensures academic institutions and federal agencies are able to monitor and mitigate the long-term negative impacts of the pandemic on the career trajectories, job stability, and leadership roles of women – especially women of color — in STEM. This publication highlights the presentation and discussion of the workshop.”

“The Influenza Imperative: An Urgent Need to Leverage Lessons from COVID-19 to Prepare for a Global Response to Seasonal and Pandemic Influenza”

The National Academy of Medicine recently released this paper discussing the findings of the Advancing Pandemic and Seasonal Influenza Vaccine Preparedness and Response in 2020 initiative’s workshop. The authors explain the aims of it, writing “The National Academy of Medicine convened an initiative on Advancing Pandemic and Seasonal Influenza Vaccine Preparedness and Response in 2020 to collect, understand, and leverage lessons learned from COVID-19 to ensure more robust and nimble preparedness for pandemic and seasonal influenza in the future (NAM, n.d.). By the end of 2021, the Initiative convened a three-day global workshop; and produced a workshop summary and four consensus studies focused on vaccine research and development, globally resilient supply chains, public health interventions, and global coordination and financing (NAM, 2022; NASEM and NAM, 2022a; NASEM and NAM, 2022b; NASEM and NAM, 2022c; NASEM and NAM, 2022d; NAM 2021). This manuscript aims to briefly summarize the four consensus studies, identify areas of focus among the 96 recommendations presented in the studies, and prioritize a small number of these recommendations for immediate action. This manuscript is authored by members of the Initiative’s international committee, which oversaw all of the activities outlined above.”

“Hazardous and Toxic Chemicals on the Move: Under-regulated, Vulnerable, and Dangerous”

Cupitt et al. recently authored an explainer for the Stimson Center discussing security challenges posed by the growing global chemical trade and the threat of chemical terrorism. They explain that “Whether they are fatal events, ecological disasters, or “normal accidents”, the mishandling of hazardous substances during the transport stage poses a serious and perpetual risk to the international community. This is especially true when considering the danger of intentional misuse rather than accidental mishandling.” They offer seven recommendations for states to strengthen transportation security and supply chain verification as well.

“Biological Weapon Monitoring in Iraq”

This new issue of “Historical Notes” is authored by Dr. Gabriele Kraatz-Wadsack, a former weapons inspector with the UN Special Commission (UNSCOM) in Iraq and later Chief of the Weapons of Mass Destruction Branch – UN Office for Disarmament Affairs. In it, “she describes the only instance of international monitoring in the biological weapons (BW) area. It draws on her first-hand experience to launch and manage biological ongoing monitoring in Iraq from 1995 through 1998 both within the country and from UNSCOM Headquarters.” She explains that “The monitoring and verification experience in Iraq illustrates that in-country verification, especially through on-site inspections could generate more timely and more accurate information than from any other source and could also serve as the strongest deterrent to proscribed activities. Unannounced on-site inspections by knowledgeable inspectors were the most powerful tool that was greatly reinforced by the deployment of resident teams inside Iraq. Such inspections credibly increased the probability of timely detection of proscribed activities at any site in Iraq. The success was ultimately due to the commitment, knowledge, skills and dedication of the people who carried out inspection and monitoring activities.”

“Dual-Use Research Needs International Oversight”

In this Nature Correspondence piece, Whitby et al. discuss current challenges and opportunities to better address DURC oversight. They write, “An international system of oversight for dual-use research could usefully be introduced. It could be incorporated, for instance, into the Tianjin Biosecurity Guidelines for Codes of Conduct for Scientists, to be considered at the upcoming Ninth Review Conference of the Biological Weapons Convention (see L. Wang et al. J. Biosaf. Biosecurity 3, 82–83; 2021). The post-pandemic period offers a timely opportunity to raise awareness of dual-use research and for training personnel in ethical reviewing.”

“Needed: Stricter Screening of Gene Synthesis Orders, Customers”

Dr. Gigi Gronvall discusses in this opinion piece for STAT News California’s new law requiring California State University to “…develop systemwide guidance for buying gene synthesis products from companies that screen their orders to minimize the risk of misuse, and requests that the entire University of California system do the same.” She explains that “This will create a competitive advantage for companies that take biosecurity seriously. Widespread screening will make it more difficult for potential nefarious actors to access genetic material that could be used to construct pathogenic viruses, including smallpox, Ebola, or influenza, so this is an important step for biosecurity.” She concludes “The U.S. government and other governments must quickly adopt similar common-sense regulations to normalize the screening process and prevent gene synthesis products from falling into the wrong hands.”

“The Next Pandemic is Right Around the Corner: Let’s Keep It There”

In this opinion piece, Drs. Andre M. Goffinet, Helen E. Mundler, Sebastien Viret, and Roland Wiesendanger propose the creation of a United Nations International Pandemic Pathogens Agency. They write “It is our collective responsibility to ensure that technology is applied for the common good. To cite the most celebrated case, research in nuclear physics led to the discovery of nuclear fission and the development of nuclear reactors, but also to nuclear weapons. Nuclear technology is burdened with deep and obvious moral and ethical issues that led the United Nations to create the International Atomic Energy Agency.”

“The hugely disruptive Covid19 pandemic should trigger an analogous response addressing the risks inherent to research on enhanced pathogens with pandemic potential—hereinafter ePPP.”

“We propose the creation by the UN of an International Pandemic Pathogen Agency, the IPPA…”

“Navigating the Paradox of the Silent Pandemic”

Dr. Alexander Ghionis, a Research Fellow in Chemical and Biological Security at the University of Sussex’s Science Policy Research Unit, recently authored this opinion piece discussing the AMR’s growing threat and the need to improve antibiotic research in addition to stewardship culture. He writes, “Antimicrobial drugs, including antibiotics, are the backbone of modern medicine. They are a primary treatment for a spectrum of ailments, from infected wounds to chest infections, sexually transmitted infections to pneumonia. They underpin treatments for people with compromised immune systems, for example those living with HIV or undergoing cancer treatments. Antibiotics have captured the public’s imagination as a fix-all drug.”

“Primate Hemorrhagic Fever-Causing Arteriviruses are Poised for Spillover to Humans”

In this new Cell article, Warren et al. discuss how SHFV replication in human cells suggests potential for zoonotic transmission. Their summary explains that “Simian arteriviruses are endemic in some African primates and can cause fatal hemorrhagic fevers when they cross into primate hosts of new species. We find that CD163 acts as an intracellular receptor for simian hemorrhagic fever virus (SHFV; a simian arterivirus), a rare mode of virus entry that is shared with other hemorrhagic fever-causing viruses (e.g., Ebola and Lassa viruses). Further, SHFV enters and replicates in human monocytes, indicating full functionality of all of the human cellular proteins required for viral replication. Thus, simian arteriviruses in nature may not require major adaptations to the human host. Given that at least three distinct simian arteriviruses have caused fatal infections in captive macaques after host-switching, and that humans are immunologically naive to this family of viruses, development of serology tests for human surveillance should be a priority.”

“An Updated Review of the Scientific Literature on the Origin of SARS-CoV-2”

Dr. Jose Domingo’s updated lit review on the origin of SARS-CoV-2 is now available as a free PMC article here. Its abstract reads “More than two and a half years have already passed since the first case of COVID-19 was officially reported (December 2019), as well as more than two years since the WHO declared the current pandemic (March 2020). During these months, the advances on the knowledge of the COVID-19 and SARS-CoV-2, the coronavirus responsible of the infection, have been very significant. However, there are still some weak points on that knowledge, being the origin of SARS-CoV-2 one of the most notorious. One year ago, I published a review focused on what we knew and what we need to know about the origin of that coronavirus, a key point for the prevention of potential future pandemics of a similar nature. The analysis of the available publications until July 2021 did not allow drawing definitive conclusions on the origin of SARS-CoV-2. Given the great importance of that issue, the present review was aimed at updating the scientific information on that origin. Unfortunately, there have not been significant advances on that topic, remaining basically the same two hypotheses on it. One of them is the zoonotic origin of SARS-CoV-2, while the second one is the possible leak of this coronavirus from a laboratory. Most recent papers do not include observational or experimental studies, being discussions and positions on these two main hypotheses. Based on the information here reviewed, there is not yet a definitive and well demonstrated conclusion on the origin of SARS-CoV-2.”

What We’re Listening To 🎧

Public Health On Call-#527: The White House’s National Action Plan On Long COVID

From Johns Hopkins: “The Biden administration’s action plan for responding to long COVID is a good start, but much more is required to truly address the impacts of this “mass disabling event” on health, safety, and the economy. Journalist Ryan Prior and inaugural White House Director for Disability Policy Kim Knackstedt talk with Stephanie Desmon about what is included in the nation’s long COVID plan, what was left out, and how the plan could pave the way for responding to other chronic illnesses.” Listen here.

The John Batchelor Show-#Ukraine: The Other Kinds of #WMD. Andrea Stricker, FDD

Listen to John Batchelor discuss WMD threats and Russia’s war in Ukraine with the Foundation for the Defense of Democracies’ Andrea Stricker, research fellow and deputy director of the nonproliferation and biodefense program at FDD. Stricker also recently authored a policy brief, “U.S. Must Show Russia There is No Impunity for Chemical Weapons Use,” alongside FDD’s Anthony Ruggiero.

Interested in Studying Biodefense? Come to Our Information Session!

Are you a Pandora Report reader who just can’t get enough? Consider applying to the Schar School’s Biodefense Program, which offers several graduate certificates, an MS in Biodefense (both in-person and online), and a PhD in Biodefense if you’re really into this. On October 11 at 12 pm ET you can join us virtually to learn more about admissions for the MS and graduate certificates, including info on the application process, student experiences, and graduate outcomes. Register here.

Competing Equities: Biorisk and Global Health

Join TEXGHS for their free October lecture featuring Dr. Taylor Winkelman-Cagle on October 11 at 1 pm CDT. “Biological events have far-reaching impacts that extend beyond borders and defy human efforts at containment. Whether a biological event is a spillover from land use change or an accidental release from a lab, every nation on Earth has equities in the bio-related activities of everyone else. How do we balance these? How do we set the table, so to speak?”

“The focus of this talk will be the intersection of international politics and global health, with an eye to practical, pragmatic solutions and an honest evaluation of the obstacles and barriers that exist (and why some need to remain).” Learn more and register here.

Disinformation: An Emerging War Weapon

“Hosted by the National Defense University Foundation and Moderated by President and CEO, James Schmeling, join us for this interactive virtual discussion. Brief Talk Description: Explore how Russia, China and other entities use misinformation, disinformation, and malinformation as weapons of war and their impact on global security and American democracy.” This online webinar will be hosted on October 20 at 12 pm EST. Register here.

Reflections on Science Communication & Human Rights Amid Public Health Emergencies

“On October 20 (10:30-11:30 am ET),  join Dr. Bina Venkataraman, Editor-at-Large for The Boston Globe, and Dr. Chris Beyrer, Director of Duke University’s Global Health Institute, for a virtual discussion of science communication during public health emergencies, the role of public health researchers and journalists in advancing human rights, and emerging lessons from the COVID-19 pandemic.”

“The conversation will be moderated by Prof. Helle Porsdam, Professor of Law and Humanities and UNESCO Chair in Cultural Rights, Centre for Interdisciplinary Studies of Law, Faculty of Law, University of Copenhagen.” Register here.

Third International Summit on Human Genome Editing

The Third International Summit on Human Genome Editing will take place March 6-8, 2023, at the Francis Crick Institute, London, UK. “Building on previous events held in Washington, DC (2015) and Hong Kong (2018), this Summit will continue the important dialogue around human genome editing. It will facilitate a global discussion on somatic and germline genome editing, including developments in clinical trials and genome editing tools such as CRISPR/Cas9. Earlier this year a three-part series of online events Looking Ahead to the Third Human Genome Editing Summit discussed some of the key topics of the meeting. The three-day summit is being organised by the Royal Society, the UK Academy of Medical Sciences, the US National Academies of Sciences and Medicine and The World Academy of Sciences.”

“Find out more about the Summit’s Planning Committee, chaired by Professor Robin Lovell-Badge FRS FMedSci. Further information about the Summit agenda will be released soon, and registration to attend the event in person and online is now open.”

Dr. Leonard Cole Dead at 89

Dr. Leonard Cole, famous for pioneering terror medicine and chronicling an Army biological weapons program from the 50s and 60s, died on September 18 in Ridgewood, NJ. He was 89 years old.

“NTI Announces Dr. Piers Millett as Inaugural Executive Director of New International Biosecurity Organization, IBBIS”

From the Nuclear Threat Initiative: “NTI is pleased to announce the appointment of Dr. Piers Millett as the founding executive director of the International Biosecurity and Biosafety Initiative for Science (IBBIS), a new organization that will work collaboratively with global partners to strengthen biosecurity norms and develop innovative tools to uphold them…“Our vision for IBBIS is to build a world in which bioscience can flourish safely and responsibly,” said NTI Co-Chair and CEO Ernest J. Moniz. “Piers brings tremendous credibility and expertise to help stand up this vitally important new organization at a time when biological risks are growing.” Read more here.

“Engineering Biology for Climate and Sustainability: A Research Roadmap for a Cleaner Future” Goes Live

The Engineering Biology Research Consortium recently launched its latest roadmap, “Engineering Biology for Climate and Sustainability: A Research Roadmap for a Cleaner Future.” They explain “Engineering Biology for Climate & Sustainability: A Research Roadmap for a Cleaner Future is a critical assessment of opportunities for engineering biology to contribute to tackling the climate crisis and long-term sustainability of products and solutions for health and well-being of Earth and its inhabitants. This roadmap identifies novel approaches, objectives, and aims for engineering biology research in climate change mitigation and adaptation that can help to lower greenhouse gases, reduce and remove pollution, and promote biodiversity and ecosystem conservation. This roadmap also identifies opportunities for engineering biology-enabled, sustainable replacements and alternatives in the food and agriculture sector, transportation and energy sectors, and for materials and industrial processes. The roadmap’s opportunities and objectives are laid out as short-, medium-, and long-term milestones, to address the challenges of climate change and sustainability with both urgency and persistent ambition and vision for the development and translation of engineering biology tools to technologies and products for the current and next-generation bioeconomy.”

Pandora Report: 9.23.2022

Happy fall! It’s finally time to enjoy all things pumpkin spice free of judgement. We will save the judgement for professional matters. Speaking of which…does a pandemic end when the US president says it does? Nope! We kick off this week discussing why the COVID-19 pandemic may be ending but is certainly not over. We also discuss new US export limits on fentanyl to Russia, highlights from the UNGA, and more.

When Does a Pandemic End?

Early this week, President Biden stated that “The pandemic is over,” on “60 Minutes.” He continued by saying “We still have a problem with COVID. We’re still doing a lot of work on it…but the pandemic is over. If you notice, no one’s wearing masks. Everybody seems to be in pretty good shape. And so I think it’s changing.”

“Everybody” is definitely not “in pretty good shape.” There were 25,202 American COVID-19 patients in hospitals across the country the day that President Biden made this statement. The week before his appearance on the show had a 59,856 case 7-day average in the United States, down 71,190 from the week before. This number is also likely low given how many in the US now use at-home testing without reporting positives to public health authorities. Worse, the US averaged 358 COVID-19 deaths that 7-day period, with our national total sitting at 1,047,020 Americans dead from COVID-19 as of September 14. According to estimates by Brookings, around 16 million working-age Americans suffer from long COVID right now, bringing potentially devastating economic and social impacts. While the situation today is better off than the US was with COVID-19 earlier in the pandemic, it is far from over.

Politico wrote of the president’s statement “White House officials on Sunday downplayed Biden’s comments as simply an attempt to reflect where the U.S. is at now, according to Adam— that is, still dealing with Covid but not gripped by a pandemic that is all-consuming. But whether Biden’s phrasing was a gaffe or intentional, the president’s precise words matter for pandemic policy and public health messaging as the U.S. continues its battle with Covid.”

Dr. Peter Hotez, co-director of the Center for Vaccine Development at Texas Children’s Hospital and dean of the National School of Tropical Medicine at Baylor College of Medicine, told CBS “It didn’t make sense from a policy perspective…I don’t want to take away from the fact that the president overall has done a good job as the leader fighting Covid. But you can’t really say the statements are just careless because he said it — I mean, I listened to it — he made a point of saying it twice.”

Politico continued, writing “His remarks also won’t help with the country’s already-struggling booster uptake, Hotez said. The FDA and CDC just authorized a new Covid booster shot, and the White House has pushed Americans to roll up their sleeves for the Omicron-specific vaccine. Earlier this summer, Covid shots became available for young children, but the vaccination rate remains abysmal: Just under 325,000 young children are fully vaccinated across the U.S., according to the CDC.”

The US has also experienced a surge in cases driven by a new variant each winter since 2020. While the US has rolled out bivalent vaccines ahead of the coming winter, only time will tell if this trend will continue, an especially concerning fact given the likelihood of an especially bad flu season on the horizon for the northern hemisphere. Experts like Dr. Hotez remain especially concerned that a new variant is coming and will again wreak havoc in the US.

Hotez and others have also pointed out this is not going to help the president secure the $22.4 billion in additional COVID-response funding the administration is seeking. Predictably, Biden’s declaration triggered partisan response in Congress, with some members demanding that this statement should end measures like DoD’s vaccination requirements and pandemic student loan relief. “This is not a statement you make when you’re trying to persuade the Congress to allocate funds,” Hotez said. “For public health, scientific, policy reasons — not the way to go. He hit the trifecta.”

However, some experts do agree with President Biden’s statement, arguing the US is no longer in the emergency state it was earlier in the pandemic. NPR wrote of Biden’s statement, “It is a reasonable thing to do as we collectively move on from this emergency footing that we’ve been on for the last couple of years, and try to navigate a new normal,” said Dr. Bob Wachter, chair of UCSF’s Department of Medicine. “It’s an appropriate way of thinking about the threat as it stands today.”

So, when does a pandemic end? It definitely isn’t when the US president suddenly says it does, but the answer is still complicated. A pandemic can be considered over when the disease becomes endemic, but that transition isn’t well defined and there is no clear authority to make that judgement call. A pandemic happens when a disease spreads across large regions or world wide, so there is no single leader in charge of declaring it over. Furthermore, the WHO recently refused to say whether or not it will formally recognize an end to the COVID-19 pandemic. A WHO spokesman told CNN “”WHO does not have a mechanism for declaring or ending a “pandemic…’ Instead, he said, WHO will continue to assess the need for the public health emergency, and an expert committee meets every three months to do that.” While the WHO says the world is nearing the end of the COVID-19 pandemic, the Director General still stressed this week that “being able to see the end, doesn’t mean we are at the end.”

This is reflected in US health policy, even as officials stress the country is no longer in the emergency stage. “We are no longer in the emergency phase of the pandemic…we haven’t yet defined what endemicity looks like,” Dr. Ashwin Vasan, NYC Health Commissioner, said at an event with HHS Secretary Xavier Becerra this week. Ultimately, while the situation in the United States is undoubtedly better and improving, this is not the time to let up on the gas.

US Limits Exports of Fentanyl to Russia…and Well Plates?

The US Department of Commerce’s Bureau of Industry and Security (BIS) announced last week that the bureau is applying further restrictions on Belarus and Russia. This move also “…strictly limited the export of fentanyl and related chemicals to Russia, saying that they “may be useful” as chemical weapons to support Russia’s “military aggression,” The Washington Post reports. Under this new rule, fentanyl sales to Russia and Belarus will now require special licensing. This echoes actions taken by the EU this summer to control exports of fentanyl and other related exports to Russia. The 2002 Nord-Ost siege, when Chechen terrorists seized the Dubrovka Theater, culminated with Russian forces filling the theater with an aerosol made from carfentanil and remifentanil, both fentanyl derivatives. This action killed over 100 hostages in the theater in addition to the insurgents, and demonstrated Russia’s interests in these weapons.

In addition to measures controlling quantum computing-related hardware and other matters, the rule released last week specifically “Expands the scope of the Russian industry sector sanctions to add items potentially useful for Russia’s chemical and biological weapons production capabilities and items needed for advanced production and development capabilities that enable advanced manufacturing across a number of industries.” This includes export restrictions on a number of kinds of laboratory equipment that BIS has determined are not manufactured in Russia. The report explains this logic, reading “Therefore, the implementation of restrictive export controls on this equipment by the United States and our allies will economically impact Russia and significantly hinder Russia’s CBW production capabilities.” This list includes items like fermenters and compressors ‘‘specially designed to compress wet or dry chlorine,
regardless of material of construction,” but also well plates and PCR instruments, offering interesting insight into the state of biotech and life sciences research in Russia.

United Nations General Assembly Highlights

The UN General Assembly wraps up its 77th session today following several days of high level engagement, including a speech from President Volodymyr Zelensky of Ukraine. Here are some global health security-related highlights from this session:

Food Security– During a side event on Tuesday, leaders from across Europe, the Americas, and Africa called for immediate funding and action to address the growing food security crisis that has been worsened by Russia’s war in Ukraine. AP reports that “Speaking at a Global Food Security Summit on the sidelines of the annual U.N. General Assembly, the leaders demanded an end to the war, with each calling it a needless “aggression” and Spain’s prime minister accusing Russian President Vladimir Putin of trying to “blackmail” the world with hunger by causing severe disruptions in the export of Ukrainian grain.”

““Russia must end its illegal war against Ukraine, which has certainly been an essential source of the world’s food supply,” Spanish Prime Minister Pedro Sanchez told the gathering. “The truth is that Putin is trying to blackmail the international community with a large part of the world’s food needs. We cannot combat hunger without peace. The world is expecting much from us. Let’s act together, and let’s act now.””

The Global FundThe Global Fund to Fight AIDS, Tuberculosis and Malaria hosted its replenishment conference this week with President Biden, seeking to close its $18 billion funding gap for the next few years. However, the Fund only accumulated $14.25 billion in pledges, though the organization stated it expects the gap will close as more donations come in. The UK and Italy notably delayed their pledges. Sarah Champion discussed this in The Guardian, writing “As the Independent Commission for Aid Impact, the UK’s aid watchdog, stated in its recent report: the Global Fund is the project covered by the government’s Overseas Development Assistance (ODA) that has the greatest value for money. With this in mind, it is hard to believe that the government is choosing to ignore the facts and not fully commit to this cause.”

Non-Communicable Diseases– WHO Director General Dr. Tedros Adhanom Ghebreyesus also released a new report, “Invisible Numbers: The true extend of noncommunicable diseases and what to do about them,” urging world leaders to take action on NCDs, which annually are responsible for 17 million premature deaths and cause nearly three quarters of all global deaths. The report’s description explains “Noncommunicable diseases (NCDs) – chief among them, cardiovascular diseases (heart disease and stroke), cancer, diabetes and chronic respiratory diseases – along with mental health, cause nearly three quarters of deaths in the world. Their drivers are social, environmental, commercial and genetic, and their presence is global. Every year 17 million people under the age of 70 die of NCDs, and 86% of them live in low- and middle-income countries (LMICs).”

Sudan Strain Responsible for Ebola Outbreak in Uganda

Uganda has reported the probable Ebola-related death of a one-year-old , with 11 more suspected cases, one confirmed case, and six more probable cases identified in the country. The WHO reported that Uganda declared an outbreak after a 24-year-old man died after showing symptoms. Samples taken from him were later identified as the relatively rare Sudan strain of Ebola virus, marking the first time this strain has been found in the country. Uganda borders the Democratic Republic of Congo, which recently reported a new case after experiencing its fourteenth outbreak earlier this year. Uganda’s last Ebola outbreak was driven by the Zaire strain in 2019, though the country’s deadliest Ebola outbreak came in 2000, leaving over 200 dead.

The WHO released a statement from Dr. Matshidiso Moeti, WHO Regional Director for Africa, in which she explained “Uganda is no stranger to effective Ebola control”, she said. “Thanks to its expertise, action has been taken to quickly to detect the virus and we can bank on this knowledge to halt the spread of infections.” The WHO also explained that “Existing vaccines against Ebola have proved effective against the Zaire strain but it is not clear if they will be as successful against the Sudan strain,” in its statement.

“FDA Repeatedly Adapted Emergency Use Authorization Policies To Address the Need for COVID-19 Testing”

The HHS Office of Inspector General released this report this week on FDA’s use of its EUA authority to authorize COVID-19 tests early in the pandemic. The OIG report found that:

“The failure of the Centers for Disease Control and Prevention (CDC)’s first test rollout revealed vulnerabilities in the Federal approach to testing early in the COVID-19 pandemic. It is typical for CDC to be the first to receive an EUA, and FDA expected that the CDC’s test would meet the early testing needs of the nation. However, CDC’s first test was unusable for many for weeks while no other test was authorized. Furthermore, due in part to its limited engagement with the public health labs that were using CDC’s test, FDA was slow to realize that testing by public health labs was far more limited than it initially expected. To address problems with the first authorized COVID-19 test, FDA worked with CDC, including allowing CDC to modify the terms of its original EUA. However, preventing a similar problem from occurring in future emergencies would require actions outside of FDA’s authority alone.

In using its EUA authority, FDA also made calculated decisions to increase availability of COVID-19 testing, but these decisions often came at a potential cost to test quality. FDA authorized tests using lower levels of evidence to support developers struggling to access clinical samples. FDA’s policies allowed diagnostic and serology tests to get on the market quickly; however, that resulted in some problematic tests on the market, requiring further action by FDA.

FDA’s decision to accept all EUA requests resulted in a record number of submissions-often low-quality and from developers lacking experience with FDA’s processes. In response, FDA took steps to support developers and ease its workload, which included issuing EUA guidance, updating templates (submission guides for developers requesting EUA), and adjusting its EUA review process, among others. Some developers still reported being frustrated and confused.”

“Health Care and the Climate Crisis: Preparing America’s Health Care Infrastructure”

The House Ways and Means Committee recently released its report analyzing responses to an RFI sent to hospitals, health systems, and health care providers to “better understand how climate events have impacted the health sector, as well as steps the health care industry is taking to address its role in mitigating the climate crisis.” The committee explains that “Health Care and the Climate Crisis: Preparing America’s Health Care Infrastructure includes an overview of the role the U.S health system plays in the climate crisis. Part One provides an overview of the problem, description of Chair Neal’s 2022 Request for Information (RFI), and summary statistics from an analysis of survey respondents. Part Two examines how the climate crisis and the prevalence of extreme weather events impact health care organizations. Part Three describes how health care organizations are assessing their climate impact and working to reduce their respective carbon footprints. Part Four summarizes findings and provides a discussion of implications. Part Five is an appendix with survey methodology, limitations, and supplemental tables.”

“Strengthening the Biological Weapon’s Convention’s Contributions to Global Health Security”

This Think Global Health piece discusses false Russian BW allegations and the recent invocation of Article V of the BWC. The authors explain “Russia’s disinformation regarding Ukrainian biological laboratories is intended to distract and divide global attention concerning its reprehensible actions in Ukraine and to generate post hoc justification for its invasion. Russian invocation of Article V risks tainting the BWC consultation mechanism and abusing it to air political grievances and foment distrust. And, like the 1997 consultations, BWC parties reached no consensus, highlighting major challenges to the mechanism in the face of complex geopolitical tensions.”

“Harnessing the Power of Science and Technology Communities for Crisis Response”

The RAND Corporation recently released this Perspective, co-authored by Dr. Daniel M. Gerstein, a Biodefense PhD Program alumnus, discussing DHS’s “…ability to leverage science and technology communities to support the use of science, technology, innovation, and analytical capabilities during crisis response.” The abstract explains, “RAND researchers conducted a literature review and discussions with subject-matter experts to understand how these capabilities have been used during past national security crises and how they could be used in the future. In this Perspective, the researchers offer a conceptual framework for employment of the science and technology communities’ capabilities during crisis response. They also present five imperatives that should be considered for providing technical support during a crisis and a concept for how to institutionalize that support. These critical elements form the basis for providing quality technical support to crisis leadership.”

“What is the Future of the Global Health Security Agenda?”

The Pandemic Action Network released this piece last week discussing the future of GHSA, explaining “The GHSA is now at an inflection point. While GHSA has built a strong community, the COVID-19 pandemic has also stress-tested domestic and global health systems and raised questions about the reach, relevance, and impact of this partnership. Despite its success as a forum for collaboration and incubator for health security concepts and networks, GHSA has been less visible as part of the global response to the COVID-19 pandemic, missing an important opportunity to activate its coordination mechanisms to support global policy discussions on the future of the global health security architecture.”

What We’re Listening To 🎧

This Podcast Will Kill You “Episode 105 Down in the Mumps”

From TPWKY: “We’ve covered measles, we’ve taken on rubella, and now we’re finishing up the classic MMR vaccine by exploring the other M: mumps. To some listeners, mumps may be a painful childhood memory while to others it’s just a letter in a vaccine they were too young to remember getting. But by the end of this episode, we promise that you’ll all be much more familiar with this strange little virus. How does the mumps virus make you sick and give you that classic swollen face look? What is so bad about the mumps that Maurice Hilleman decided to snag a mumps sample from his sick daughter to make a vaccine? Where do we stand with mumps today and what do declining vaccination rates have to do with those not-so-great numbers? Tune in to hear our take on all these questions and many more in this classic TPWKY episode.” Listen here.

National Biodefense Science Board Public Meeting

The National Biodefense Science Board (NBSB) is hosting its next public meeting on September 29 at 11 am ET. “This public meeting of the NBSB will focus on several topics, including the collection, analysis, and sharing of operational health data and/or development and implementation of systems to ensure the availability of virtual healthcare (telehealth, telemedicine, etc.) during a disaster. The NBSB is particularly concerned with the impacts of COVID-19 on rural and underserved communities, including the ways in which those communities succeeded or were challenged in conducting a public health response, and ways in which HHS can support strengthening of systems, technologies, and partnerships that will lead to improvements in data collection and virtual care during disasters.” Learn more and register here.

Introducing the Global Guidance Framework for the Responsible Use of the Life Sciences: Mitigating Biorisks and Governing Dual-Use

The WHO is offering this open webinar on 3 October 2022, 13:30-14:30 CEST, where an expert panel will introduce the recently released global guidance framework for the responsible use of the life sciences: mitigating biorisks and governing dual-use research and discuss its applications for different stakeholders. The panel will include a number of WHO experts as well as Drs. Anita Cicero and Filippa Lentzos. Learn more and register here.

Interested in Studying Biodefense? Come to Our Information Session!

Are you a Pandora Report reader who just can’t get enough? Consider applying to the Schar School’s Biodefense Program, which offers several graduate certificates, an MS in Biodefense (both in-person and online), and a PhD in Biodefense if you’re really into this. On October 11 at 12 pm ET you can join us virtually to learn more about admissions for the MS and graduate certificates, including info on the application process, student experiences, and graduate outcomes. Register here.

iGEM Responsibility Conference: Navigating the Future of Synthetic Biology

“For the first time ever, iGEM’s Responsibility Program is running a dedicated Responsibility Conference on the margins of this year’ s Grand Jamboree. The theme is ‘Navigating the future of synthetic biology’. The event is taking place from 26-27 October 2022 at the Paris Expo, Porte de Versailles, Paris, France. Join policy makers, technical experts, and other experts from around the world in exploring: Safe, secure, & responsible synbio beyond containment; Negotiating competing ideas of doing good; Applied biosafety & biosecurity; Lessons for governance of emerging technologies. If you are interested in taking part in this exciting new event, please register your interest online here, or contact us directly at responsibility@igem.org.”

Pathogens Project Launched

This week, “a group of scientists and public health leaders, convened by the Bulletin of the Atomic Scientists, launched an international taskforce to consider trends and oversight of high-risk pathogen research. This follows the WHO’s recent release of the “Global guidance framework for the responsible use of the life sciences: mitigating biorisks and governing dual-use research.”

“Over the next few months, the initiative on “Creating the Framework for Tomorrow’s Pathogen Research” will discuss risk assessment and mitigation, including lab-based outbreak risks.   A public-facing conference in Geneva, Switzerland on April 19-21, 2023, will include task force members, policy leaders, journalists, scientists, and civic leaders, among others, and will produce a summary report with recommendations for a comprehensive global approach to management of extremely high-risk biological research.”

Read more about the project here.