COVID-19 – The Pandora Report

Pandora Report 5.10.2024

May 10, 2024 by dkellogg97, posted in Pandora Report

This week’s Pandora Report covers a new interim staff report from the House Select Subcommittee on the Coronavirus Pandemic, the new United States Government Policy for Oversight of Dual Use Research of Concern and Pathogens with Enhanced Pandemic Potential, the OPCW’s statement on Russia’s alleged use of toxic chemicals as weapons in Ukraine, and more.

GMU Biodefense Students Visit National Museum of Health and Medicine

“Late last month a cadre of students from the Schar School of Policy and Government’s biodefense graduate program visited the National Museum of Health and Medicine in Silver Spring, Maryland, not far from the George Mason University campuses.”

“The 150-year-old museum is known for its collections that depict the human anatomy and everything that can befall it, in sometimes stark and gory detail. What else would you expect from a museum with a pathology guide with listings for “bilateral nephrolithiasis (kidney stones),” “liver, hydatid cyst from tape worm,” and an all-time-favorite, “trichobezoar (human hairball from stomach).”’

Read more about this visit here on the Schar School’s website.

*GMU Biodefense students at the National Museum of Health and Medicine*

Select Subcommittee on the Coronavirus Pandemic Interim Staff Report Calls for Daszak, EcoHealth Alliance Debarment

Earlier this month, the House Select Subcommittee on the Coronavirus Pandemic’s chairman, Rep. Brad Wenstrup (R-OH), released an interim staff report-“An Evaluation of the Evidence Surrounding EcoHealth Alliance, Inc.’s Research Activities”. The press release explains in part, “This report details the Select Subcommittee’s comprehensive investigation into the U.S. government’s funding and lack of oversight of gain-of-function research, EcoHealth Alliance (EcoHealth), and the Wuhan Institute of Virology (WIV). The report reveals serious, systemic weaknesses in the National Institute of Allergy and Infectious Diseases (NIAID) and National Institutes of Health’s (NIH) grant procedures and examines how these failures enabled EcoHealth President Dr. Peter Daszak to fund dangerous gain-of-function research in Wuhan, China without sufficient oversight.”

The select subcommittee’s recommendations include:

“The Select Subcommittee on the Coronavirus Pandemic recommends that EcoHealth Alliance and Dr. Peter Daszak are formally debarred and cut off from receiving any future U.S. taxpayer funding.”
“The Select Subcommittee also recommends that the U.S. Department of Justice conduct a formal investigation into Dr. Daszak.”
“Further, the Select Subcommittee recommends eight improvements to NIAID and NIH procedures that will improve grant compliance, increase biosafety and biosecurity of high-risk research, and advance transparency and accountability in America’s federal health agencies.”

Daszak testified before the select subcommittee on the day the report was released, which was covered by Matt Field in The Bulletin of the Atomic Scientists. Field explains in his coverage that Daszak was grilled by members of both major political parties during the subcommittee’s hearing on May 1, writing “On Wednesday, however, members of both US political parties came armed with blistering criticism for Peter Daszak, the head of the nonprofit EcoHealth Alliance, questioning his honesty in dealing with federal agencies and skewering his alleged conflicts of interests as he attempted to assume the role of a leading scientific voice on the pandemic’s origins. Beginning in 2014, EcoHealth ran a US-funded, multimillion-dollar project to identify hotspots where patterns of interaction between humans and animals could spark disease outbreaks.”

He later writes, “They hammered away on one of the plot points in the origins debate, EcoHealth’s transparency in reporting on its studies to the National Institutes of Health (NIH). Over the course of one five-year grant, EcoHealth was supposed to submit annual reports. One of those, covering 2018-2019, came two years late. Daszak claimed that EcoHealth had tried to submit the report, but the NIH had a problem with its computerized reporting platform. According to a report by the subcommittee’s Democrats, however, a forensic audit found no evidence for this assertion.”

Chairman Wenstrup said in a statement, ““EcoHealth Alliance President Dr. Peter Daszak is not a good steward of U.S. taxpayer dollars and should never again receive funding from the U.S. taxpayer. Dr. Daszak and his organization conducted dangerous gain-of-function research at the WIV, willfully violated the terms of a multi-million-dollar NIH grant, and placed U.S. national security at risk. This blatant contempt for the American people is reprehensible. It is imperative to establish higher standards of oversight at the NIH. The Select Subcommittee’s detailed and comprehensive report today holds Dr. Daszak and EcoHealth Alliance accountable and sheds light on severe shortcomings in our public health systems.”

US Agencies Set to Tighten Gain-of-Function Research Oversight

This White House announced this week the new United States Government Policy for Oversight of Dual Use Research of Concern and Pathogens with Enhanced Pandemic Potential and accompanying implementation guidance, following years of public debate and recommendations made by the National Science Advisory Board for Biosecurity. As the New York Times explains, “The new policy, which applies to research funded by the federal government, strengthens the government’s oversight by replacing a short list of dangerous pathogens with broad categories into which more pathogens might fall. The policy pays attention not only to human pathogens, but also those that could threaten crops and livestock. And it provides more details about the kinds of experiments that would draw the attention of government regulators.”

Read Max Kozlov’s summary and discussion of this new policy in Nature.

Emergent BioSolutions Announces Layoff Plans, Plant Closures

Emergent BioSolutions, the Gaithersburg-based company best known for producing Narcan, has announced it is shuttering its Maryland manufacturing facilities and laying off about 300 employees. This includes its Baltimore-Bayview Drug Substance manufacturing facility and its Rockville Drug Product facility, according to The Baltimore Banner. The company has also said it will eliminate 85 currently vacant positions. This is all on top of the more than 230 Maryland employees Emergent laid off last year.

Emergent drew national attention in the summer of 2021 after the company, which had secured a government contract to produce COVID-19 vaccines on behalf of Johnson & Johnson and AstraZeneca, came under Congressional scrutiny for potentially contaminating at least 75 million vaccine doses. Furthermore, as The New York Times highlighted at the time, “With its stock price cut in half, Emergent faces several shareholder lawsuits accusing it of securities fraud, and a pension fund filed a complaint last Tuesday claiming that some executives and board members — including several former federal officials — had engaged in insider trading by unloading more than $20 million worth of stock over the past 15 months.”

An investigation found that Emergent was forced to destroy or discard up to 400 million doses’ worth of ingredients for COVID-19 vaccines. ABC News explained in a piece about the report that “Congressional investigators probing the Maryland-based biotech company found that Emergent executives had privately raised urgent quality-control concerns even before the company began manufacturing the vaccines’ key ingredient — despite publicly expressing confidence in their ability to deliver on their multimillion-dollar government contract.”

‘”Despite major red flags at its vaccine manufacturing facility, Emergent’s executives swept these problems under the rug and continued to rake in taxpayer dollars,” House Oversight and Reform Committee Chairwoman Carolyn Maloney, D-N.Y., said of the report, which determined that the company’s “manufacturing failures and deceptive tactics” led to the large-scale waste of ingredients that could have helped make millions of vaccine doses.”

Emergent’s stock price did jump following the announcement of the layoffs, finishing yesterday at $4.37 up from $1.93 on May 1, a far cry from the $130 its shares were traded for in August 2020. According to The Baltimore Banner, “The company estimated that the restructuring will cost up to $21 million this year and save the company about $80 million annually. In a filing with the U.S. Securities and Exchange Commission, Emergent said most of those initial costs will be related to severance and benefits.”

OPCW Releases Statement on Ukraine

The OPCW released this week a statement about Russia’s alleged use of toxic chemicals as weapons in Ukraine. It reads in part “The Secretariat of the Organisation for the Prohibition of Chemical Weapons (OPCW) has been monitoring the situation on the territory of Ukraine since the start of the war in February 2022 in relation to allegations of use of toxic chemicals as weapons…The information provided to the Organisation so far by both sides, together with the information available to the Secretariat, is insufficiently substantiated.”

Read more here.

Mason Biodefense Graduate Program Director Discusses AI, Biological Weapons Risks with CNN

Biodefense Graduate Program Director Gregory Koblentz was recently interviewed in this May 5 CNN Newsroom segment covering AI and biological weapons proliferation risks. It was filmed ahead of the release of an episode of CNN’s “How It Really Happened” focused on the 2001 Amerithrax attacks.

“2024 U.S. Department of State Report on North Korea’s ‘Genetic Scissors’ Technology and Capabilities and Its National Security Implications”

This report from the Institute for National Security Strategy was co-authored by Biodefense PhD Program alumnus Hyun Jung Kim: “The recent U.S. State Department’s report, titled “2024 Adherence to and Compliance with Arms Control, Nonproliferation, and Disarmament Agreements and Commitments,” articulates that North Korea has acquired the capability to genetically engineer biological products utilizing CRISPR. This report raises alarms over the potential transformation of this genetic engineering technology into an offensive biological weapons program. CRISPR, often referred to as ‘genetic scissor’ technology, renowned for its ability to precisely cut and replace sections of the genome, holds promise for groundbreaking developments in medicine, agriculture, and energy sectors. However, this technology also faces several challenges, including ethical and institutional issues and safety concerns. The national security threats posed by the advancement of North Korea’s genetic engineering technology include unconventional warfare tactics such as terrorism and targeted assassinations, the potential leakage of genetically modified bioagents due to laboratory accidents, and the proliferation of weapons of mass destruction. Furthermore, the same report notes the development of ‘dual-use marine toxins’ by the Chinese People’s Liberation Army, which may imply possible strategic cooperation and coordination between China and North Korea in the development of biological toxins, posing a significant challenge to the international security landscape.”

“China, Biotechnology, and BGI: How China’s Hybrid Economy Skews Competition”

Anna Puglisi and Chryssa Rask recently published this issue brief with Georgetown’s Center for Security and Emerging Technology: “As the U.S. government considers banning genomics companies from China, it opens a broader question about how the United States and other market economies should deal with China’s “national champions.” This paper provides an overview of one such company—BGI—and how China’s industrial policy impacts technology development in China and around the world.”

“The National Blueprint for Biodefense: Immediate Action Needed to Defend Against Biological Threats”

This latest report from the Bipartisan Commission on Biodefense urges policymakers to adopt several measures to help sustain and grow US biodefense, including establishing a congressional working group focused on biodefense at the start of each Congress, making amendments to the Public Health Service Act in order to “produce a research and development plan for reducing pathogen transmission in built environments,” and replacing BioWatch.

In addition to the report linked above, Axios’ Alison Snyder has summarized the report and provided context to its recommendations here.

“Twenty Years of Preparedness: Reflecting on the Legacy of the Project BioShield Act of 2004”

Adey Pierce-Watkins and Tanima Sinha recently published this report for BDO: “This July 2, 2024, marks the 20th anniversary of The Project BioShield Act of 2004 (P.L. 108-276); legislation enacted in response to the anthrax attacks of September 2001, which revealed the need for development and acquisition of medical countermeasures (vaccines, therapeutics, and diagnostics) to protect the U.S. population from chemical, biological, radiological, and nuclear (CBRN) threats. This Act, and associated Congressional Appropriations, established a Special Reserve Fund (SRF) of $5.593B advanced funding available over a 10-year period for the advanced development and procurement of medical countermeasures with the intent of initiating a new posture of national preparedness.1 Simultaneously, this legislation created new market incentives for pharmaceutical and biotech companies to engage in the development of CBRN medical countermeasures and transformed the partnership between the federal government and industry into a shared responsibility for increasing preparedness against CBRN threats. As a result, this legislation and the SRF created a “guaranteed market” for pharmaceutical companies to produce CBRN medical countermeasures for which there previously was no commercial demand…In recognition of the 20th Anniversary of The Project BioShield Act, it is fitting to highlight the impact and milestones of this legislation based on its intended purpose and outcomes to date.”

“It Shouldn’t Be Easy to Buy Synthetic DNA Fragments to Recreate the 1918 Flu Virus”

Kevin M. Esvelt recently authored this piece for STAT News, writing in part “It should be hard — exceedingly hard — to obtain the synthetic DNA needed to recreate the virus that caused the deadly 1918 influenza pandemic without authorization. But my lab found that it’s surprisingly easy, even when ordering gene fragments from companies that check customers’ orders to detect hazardous sequences…Our experiment demonstrates that the immense potential benefits of biotechnology are profoundly vulnerable to misuse. A pandemic caused by a virus made from synthetic DNA — or even a lesser instance of synthetic bioterrorism — would not only generate a public health crisis but also trigger crippling restrictions on research.”

Applied Biosafety Special Issues on Biosafety and Biosecurity for Synthetic Genomics

Applied Biosafety‘s first and second special issues focused on biosafety and biosecurity for synthetic genomics is now available online. Articles include “Enhancing Gene Synthesis Security: An Updated Framework for Synthetic Nucleic Acid Screening and the Responsible Use of Synthetic Biological Materials,” “Developing a Common Global Baseline for Nucleic Acid Synthesis Screening,” Biosecurity Risk Assessment for the Use of Artificial Intelligence in Synthetic Biology,” “Biosecurity Assessments for Emerging Transdisciplinary Biotechnologies: Revisiting Biodefense in an Age of Synthetic Biology,” and more.

“Supporting Follow-Up Screening for Flagged Nucleic Acid Synthesis Orders”

Tessa Alexanian and Sella Nevo recently published this briefer with CSR’s Nolan Center, writing in part “Medical diagnostics, biomanufacturing, and many other parts of the bioeconomy rely on synthetic DNA and RNA purchases, which are ordered from commercial providers and shipped to laboratories around the globe. In addition to enabling beneficial biotechnology, affordable and accessible nucleic acid synthesis raises biosecurity concerns: some sequences can be used to reconstruct pathogen genomes or engineer dangerous biological agents, and it’s necessary to ensure those sequences are not misused by actors seeking to cause harm.”

“Most commercial synthesis providers screen the orders they receive to identify sequences of concern that could facilitate the construction of dangerous biological agents. When sequences in an order are flagged, follow-up screening determines whether the order is fulfilled. This screening centers on the customer: do they have a legitimate, peaceful purpose for obtaining the flagged sequences of concern?”

“This follow-up screening is the subject of this briefer. Between July and August 2023, we interviewed industry contacts and other policy and biosecurity experts. In the subsequent months, we conducted independent research and solicited expert feedback on report drafts. This process made clear that today, the follow-up screening process is ad-hoc. The customer service representatives, bioinformaticians, and security experts conducting follow-up screening often lack support for handling ambiguous cases, and there is little infrastructure to support information-sharing with other synthesis providers or law enforcement…”

“Developing a Customer Screening Framework for the Life Sciences”

A new report from Blueprint Biosecurity: “Since the 1970’s and the advent of recombinant DNA, biology has consistently become easier to engineer, and the pace of these advances is increasing. Many tools and capabilities for engineering biology are becoming more powerful, more affordable, and more widely available. These capabilities are critical for basic scientific research as well as advances in health, agriculture, and a wide range of applications in the burgeoning bioeconomy. However, access to these tools also raises the possibility that they could be accidentally or deliberately misused to cause harm by enabling development of toxins, pathogens, or other dangerous biological agents, including some not found in nature. Potential biological harms include high-consequence events such as the development and release of an engineered pathogen that causes a global catastrophe as well as a wide range of lower-consequence, higher-likelihood events. To prevent this type of misuse, policy experts have recommended expanding customer screening practices and policy frameworks to include a broad range of life sciences products, services, and infrastructure (Carter and DiEuliis, 2019a). Recent advances in artificial intelligence (AI) have increased this type of risk and have intensified these calls for action (Carter, et al., 2023; Helena, 2023).”

“To Combat Cow Flu Outbreak, Scientists Plan to Infect Cattle with Influenza in High-Security Labs”

Science’s Kai Kupferschmidt discusses current efforts to better understand H5N1 in this piece, writing in part “The avian influenza virus that has been infecting dairy cows and spreading alarm in the United States was expected to reach Germany this week. But that’s actually good news. A shipment of samples of the H5N1 virus from Cornell University virologist Diego Diel is destined for the Federal Research Institute for Animal Health in Riems, which has one of the rare high-security labs worldwide that are equipped to handle such dangerous pathogens in cattle and other large animals. There, veterinarian Martin Beer will use the samples to infect dairy cows, in search of a fuller picture of the threat the virus poses, to both cattle and people, than researchers have been able to glean from spotty data collected in the field.”

“Biodiversity Loss is Biggest Driver of Infectious Disease Outbreaks, Says Study”

This piece from The Guardian discusses the findings of a recent Nature meta-analysis: “New infectious diseases are on the rise and they often originate in wildlife. In meta-analysis published in the journal Nature, researchers found that of all the “global change drivers” that are destroying ecosystems, loss of species was the greatest in increasing the risk of outbreaks. Biodiversity loss was followed by climate change and introduction of non-native species.”

“Washington Accuses Russia of Chemical Weapons Attacks in Ukraine”

Andrea Stricker and Anthony Ruggiero recently authored this piece for the Foundation for Defense of Democracies that summarizes the United States’ claim that Russia has used CW in Ukraine, writing in part “The United States last week accused Russia of using chemical weapons against Ukrainian troops and sanctioned 12 Russian entities and individuals associated with Vladimir Putin’s ongoing chemical weapons program. The finding points to yet another instance of Moscow’s violation of international norms and conventions through the continued possession, stockpiling, and use of chemical weapons.”

“The Alleged Use of Chemical Weapons in Ukraine: How the International Community Can Investigate”

Ahmet Üzümcü recently authored this commentary piece for the European Leadership Network, explaining in part “I have summarised above the different mechanisms employed in the recent past to investigate allegations of the use of chemical weapons. I believe that one of them might be activated to investigate reported incidents in Ukraine. Whichever is selected may not enjoy the support of the whole membership; however, if one of the options is chosen, it needs to be practical and produce concrete results despite the challenges associated with the ongoing conflict. One of the strengths of the OPCW’s robust verification and compliance regime has always been its level of expertise and objectivity in the area of chemical weapons. The international community could leverage these strengths to test the veracity of the allegations that have been levelled against Russia about chemical weapons use during the armed conflict in Ukraine. The States Parties to the Chemical Weapons Convention should support such an initiative for two reasons: first, to provide a deterrent effect against further alleged uses of chemical weapons, and second, to uphold the integrity and credibility of the Chemical Weapons Convention, which is one of the pillars of the rules-based international order.”

ICYMI: Biological Weapons Convention Scientific and Technological Advisory Mechanism

From the UN Institute for Disarmament Research: “The Friends of the Chair, together with UNIDIR and @unitednations_disarmament, organized this informal webinar on a BWC scientific and technological advisory mechanism. This webinar was designed to support ongoing activities of the BWC Working Group and to stimulate thinking and discussion around a mechanism during the intersessional period. The event consisted of an expert panel followed by a moderated question-and-answer session with the audience.”

Watch here.

NEW-Slaves to the Bomb: The Role & Fate of N. Korea’s Nuclear Scientists

“The Committee for Human Rights in North Korea (HRNK) is delighted to invite you to the rollout of its latest report, Slaves to the Bomb: The Role & Fate of North Korea’s Nuclear Scientists by Robert Collins. The event will be open to the press and on the record. The report will be published on HRNK’s website on the day of the report rollout.”

This event will take place on May 17, at 3 pm EST. Learn more and RSVP here.

NEW-Getting Ahead of Avian Influenza: Why Organizations Need to Prepare Today

From Bluedot: “Highly Pathogenic Avian Influenza A(H5N1), commonly referred to as bird flu, has been making headlines around the world, as the virus rapidly spreads to new animal species. Already the cause of a panzootic (global animal pandemic), last month a human H5N1 case was reported in the U.S. after likely contracting it from infected dairy cattle. The virus has now been detected in dairy herds across multiple states, with evidence to suggest it has been spreading more widely than previously thought — begging the question: Are we at risk for an avian influenza-instigated pandemic?”

“Join us for a deep dive into avian influenza as we explore why and how organizations should prepare to safeguard against bird flu. Together, through collaborative efforts and informed decision-making, we can mitigate the risk of increased transmission to humans. BlueDot’s experts have been closely monitoring the situation and potential risks, issuing multiple alerts on H5N1 — and other avian influenzas — over the past 15 months.”

This event will take place on May 23, at 11 am ET. Learn more and register here.

Biosafety and the Origin of the COVID-19 Pandemic: Evidence and Policy Implications

From Brookings: “The world just lived through the COVID-19 pandemic, with more than 7 million reported direct deaths globally, more than 775 million reported cases, more than 14 million indirect excess deaths, and likely millions more unreported deaths. Despite the devastating effects on people and economies around the world, we still do not know with certainty how the pandemic originated, with the two most likely hypotheses either a natural spillover from an animal host or a research lab leak. Finding an answer to this question is not just a matter of doing justice to the millions of victims of COVID-19—it will have significant ramifications for policy implementation to help prevent the next pandemic.”

“Importantly, the catastrophic impact of the COVID-19 disease has shown us that preventing the next pandemic and biosafety in general should be top of mind for researchers, regulators, policymakers and public health officials, and it will likely require an array of measures by private, public, and nongovernmental organizations. This includes reconsidering our early warning systems for emergent diseases from the natural world, and taking a closer look at research with dangerous pathogens in biolabs. Identifying the origins of the recent pandemic can help target those efforts.”

“On May 14, the Brookings Center on Regulation and Markets will address these complex questions. First, Alina Chan, scientific advisor at the Broad Institute, and Alison Young, Curtis B. Hurley chair in public affairs reporting at the University of Missouri School of Journalism, will explain why the origin of the SARS-CoV-2 virus matters for public policy. Then, a balanced expert panel will debate the two most likely origins: natural spillover or a leak from a lab. A final panel of biosafety experts will discuss what measures would be best suited to improve biosafety and reduce the risks for research-related lab incidents as well as future pandemics. This event is a part of the CRM series on Reimagining Modern-day Markets and Regulations.”

This online event will take place on May 14 at 1:30 pm EDT. Learn more and access the event here.

Addressing the Challenges Posed by Chemical and Biological Weapons: Intensive Online Introductory Course for Students of Technical Disciplines

“SIPRI and the European Union Non-Proliferation and Disarmament Consortium (EUNPDC) invite graduate and postgraduate students of the technical or natural science disciplines to apply for an intensive online introductory course on chemical and biological weapons—their proliferation, the efforts to eliminate them, the various mechanisms used to control their spread—and endeavours underway to reduce the risk of chemical or biological agents in terrorist attacks. The course will take place online, during four half-days on 28–31 May 2024, 14:00 to 18:00 Central European Summer Time (CEST).”

“The course will cover the fundamentals of chemical and biological weapons as well as of missiles and other means of delivery; the history of chemical and biological warfare; the evolution of international norms against these weapons; the threats associated with potential terrorist uses of chemical and biological material; bioweapons and other related scientific advances; the current challenges posed by chemical weapons; arms control treaties; and mechanisms to curb the spread of dangerous substances, including export controls.”

“The course will also discuss the role of the EU institutions and industry to address the challenges mentioned above. The course will be instructed by renowned experts on non-proliferation, arms control, disarmament, export controls, verification and related subjects from SIPRI, other European research centres, think tanks and international organizations.”

Learn more and apply here.

Registration for GHS 2024 Now Open

Registration is now open for the Global Health Security 2024 conference in Sydney, Australia. This iteration will take place 18-21 June, 2024. The call for abstracts is also still open. “The mission of the Global Health Security conference is to provide a forum where leaders, researchers, policy-makers, and representatives from government, international organisations, civil society, and private industry from around the world can engage with each other, review the latest research and policy innovations, and agree solutions for making the world safer and healthier. To that end, our mission is to help foster a genuinely multidisciplinary community of practice that is committed to working collaboratively to enhance global health security and eliminate disease, irrespective of its origin or source.”

SBA.3 International Synthetic Biology, and Biosecurity Conference in Africa

“Join us for the SBA.3 International Synthetic Biology and Biosecurity Conference in Africa, a groundbreaking event that brings together experts, researchers, and enthusiasts in the field of synthetic biology. This in-person conference will take place at the Laico Regency Hotel from Wed, Jul 17, 2024 to Friday, Jul 19, 2024.”

“Get ready to dive into the exciting world of synthetic biology and explore its potential applications in Africa. From cutting-edge research to innovative solutions, this conference offers a unique opportunity to learn, network, and collaborate with like-minded individuals.”

“Discover the latest advancements, trends, and challenges in synthetic biology through engaging keynote speeches, interactive workshops, and thought-provoking panel discussions. Immerse yourself in a vibrant atmosphere where ideas flow freely and new connections are made.”

“Whether you’re a seasoned professional or just starting your journey in synthetic biology, this conference provides a platform to expand your knowledge, exchange ideas, and contribute to the growth of the field in Africa.”

“Don’t miss out on this extraordinary event that promises to shape the future of synthetic biology and biosecurity in Africa. Mark your calendars and join us at the SBA.3 International Synthetic Biology and Biosecurity Conference in Africa!”

Learn more and register here.

IBBIS Announces The Common Mechanism

The International Biosecurity and Biosafety Initiative for Science (IBBIS) recently launched The Common Mechanism, “An open-source, globally available tool for DNA synthesis screening.” The organization explains on its website that “The Common Mechanism helps providers of synthetic DNA and RNA to effectively screen orders to prevent synthesis technology from being exploited. We provide free, distributed, open-source, automated software for screening sequences of nucleic acids (including DNA and RNA) as well as resources to facilitate customer screening.”

Learn more and access the tool here.

Pandora Report 3.22.2024

March 22, 2024March 22, 2024 by dkellogg97, posted in Pandora Report

Happy Friday! This week’s Pandora Report covers progress on the ninth round of negotiations on a Pandemic Accord and proposed amendments to the International Health Regulations, Murthy v. Missouri and the evolving threat of health and medical misinformation, a recently launched Senate biodefense and life science research investigation, EPA’s warnings about cyberattacks against the United States’ water infrastructure and more.

Global Leaders Call for Urgent Agreement on a Pandemic Accord

More than 100 global leaders have made a call “to press for an urgent agreement from international negotiators on a Pandemic Accord, under the Constitution of the World Health Organization, to bolster the world’s collective preparedness and response to future pandemics,” according to a recent WHO press release. It comes as member states of the WHO look to finalize an agreement that would amend the 2005 International Health Regulations (IHR), which will be considered by the World Health Assembly in May. David P. Fidler explains what is at stake during this ninth round of deliberations in a recent piece for CFR’s Think Global Health, writing in part “WHO documents on the negotiations, along with commentary parsing the talks, indicate that WHO member states have much to do in a short period to deliver final drafts of a pandemic agreement and amended IHR to the World Health Assembly. Unresolved issues include problems that have long confounded global health governance, including equitable access to pharmaceutical products, financing for public health capacity-building, and government accountability. Even if the negotiations achieve breakthroughs on those problems, the task of turning reforms on paper into reality in practice confronts a world in which solidarity is increasingly in short supply.”

The letter challenges those who argue such amendments will harm national sovereignty, reading in part, “A new pandemic threat will emerge; there is no excuse not to be ready for it. It is thus imperative to build an effective, multisectoral, and multilateral approach to pandemic prevention, preparedness, and response. Given the unpredictable nature of public-health risks, a global strategy must embody a spirit of openness and inclusiveness. There is no time to waste, which is why we are calling on all national leaders to redouble their efforts to complete the accord by the May deadline.”

“Beyond protecting countless lives and livelihoods, the timely delivery of a global pandemic accord would send a powerful message: even in our fractured and fragmented world, international cooperation can still deliver global solutions to global problems.”

SCOTUS Hears Case Concerning Social Media Platforms, Pandemic Misinformation

The Supreme Court heard arguments this week in Murthy v. Missouri, a case concerning the First Amendment and whether the Biden administration violated the right to freedom of expression in its communications with social media companies regarding COVID-19-related misinformation. The lawsuit, one of 26 filed against the administration by former Missouri Attorney General Eric Schmitt, alleges that the Biden administration was “…working with social media giants such as Meta, Twitter, and YouTube to censor and suppress free speech, including truthful information, related to COVID-19, election integrity, and other topics, under the guise of combating ‘misinformation.”

NYT‘s Dani Blum explains how this has refocused attention on misinformation and its evolving nature, writing in part “Health hacks not backed by science have spread widely on social media platforms. The same kinds of conspiracy theories that helped to fuel vaccine hesitancy during the Covid-19 pandemic are now undermining trust in vaccines against other diseases, including measles, as more people have lost con fidence in public health experts and institutions. And rapid developments in artificial intelligence have made it even harder for people to tell what’s true and what’s false online.”

Blum continues, writing “Misinformation commonly includes “fake experts,” according to Sander van der Linden, a professor of social psychology in society at Cambridge who researches misinformation. These are either people making health claims who do not have any medical credentials, or doctors making statements about topics that they are not experts in. “You wouldn’t want to go to an ear and nose doctor to do a heart operation,” he said. “Is this a vaccine expert, or is this a doctor who actually does no research and has no expertise on vaccinations?”’

The effects of this are being keenly felt by healthcare providers. Amanda Johnson, a primary care physician in New York City, told USA Today about her approach to working with patients who have fallen victim to such information, saying “(Frustration) doesn’t get us anywhere. I think those conversations are more likely to go poorly if you take it as a personal affront.”

The same article explains further that “She has talked about misinformation with patients, some of whom have even asked her to review social media posts they’ve seen. The most animated responses come from patients who believe they’re losing control or having something forced on them, said Johnson, who also leads NYC Health + Hospitals’ AfterCare program for New Yorkers recovering from COVID-19 or living with long COVID.”

“Many people are disparaging or dismissive when talking about people who believe misinformation, but it can happen to anyone, said Sedona Chinn, an assistant professor in the life sciences communication department at the University of Wisconsin-Madison.”

Senate Homeland Security and Governmental Affairs Committee Announces Bipartisan Biodefense and Life Science Research Investigation

In a statement this week, the Senate Homeland Security and Governmental Affairs Committee announced, “U.S. Senators Gary Peters (D-MI) and Rand Paul (R-KY), Chairman and Ranking Member of the Homeland Security and Governmental Affairs Committee, announced a joint investigation of national security threats posed by high-risk biological research and technology in the U.S. and abroad. Peters and Paul plan to hold hearings and conduct government-wide oversight on areas including high-risk life science research, biodefense, synthetic biology, biosafety and biosecurity lapses, early warning capabilities for emerging outbreaks or possible attacks, and potential origins of the COVID-19 pandemic. This bipartisan oversight effort will assess and identify measures to mitigate longstanding and emerging risks and threats that may result in serious biological incidents – whether deliberate, accidental, or natural. The investigation will also seek to increase transparency and strengthen oversight of taxpayer-funded life sciences research, laboratories in the U.S. and abroad, and detection of biological threats.”

This is likely to add fire to efforts to impose new restrictions on contracted Chinese research firms like WuXi AppTec, as highlighted by Axios. At the same time, this will likely further reveal partisan divides on the topic, particularly given Paul’s emphasis on the Biden administration’s alleged efforts to conceal critical information about the COVID-19 pandemic.

EPA Confirms China- and Iran-Backed Hackers Are Targeting US Drinking Water Systems

“The country’s water systems are being hit with an increasing number of nation-state cyberattacks, according to the US Environmental Protection Agency (EPA),” explains a recent news article. In a recent letter to governors from EPA Administrator Michael Regan and National Security Adviser Jake Sullivan, the pair wrote ‘“We need your support to ensure that all water systems in your state comprehensively assess their current cybersecurity practices.”’ They also emphasized that, in many cases, “even basic cybersecurity precautions, are not present at water treatment facilities, urging that this “can mean the difference between business as usual and a disruptive cyberattack.”

CNN reports that “The EPA will also set up a “task force” to “identify the most significant vulnerabilities of water systems to cyberattacks,” among other pressing issues, Regan and Sullivan said in their letter. The Biden officials invited state homeland security and environmental officials to a meeting to discuss cybersecurity improvements needed in the water sector.”

This comes after industrial equipment at multiple water facilities in the US was hacked late last year, displaying an anti-Israel message, according to US officials. The administration blamed the Iranian government for these attacks. Hackers backed by the Chinese state have also recently infiltrated US water facilities, in “…a hacking campaign that the Biden administration worries Beijing could use to disrupt critical infrastructure in the event of a conflict with the US. China denies the allegations.”

US Hosts Launch for New Foreign Ministry Channel for Global Health Security

Recently, the US Department of State announced that Ambassador John Nkengasong – U.S. Global AIDS Coordinator and Senior Bureau Official for Global Health Security and Diplomacy, overseeing the Department’s Bureau for Global Health Security and Diplomacy – hosted a day-long discussion program to help plan priorities and review lines of efforts for the recently created Foreign Ministry Channel for Global Health Security.

The Department’s press statement explains that “The Channel builds on the 2022-2023 COVID-19 Pandemic Prioritized Global Action Plan for Enhanced Engagement (GAP). The meeting is the first in a series of regular engagements between senior officials within Ministries of Foreign Affairs to focus diplomatic attention and action on critical global health security priorities. The foreign ministries, and participants from other ministries, will build on progress in this first meeting to elevate global health security issues as a national security imperative, enhance pandemic preparedness, and advance concrete global health security deliverables. Participants will collaborate on global efforts to:

Strengthen pandemic prevention and early-warning capacities
Address misinformation and disinformation on health issues, and leverage emerging technologies to strengthen global health security
Mitigate the human health impacts of climate change utilizing the One Health approach, which recognizes the interconnectedness of human, animal, and environmental health
Enable sustainable medical countermeasures for health emergencies
Enhance diplomatic workforce capacity on health security.”

“‘Lab Leak’ Proponents at Rutgers Accused of Defaming and Intimidating COVID-19 Origin Researchers”

Jocelyn Kaiser covers a recent formal complaint filed with Rutgers University regarding the conduct of molecular biologist Richard Ebright and microbiologist Bryce Nickels, both employed by the university. Kaiser explains in the news piece for Science, “But now, their targets have had enough. A dozen scientists filed a formal complaint with Rutgers yesterday alleging that the two faculty members have violated the university’s policies on free expression by posting “provably false” comments that are often defamatory, and that some of their actions could even threaten scientists’ safety.”

Read more here.

“How to Better Research the Possible Threats Posed by AI-Driven Misuse of Biology”

Matthew E. Walsh recently authored this piece for The Bulletin of the Atomic Scientists, writing in part “Nonetheless, researchers have conducted experiments that aim to evaluate sub-components of biological threats—such as the ability to develop a plan for or obtain information that could enable misuse. Two recent efforts—by RAND Corporation and OpenAI—to understand how artificial intelligence could lower barriers to the development of biological weapons concluded that access to a large language model chatbot did not give users an edge in developing plans to misuse biology. But those findings are just one part of the story and should not be considered conclusive.”

“An Action Plan to Increase the Safety and Security of Advanced AI”

This action plan from Gladstone AI was completed following the release of an October 2022 State Department assessment of proliferation and security risks posed by weaponized and misaligned AI. The plan-“Defense in Depth: An Action Plan to Increase the Safety and Security of Advanced AI“-explains in part of its introduction that “This action plan is a blueprint for that intervention. Its aim is to increase the safety and security of advanced AI by countering catastrophic national security risks from AI weaponization and loss of control. It was developed over thirteen months, and informed by conversations with over two hundred stakeholders from across the U.S., U.K., and Canadian governments; major cloud providers; AI safety organizations; security and computing experts; and formal and informal contacts at the frontier AI labs themselves. The actions we propose follow a sequence that:
● Begins by establishing interim safeguards to stabilize advanced AI development,
including export controls on the advanced AI supply chain;
● Leverages the time gained to develop basic regulatory oversight and strengthen
U.S. government capacity for later stages;
● Transitions into a domestic legal regime of responsible AI development and
adoption, safeguarded by a new U.S. regulatory agency; and
● Extends that regime to the multilateral and international domains.”

“Government Commissioned Report: AI is Creating New Categories of Weapons of Mass Destruction”

This recent article in the Claims Journal covers the aforementioned report from the State Department focused on WMD threats and AI: “A U.S. State Department-commissioned report asserts that advanced artificial intelligence is creating entirely new categories of weapons of mass destruction-like (WMD-like) and WMD-enabling catastrophic…The risks associated with these developments are global, have deeply technical origins and are quickly evolving, leaving policymakers with diminishing opportunities to introduce safeguards to balance these considerations and ensure advanced AI is developed and adopted responsibly.”

Read more here.

“Why Are Large AI Models Being Red Teamed?”

Natasha Bajema covers AI red teaming in this piece for IEEE Spectrum, writing in part “In February, OpenAI announced the arrival of Sora, a stunning “text-to-video” tool. Simply enter a prompt, and Sora generates a realistic video within seconds. But it wasn’t immediately available to the public. Some of the delay is because OpenAI reportedly has a set of experts called a red team who, the company has said, will probe the model to understand its capacity for deepfake videos, misinformation, bias, and hateful content.”

“Red teaming, while having proved useful for cybersecurity applications, is a military tool that was never intended for widespread adoption by the private sector.”

‘“Done well, red teaming can identify and help address vulnerabilities in AI,” says Brian Chen, director of policy from the New York–based think tank Data & Society. “What it does not do is address the structural gap in regulating the technology in the public interest.”’

“Biodefense in the FY25 President’s Budget Request”

Lillian Parr and Dan Regan recently published this blog post with CSR’s Nolan Center in which they compare the FY25 budget request to the FY24 Continuing Resolution. They explain “On Monday, March 11, the Biden Administration released the President’s Budget Request (PBR) for Fiscal Year 2025. While the final budget appropriations bills enacted by Congress will likely differ substantially from this request, the PBR provides useful insight into the Administration’s priorities. This blog post will highlight a few notable funding lines and trends for biodefense-focused programs…The initial tranche of the PBR documents, namely the Budget of the United States Government and the budget-in-briefs from each agency, state the priority budget items and highlight significant changes in funding. This analysis is largely based on these highlights and the topline budget numbers available. Over the next several weeks the agencies will complete the release of their budget justification books, which contain the highest level of detail on budgetary resourcing. Once all of the final justification books are released, we’ll announce our updated CSR Biodefense Budget Breakdown.”

“Public Health Emergency Medical Countermeasures Enterprise Multiyear Budget: Fiscal Years 2023-2027”

ASPR recently released the Public Health Emergency Medical Countermeasure Enterprise (PHEMCE) Multiyear Budget (MYB) for fiscal years 2023-2027. “The report assesses funding needs to support medical countermeasure priorities, which would allow the U.S. Government to prepare for the next public health threat. The MYB projects an estimated overall funding need of $79.5 billion over the five-year period, an increase of $15.5 billion over the 2022-2026 report. The MYB is not a budget request and does not replace funding levels requested in the President’s Budget or accompanying documents.”

“The MYB forecasts to Congress and external stakeholders the funding required to fully prepare the country for a range of chemical, biological, radiological, and nuclear threats, without regard to the competing priorities considered in the President’s Budget. The MYB also illustrates the support needed for other key priorities — such as supporting innovative approaches to medical countermeasure (MCM) development and fostering clear, scientifically supported regulatory pathways for MCMs.”

“Ready or Not 2024: Protecting the Public’s Health from Diseases, Disasters, and Bioterrorism”

From Trust for America’s Health: “As the nation experiences an increasing number of infectious disease outbreaks and extreme weather events, TFAH’s Ready or Not 2024: Protecting the Public’s Health from Diseases, Disasters, and Bioterrorism report identifies key gaps in national and state preparedness to protect residents’ health during emergencies and makes recommendations to strengthen the nation’s public health system and improve emergency readiness.”

“Op-Ed: Proposed LDTs Rule Threatens Outbreak Containment”

Linoj Samuel and Erin Graf, Chair and Vice Chair of the American Society for Microbiology’s Clinical and Public Health Microbiology Committee respectively, recently authored this opinion piece discussing how federal regulations currently under consideration might harm the effectiveness of of laboratory-developed tests for fast-moving outbreaks. They write in part, “The Food and Drug Administration (FDA) recently proposed a rule that would require the same premarket approval for LDTs as it does for medical devices, such as prosthetic joints or pacemakers. The potential rule could bring significant harm to patients by limiting the clinical microbiology and public health laboratories that serve them. The medical device pathway under consideration is designed for commercially developed medical devices. It’s ill-suited to regulate LDTs, and it’s especially at odds with the realities of infectious disease testing. If adopted, the FDA’s rule will disincentivize clinical and public health labs from developing and deploying essential LDTs. It will create gaps in diagnosis and care, and it could potentially impact underserved communities the most.”

“Clinical, Biomarker, and Research Tests Among US Government Personnel and Their Family Members Involved in Anomalous Health Incidents”

Chan, Hallett, and Zalewski recently published this article in JAMA: “Questions Do US government officials and their family members involved in anomalous health incidents (AHIs) differ from control participants with respect to clinical, biomarker, and research assessments?”

“Findings In this exploratory study that included 86 participants reporting AHIs and 30 vocationally matched control participants, there were no significant differences in most tests of auditory, vestibular, cognitive, visual function, or blood biomarkers between the groups. Participants with AHIs performed significantly worse on self-reported and objective measures of balance, and had significantly increased symptoms of fatigue, posttraumatic stress disorder, and depression compared with the control participants; 24 participants (28%) with AHIs presented with functional neurological disorders.”

“Meaning In this exploratory study, there were no significant differences between individuals reporting AHIs and matched control participants with respect to most clinical, research, and biomarker measures, except for self-reported and objective measures of imbalance; symptoms of fatigue, posttraumatic stress, and depression; and the development of functional neurological disorders in some.”

“Russia Appears to Be Using Chemical Weapons in Ukraine. And Admitting It.”

Matt Field covers the debate over the validity of Ukraine’s claims that Russia is using CW in the ongoing war in Ukraine for The Bulletin of the Atomic Scientists, writing in part “For Lennie Phillips, a former inspector for the Organisation for the Prohibition of Chemical Weapons (OPCW), which implements the Chemical Weapons Convention, some of Ukraine’s claims appear credible, including a segment on Russian state-controlled TV that included an interview with a man the US embassy in The Hague reports is a Russian soldier discussing the effectiveness of chemicals as weapons. “The piece on Russia’s Channel [One] alone makes the use of tear gas by the [Russian Federation] very credible,” Phillips, now a research fellow at the UK defense think tank RUSI, said.”

“The Centre for Chemistry and Technology and the Future of the OPCW”

Ian Anthony recently published this paper with the Stockholm International Peace Research Institute: “With the destruction of the final remaining stockpiles of declared chemical weapons in 2023, the Organisation for the Prohibition of Chemical Weapons (OPCW) must adjust to a new role. The inauguration of the OPCW’s Centre for Chemistry and Technology (CCT) in 2023 provides a new resource to assist the organization and the international community in reducing and eliminating the threat from chemical weapons.”

“Now that the CCT is operational, it is important to build momentum behind a substantive programme of work. Projects for the programme could be grouped into four thematic categories: understanding technological developments; chemical forensics; broadening geographical representation; and tailored training programmes.”

“The CCT should be led by a director, who should work with a newly established Office of Science and Technology to develop the centre’s strategic direction. To provide the CCT with stable and secure financing, a trust fund for the CCT should be established.”

Report Release Webinar: Future State of Smallpox Medical Countermeasures

From National Academies of Science and Medicine: “Join the Committee on Current State of Research, Development, and Stockpiling of Smallpox Medical Countermeasures as it discusses its newly released report Future State of Smallpox Medical Countermeasures on Tuesday, March 26, 2024.”

Learn more and join the discussion here.

Artificial Intelligence and Automated Laboratories for Biotechnology: Leveraging Opportunities and Mitigating Risks

From the National Academies’ Board on Life Sciences: “Please join us April 3-4, 2024 for a hybrid workshop on the opportunities and mitigation of risks of the use of artificial intelligence and automated laboratories (i.e., self-driving labs) for biotechnology.”

“The workshop will consider opportunities to leverage AI and laboratory automation capabilities for discovery and development, explore methods and approaches to identify, track, and forecast the domestic and international development of such technologies, and convene experts across sectors to highlight recent advances and explore implications for the development and use of these technologies.”

Learn more and register here.

Launch of the 2024 National Blueprint on Biodefense

From the Bipartisan Commission on Biodefense: “On the 10^th anniversary of its inception, the Bipartisan Commission on Biodefense will release its 2024 National Blueprint on Biodefense: Immediate Action Needed to Defend Against Biological Threats.”

“Please join us for this momentous event at the Congressional Auditorium, Capitol Visitor Center, on April 17^th at 4:30pm.”

“The Bipartisan Commission on Biodefense (formerly the Blue Ribbon Study Panel on Biodefense) was established in 2014 to provide a comprehensive assessment of the state of United States biodefense efforts and to issue recommendations that foster change. Subsequently, the Commission has briefed White House Administrations (including then Vice President Biden); testified before Congress; convened numerous meetings with experts; released 12 reports; produced the graphic novel Germ Warfare; and mobilized biodefense conversations and actions in the private and public sectors.”

Learn more and register here.

Addressing the Challenges Posed by Chemical and Biological Weapons: Intensive Online Introductory Course for Students of Technical Disciplines

Learn more and apply here.

Registration for GHS 2024 Now Open

SBA.3 International Synthetic Biology, and Biosecurity Conference in Africa

Learn more and register here.

Eighth Annual Next Generation for Biosecurity Competition Open for Applications

“The Eighth Annual Next Generation for Biosecurity Competition is now open. NTI | bio hosts this competition to provide a platform for the next generation of global leaders in biosecurity to develop original concepts and share them with the wider biosecurity community. This year’s co-sponsors include 80,000 Hours, the Global Health Security Network, the iGEM Foundation, the International Federation of Biosafety Associations, the Next Generation Global Health Security Network, Pandemic Action Network, SynBio Africa, and Women of Color Advancing Peace, Security, and Conflict Transformation.“

“This year, the competition invites innovative and creative papers focused on how investments in biosecurity can both contribute to a more equitable society and reduce biological risks. The full prompt is provided below.”

“Winners of the Biosecurity Competition will be awarded the following:

Online publication of their paper on the NTI website
The opportunity to attend a high-profile international biosecurity event, such as the Biological Weapons Convention, and present their paper at a prestigious side event.”

Learn more here.

Nonproliferation Review and CNS Announce McElvany Award Winners

“The Nonproliferation Review and the James Martin Center for Nonproliferation Studies (CNS) are pleased to announce that an article examining the George W. Bush administration’s policies toward the nuclear programs of Iran and South Korea, “A tale of two fuel cycles: defining enrichment and reprocessing in the nonproliferation regime” by Sidra Hamidi and Chantell Murphy, has won the Doreen and Jim McElvany Nonproliferation Award’s grand prize.”

“In examining the Bush administration’s policies toward two states with advanced nuclear fuel cycles, Hamidi and Murphy’s article also explores the various US and international definitions of uranium enrichment and spent-fuel reprocessing. Its analysis draws on the concept of “technopolitics,” the study of the mutually reinforcing processes by which political priorities shape technological systems while technology also limits and creates new kinds of politics.”

Read more here.

Pandora Report 1.26.2024

January 26, 2024January 26, 2024 by dkellogg97, posted in Pandora Report

This week covers the updated Doomsday Clock time, new HHS cybersecurity performance goals for the health sector, a podcast episode with our own Sonia Ben Ouagrham-Gormley covering her work on barriers to biological weapons, new publications, and more!

Bulletin of the Atomic Scientists Science and Security Board Leaves Doomsday Clock at 90 Seconds to Midnight

The Bulletin of the Atomic Scientists Science and Security Board recently announced that it left the Doomsday Clock at 90 seconds to midnight this year, based on threats like nuclear risk, climate change, biological threats, and disruptive technologies. In its statement, the board said in part “Ominous trends continue to point the world toward global catastrophe. The war in Ukraine and the widespread and growing reliance on nuclear weapons increase the risk of nuclear escalation. China, Russia, and the United States are all spending huge sums to expand or modernize their nuclear arsenals, adding to the ever-present danger of nuclear war through mistake or miscalculation.”

“In 2023, Earth experienced its hottest year on record, and massive floods, wildfires, and other climate-related disasters affected millions of people around the world. Meanwhile, rapid and worrisome developments in the life sciences and other disruptive technologies accelerated, while governments made only feeble efforts to control them.”

In its in-depth explanation of biological risks that factored into this decision, the board explains that “The revolution in the life sciences and associated technologies continues to accelerate and expand in scope, enabling an increasing number of individuals, in groups and alone, to pose threats arising from both accidental and deliberate misuse. During the past six months, the potential for artificial intelligence tools to empower individuals to misuse biology has become far more apparent.”

The same sidebar also explains that “Two other types of biological risks remain causes for concern: accidental release of organisms from laboratories and naturally occurring infectious diseases, especially those with pandemic potential. Deforestation, urbanization, and climate change continue to destabilize microbe-host relationships and facilitate the emergence of infectious diseases. Meanwhile, high-biosafety-level laboratories have proliferated around the world, as has risky research motivated by interests in controlling these diseases. Despite the importance of understanding and countering naturally occurring biological threats, it isn’t clear that all of these high-biosafety-level laboratories or high-risk experiments are needed for achieving these goals. As the number of laboratories and amount of risky research increases, and the failure to standardize safe laboratory practices and to institute adequate research oversight persists, the risk of accidental release of dangerous pathogens worsens.”

HHS Announces New Voluntary Performance Goals, Resources for Health Sector Cybersecurity

This week, the Department of Health and Human Services announced via the Administration for Strategic Preparedness and Response (ASPR) that it is releasing “voluntary health care specific cybersecurity performance goals (CPGs) and a new gateway website to help Health Care and Public Health (HPH) sector organizations implement these high-impact cybersecurity practices and ease access to the plethora of cybersecurity resources HHS and other federal partners offer.”

The statement further explained “As outlined in the recent HHS Health Care Sector Cybersecurity concept paper, HHS is publishing the CPGs to help health care organizations, and health care delivery organizations in particular, prioritize implementation of high-impact cybersecurity practices. The HPH CPGs are designed to better protect the healthcare sector from cyberattacks, improve response when events occur, and minimize residual risk. HPH CPGs include both essential goals to outline minimum foundational practices for cybersecurity performance and enhanced goals to encourage adoption of more advanced practices.”

Read more here.

“Sonia Ben Ouagrham-Gormley on Barriers to Bioweapons”

From Hear This Idea: “Sonia Ben Ouagrham-Gormley is an associate professor at George Mason University and the deputy director of their biodefense program. Sonia has written extensively on the proliferation and non-proliferation of bioweapons, being one of the key voices to have emphasized the challenges that organizations, tacit knowledge, and other factors have caused for states and terrorists that have attempted to acquire weapons of mass destruction.”

“In this episode we talk about:

Misconceptions around the ease of bioweapon production — how and why bioweapons programs face unique challenges compared to nuclear weapons programs
The crucial role of tacit knowledge in bioweapons production
Will AI make bioweapons much easier to develop, or will human expertise remain a major bottleneck?
Case studies of bioweapons programs, illustrating the practical difficulties and failures encountered even by well-resourced state actors.
(How) has Biological Weapons Convention prevented bioweapon proliferation?
Do global political trends point towards proliferation, even without AI?”

“How Reliable is ISIS’s Claiming Responsibility for Deadly Attacks in Iran?”

Schar School associate professor Mahmut Cengiz recently authored this piece for Homeland Security Today, in which he writes in part “These discrepancies related to the twin blasts bring up a question of how reliable ISIS is when the group claims responsibility for terrorist attacks. Terrorist groups aim to take credit when a group spokesperson, on behalf of the organization, states that the group is the perpetrator of the attack. They tend to claim responsibility for attacks—targeting state institutions and the military rather than civilians— when they aim to gain publicity and when the backlash from the government is not likely. As opposed to terrorist attacks that claimed most responsibility in the 1980s and 1990s, every one of seven attacks has been recorded claiming responsibility since 2018. According to the Global Terrorism and Trends Analysis Center (GTTAC) Records of Incidents Database (GRID), the attacks by ISIS and its affiliated organizations steadily increased from 2018 to 2022. They conducted 873 attacks in the first ten months of 2023. Contrary to increasing attacks, its attacks of claiming responsibility slightly increased between 2018 and 2020 and dropped in 2021 and 2022. ISIS groups claimed responsibility in its 161 attacks. “

“Beyond Borders, Beyond Biases: Building a Biosecure Future with Diverse Voices”

Aparupa Sengupta, Senior Program Officer for Global Biological Policy and Programs at NTI, discusses the importance of diversity and inclusion in biosafety and biosecurity governance in this piece for NTI. She writes in part “At NTI, we believe the greatest risk of these catastrophic effects is from the accidental or intentional misuse of a bio-engineered agent. Therefore, we focus on developing stronger biosafety and biosecurity policies and practices to protect against these manmade risks. This work requires global cooperation and shared responsibility, and an understanding that diverse perspectives and experiences are essential. Without them, we will face widening knowledge gaps and international resentment, ultimately sabotaging our ability to collectively address bio threats.”

“Recently, the Center for Security and International Studies (CSIS) published a report recommending actions to strengthen global biosafety and biosecurity. As someone with more than 15 years of experience working in the interface of science, technology, and biosafety/security, I endorse all eight recommendations in the report but suggest adding a ninth one to the list: “Prioritize diversity and inclusion for effective global biosafety and biosecurity governance.”’

“Did China Keep the COVID Virus Sequence Secret for Weeks?”

Matt Field breaks down questions surrounding China’s sharing of the SARS-CoV-2 genetic sequence in the early days of COVID-19 in this piece for the Bulletin of the Atomic Scientists: “In outbreak response, speed is critical as authorities seek to quickly determine the cause of a disease and prevent it from spreading. A new report is now raising fresh questions about China’s early response to COVID-19. The Wall Street Journal revealed Wednesday that a researcher in Beijing attempted to upload the genetic sequence SARS-CoV-2, the virus that causes COVID, to a US-based public database about two weeks before the Chinese government publicized the pathogen’s sequence, a lag that potentially robbed scientists and health officials of valuable time.”

“Investigating the Potential Strategic Implications of COVID-19 for Biological Weapons Pursuit: A New Expert Simulation”

Ackerman et al. recently published this article in Health Security: “To investigate the impact of the COVID-19 pandemic on the strategic decisionmaking of leaders with respect to biological weapons, this study employed a prospective simulation technique called Asynchronous Strategic Dynamics Red Teaming. Using an immersive, multimedia simulation conducted remotely and asynchronously, the effort engaged 240 carefully selected and curated expert participants in either biological weapons or the countries of interest (as well as 60 naïve participants). Across our sample of 30 countries, simulated interest in pursuing some type of biological weapons program (defensive or offensive) remained low to moderate. While such interest increased after the simulated onset of the COVID-19 pandemic, it was limited overall, with only a handful of states showing salient increases in offensive biological weapon interest. When directly referencing why their countries might have changed their post-COVID-19 interest in biological weapons, the most commonly cited reasons were: (1) COVID-19 demonstrated the power of biological weapons to disrupt societies and cause large-scale economic harm, and (2) the pandemic revealed either the state’s own or its rivals’ vulnerability to diseases like COVID-19, as well as an inability to efficiently respond and contain such diseases. In sum, despite a global pandemic with massive consequences, the simulation revealed that most states are not likely to dramatically change their strategic posture regarding pursuit of offensive biological weapons.”

“Catalogue of Civil Society Assistance for BWC States Parties”

From the Stimson Center: “The Catalogue of Civil Society Assistance to States Parties annually highlights the contributions of civil society to the BWC and States Parties and to the enhancement of biological safety and security. From Ottawa to Hamburg, there are civil society assistance programs across the world that are available to support the implementation of the BWC. The catalogue includes organization and project descriptions and points of contact for each program, which aims to facilitate stronger connections between civil society and State Parties in need of assistance.”

“The Operational Risks of AI in Large-Scale Biological Attacks”

New from RAND: “The rapid advancement of artificial intelligence (AI) has far-reaching implications across multiple domains, including concern regarding the potential development of biological weapons. This potential application of AI raises particular concerns because it is accessible to nonstate actors and individuals. The speed at which AI technologies are evolving often surpasses the capacity of government regulatory oversight, leading to a potential gap in existing policies and regulations.”

“In this report, the authors share final results of a study of the potential risks of using large language models (LLMs) in the context of biological weapon attacks. They conducted an expert exercise in which teams of researchers role-playing as malign nonstate actors were assigned to realistic scenarios and tasked with planning a biological attack; some teams had access to an LLM along with the internet, and others were provided only access to the internet. The authors sought to identify potential risks posed by LLM misuse, generate policy insights to mitigate any risks, and contribute to responsible LLM development. The findings indicate that using the existing generation of LLMs did not measurably change the operational risk of such an attack.”

“Implementing The Bioeconomy Executive Order: Lessons Learned And Future Considerations”

Nazish Jeffrey breaks down the Federations of American Scientists’ Bioeconomy EO Tracker in this piece, writing “With the U.S. bioeconomy valued at over $950 billion and predicted to steadily increase, the potential for significant economic impact is unmistakable. To leverage this economic opportunity, the 2022 Bioeconomy Executive Order (EO) took a significant step towards addressing the complexities of the bioeconomy and creating a whole-of-government approach. The scope of the EO was vast, assigning around 40 tasks to many different federal agencies, in order to create a national framework to leverage bio-based innovations for sustainable economic growth.”

“To track the numerous tasks assigned by the EO, the Federation of American Scientists have put together a living Bioeconomy EO tracker to monitor the progress of these tasks, enhance accountability and to allow stakeholders to stay informed on the state of the U.S. bioeconomy as it evolves. This FAS tracker was inspired by the initial tracker created by Stanford University when the EO was first published.”

“Public Health Preparedness: HHS Emergency Agency Needs to Strengthen Workforce Planning”

In this new Government Accountability Office report, GAO recommends that “ASPR (1) establish specific goals and performance measures to use for its new hiring office once it is fully operational, (2) develop tailored strategies for recruiting and hiring human capital staff for the new office, (3) identify the critical areas that need workforce assessments and develop plans to implement them, and (4) conduct an agency-wide workforce assessment. HHS neither agreed nor disagreed with the first two recommendations and agreed with the last two recommendations. GAO believes actions are needed to address all of the recommendations.”

Read more here.

“Dissecting Pandemic-Prone Viral Families Volume 2: The Paramyxoviridae”

Amesh A. Adalja covers the Paramyxoviridae family in this volume of Johns Hopkins Center for Health Security’s Dissecting Pandemic-Prone Viral Families,” writing in part “Paramyxoviridae is a large viral family that contains many once common and wellknown human pathogens, such as measles and mumps, as well as other pathogens that pose concerns for their potential to cause epidemic or pandemic disease.1″

“This family of viruses infects a wide variety of species, ranging from reptiles to rodents and fish to birds. While diseases such as measles and mumps cause little morbidity and mortality in advanced societies today—because of high levels of vaccine-induced immunity—other members of this viral family have considerable burdens of infection with attendant morbidity and mortality risks. Also, within this family, there is one genus of consequence – Henipavirus – that has already been responsible for a number of serious emerging infectious diseases. The table below summarizes key genera and viruses of this family.1”

“The Overlooked Bacterial Pandemic”

Moriel et al. recently published this work in Seminars in Immunopathology: “The COVID-19 pandemic had a significant economic and health impact worldwide. It also reinforced the misperception that only viruses can pose a threat to human existence, overlooking that bacteria (e.g., plague and cholera) have severely haunted and shaped the course of human civilization. While the world is preparing for the next viral pandemic, it is again overlooking a silent one: antimicrobial resistance (AMR). This review proposes to show the impact of bacterial infections on civilization to remind the pandemic potential. The work will also discuss a few examples of how bacteria can mutate risking global spread and devastating outcomes, the effect on the global burden, and the prophylactic and therapeutic measures. Indeed, AMR is dramatically increasing and if the trend is not reversed, it has the potential to quickly turn into the most important health problem worldwide.”

“Etymologia: Ring Vaccination”

Sharma et al. recently published this short piece covering ring vaccination’s etymology in Emerging Infectious Diseases: “Ring Vaccination [rɪŋ-væk-sɪ′-neɪ-ʃn] Ring vaccination (expanding ring, surveillance and containment) is a public health measure designed to prevent spread of disease from infected persons to others. This approach targets persons who have had close contact with confirmed or suspected cases and are at a higher risk of infection by vaccinating them first (Figure).”

Read more here.

“Russian Military Thought and Doctrine Related to Non-strategic Nuclear Weapons: Change and Continuity”

William Alberque tackles Russian nuclear doctrine in this report for the International Institute for Strategic Studies: “Russian nuclear doctrine, especially regarding its large stockpile of non-strategic nuclear weapons, has become one of the most pressing issues in Euro-Atlantic security. This report aims to build an understanding of Russia’s strategic nuclear weapons doctrine through empirical research, including by examining the continuities and discontinuities in doctrine across time, through the Cold War, to the collapse of the Soviet Union, to Russia’s annexation of Crimea, and in Russia’s ongoing war on Ukraine.”

Global Partnership Against the Spread of Weapons and Materials of Mass Destruction Newsletter

The Global Partnership Against the Spread of Weapons and Materials of Mass Destruction’s newsletter is published quarterly and is available for subscription here. This quarter’s edition focuses on Italy’s upcoming Global Partnership presidency, the Partnership’s 2023 Programming Annex, featured articles, community updates, and more.

“UNITAD – Key Investigations as UN Mechanism Reaches Its Final Reporting Year”

Sam Biden covers the work of the UN Investigate Team to Promote Accountability Crimes Committed by Da’esh/ISIL (UNITAD), providing an overview of its key investigations in the last two years in this piece for the Human Security Centre. This includes UNITAD’s work on biological and chemical weapons, under which Biden explains in part, “2023 marked a significant stride in the relentless pursuit of accountability for ISIL’s chemical and biological weapons program. The investigation during this reporting period yielded substantial evidence from earlier inquiries strategies regarding the production and delivery of the weapons themselves. These key lines of inquiry harnessed new collaborations with technical experts, including those from the Mine Action Service, provided essential insights into a wide array of attacks. UNITADs work extended to collecting and preserving evidence linked to 12 attacks yet continued to focus on gathering further evidence from the 2016 attack on Tazah Khurmatu. This ultimately led to the collection of new battlefield evidence and files, shedding light on ISIL’s operations in Kirkuk and implicating specific persons of interest. A comprehensive report focused on the 2016 attack on Tazah Khurmatu was shared with the Iraqi judiciary, encapsulating critical findings from the ongoing investigation.”

ICYMI-“Event Summary: U.S.–UK Strategic Dialogue on Biosecurity”

“On January 16, the Council on Strategic Risks (CSR) hosted senior government leaders for the launch of the U.S.–UK Strategic Dialogue on Biosecurity at the historic National Academy of Sciences Building in Washington, D.C.”

“Building upon decades of partnership between the two countries, the Strategic Dialogue is a core component of the Atlantic Declaration—the new bilateral economic partnership established in 2023 to adapt, reinforce, and reimagine the U.S.-UK alliance for the challenges of the twenty-first century. Following the event, the U.S. National Security Council and the UK Cabinet Office released a joint statement outlining the Strategic Dialogue’s intent, including coordination to uphold global norms and commitments to lead on innovation in biotechnology and biosecurity.”

Read more here.

NEW: AI Rewards, Risks, and the Future of Biosecurity by Design (Pandemic Center Webinar)

From the Brown School of Public Health: “On January 24th at 1:00 PM EST the Pandemic Center will host a webinar titled AI Rewards, Risks, and the Future of Biosecurity by Design.”

“This event will bring together experts in biosecurity, global health, and pandemic prevention and response. Together, they will discuss the relationship between AI and biosecurity, with a focus on benefits, risks, and pragmatic solutions.”

“This event will be hosted and moderated by Beth Cameron, PhD, Professor of the Practice and Senior Advisor to the Pandemic Center.”

Learn more and register here.

NEW: Kazakhstan’s Actions to Address Nuclear and Biological Risks

From the Cargenie Endowment for International Peace: “Upon the 1991 collapse of the Soviet Union, Kazakhstan found itself in possession of the world’s fourth-largest nuclear weapons stockpile and the former union’s most significant biological weapons factory. Kazakhstan’s subsequent decision to return and dismantle these weapons has solidified its position as a leader in nuclear and biological risk reduction. For the last thirty years, Kazakhstan’s actions have served as a core model for regional and international security.”

“Please join the Carnegie Endowment and the Council on Strategic Risks for a hybrid panel on Kazakhstan’s increasingly global role in the changing threat landscape of weapons of mass destruction. The discussion will feature Kazakhstan’s Ambassador to the United States of America Yerzhan Ashikbayev, the Honorable Andrew Weber, and Dr. Toghzan Kassenova. It will be moderated by Shannon Green, senior fellow at the Council on Strategic Risks.”

This event will take place on January 30 at 1:30 pm EST. Learn more and RSVP here.

NEW: WEBINAR: State Department 2023 Global Terrorism Data: Trends & Warnings

From Homeland Security Today: “Join HSToday for a Law Enforcement-only analysis of global terrorism trends from 2023 and threat forecasts for 2024. The Department of State’s yearly Annex of Statistical Information Reports uses The Global Terrorism Trends and Analysis Center (GTTAC) database.”

“Dr. Mahmut Cengiz, a senior data analyst at GTTAC since 2018, will discuss terrorism trends from 2023 and areas of concern for law enforcement in the United States (US). More specifically, his analyses will focus on HAMAS and Iran-backed terror groups targeting American facilities in the Middle East, Al Qaeda- and ISIS-affiliated organizations actively involved in terrorist attacks worldwide, increasing far-right terrorism and emerging lone actor threats in the US and Europe. The Terrorism, Transnational Crime and Corruption Center (TraCCC) is the first center in the United States devoted to understanding the links among terrorism, transnational crime and corruption, and to teach, research, train and help formulate policy on these critical issues. TraCCC is a research center within the Schar School of Policy and Government at George Mason University. TraCCC also houses the innovative and highly-respected Anti-Illicit Trade Institute (AITI).”

This event will take place on February 8 at 2 pm EST. Learn more and register here.

AI Executive Order Report Card Reviewing the First 90 Days

“On October 30, 2023, the Biden Administration issued a call to action outlining a host of requirements and deliverables for U.S. government agencies on artificial intelligence. The executive order touched on a range of AI-relevant issues, including testing and evaluation of new AI systems, developing a healthy and capable U.S. AI workforce, and ensuring U.S. competitiveness in the years to come.”

“Join CSET researchers on January 31, 2024, for a discussion of what the U.S. Government has accomplished so far, what have we learned, and what’s left to do to complete the EO’s ambitious goals.”

This online event will begin at 12 pm EST. Learn more and register here.

GP Nonproliferation and Strategic Trade Hub Virtual Launch & Demo

“The Strategic Trade Research Institute (STRI) invites you to participate in the Global Partnership Nonproliferation and Strategic Trade Hub Virtual Launch and Demo event taking place on February 27, 2024, from 9:00-10:00 am EST.”

“Please join us to learn about the main features of the Hub, how to use it, and how it can be useful and impactful for nonproliferation and export control professionals. The event will feature Andrea Viski, Director of STRI, as well as introductory remarks from the Hub’s sponsor, the United Kingdom’s Counter-proliferation and Arms Control Center (CPACC).”

Learn more and register here.

International Conference, CBRNE Research & Innovation

“The last 40 years have demonstrated that both military and civilian populations could be exposed to highly hazardous CBRNE agents following conflicts, natural outbreaks and disasters, industrial incidents or terrorist attacks.”

“Worldwide, researchers, responders and industrial capacities have been commited to provide adapted response to these challenges.”

“Building on the success of the first 5 International Conferences « CBRNE Research and Innovation » which took place in Antibes (2015), Lyon (2017), Nantes (2019), on line (2021) and Lille (2022), we want to give you a new opportunity to build up or strengthen collaborative networks in Strabourg (March 19^th – 21^rst 2024).”

“The CBRNE R&I Conference is specifically devoted to scientific updates, responders’ feedbacks and expression of needs. It also includes workshops and demonstrations of innovative materials, technologies and procedures, according to the following themes: DETECTION – IDENTIFICATION, PROTECTION – DECONTAMINATION, MEDICAL COUNTERMEASURES, RISKS & CRISIS MANAGEMENT.”

“Looking forward to your proposals for communication and to welcoming you at Strasbourg in March 2024!”

Learn more here.

cbrne-ri-conference-2024-_-flyer-ppt-v06.11.2023-1 Download

Registration for GHS 2024 Now Open

Pandora Report 1.19.2024

January 19, 2024 by dkellogg97, posted in Pandora Report

This week’s Pandora Report covers the United States’ designation of the Houthis as a Specially Designated Global Terrorist group, a new strategic dialogue between the United States and the United Kingdom to combat biological threats, and more.

Houthis Added to US List of Specially Designated Global Terrorist Groups

The US Department of State announced this week that Ansarallah, commonly known as the Houthis, has been designated as a Specially Designated Global Terrorist group. This will enter into effect on February 16. In the press statement on the designation, the Department said “Since November, the Houthis have launched unprecedented attacks against international maritime vessels in the Red Sea and Gulf of Aden, as well as military forces positioned in the area to defend the safety and security of commercial shipping. These attacks against international shipping have endangered mariners, disrupted the free flow of commerce, and interfered with navigational rights and freedoms. This designation seeks to promote accountability for the group’s terrorist activities. If the Houthis cease their attacks in the Red Sea and Gulf of Aden, the United States will reevaluate this designation.”

“The Houthis must be held accountable for their actions, but it should not be at the expense of Yemeni civilians. As the Department of State moves forward with this designation, we are taking significant steps to mitigate any adverse impacts this designation may have on the people of Yemen. During the 30-day implementation delay, the U.S. government will conduct robust outreach to stakeholders, aid providers, and partners who are crucial to facilitating humanitarian assistance and the commercial import of critical commodities in Yemen. The Department of the Treasury is also publishing licenses authorizing certain transactions related to the provision of food, medicine, and fuel, as well as personal remittances, telecommunications and mail, and port and airport operations on which the Yemeni people rely.”

Mahmut Cengiz, an Assistant Professor at George Mason University, published an in-depth overview of the group and their previous designation on the list for Homeland Security Today just before the State Department’s announcement. In addition to outlining the organization’s connection to Iran and other Iranian-backed terrorist organizations, Cengiz covers previous attacks by the Houthis and the complicated situation in Yemen, writing “The civil war in Yemen has morphed into proxy wars for states and their surrogate organizations to pursue their interests. Much like the ongoing civil war in Syria that involves many parties, the Yemeni conflict involves several states (Iran and Saudi Arabia) and non-state actors – including surrogate organizations for the states, terrorist organizations, and rebel groups. Several of them are Houthis, Al Qaeda In the Arabian Peninsula (AQAP), ISIS’s affiliate in Yemen, the Southern Transitional Council backed by UAE, and the southern separatist groups. This diverse mix of participants makes it difficult to determine which states and groups are involved and what they hope to achieve by inserting themselves into the Yemeni civil war.”

Cengiz concludes his piece with a warning about the organization and the threat it poses to Yemeni civilians and broader security concerns, writing “To conclude, given the capacity of the Houthis to commit violent acts and the involvement of regional powers in the conflict in Yemen, it would not be wrong to conclude that the Yemeni conflict and the death of innocent Yemeni civilians will continue. Houthis will be a strong pawn in the game played by Tehran and serve the interests of its regime in the region. The United States removed Houthis from the list of FTOs due to humanitarian concerns in 2021, but its growing threat in the region has pushed Houthis to knock on the door of the terrorist list.”

United States and United Kingdom Announce Strategic Partnership to Tackle Biological Threats

The governments of the United States and the United Kingdom announced the creation of a new strategic dialogue on biological security this week. The White House said in a press release, “Building on the June 10, 2021 New Atlantic Charter and the June 8, 2023 Atlantic Declaration on Economic Security, the U.S. National Security Council and the UK Cabinet Office announced a new Strategic Dialogue on Biological Security during a launch event today.”

“Underpinned by the UK Biological Security Strategy and the U.S. National Biodefense Strategy, this Strategic Dialogue reflects a shared ambition to bolster future heath and economic resilience against a growing and diverse spectrum of biological threats.”

“The Strategic Dialogue reaffirms both nations’ commitment to increase collaboration in the following ways:

Develop a shared understanding of research and development (R&D) needs at the onset of new disease outbreaks, allowing for improved responsiveness by shaping global R&D efforts and supporting early technology assessments.
Adopt a One Health approach to biosurveillance and biological threat detection, in support of international efforts to develop stronger and more interconnected global surveillance capabilities.
Pursue the development of new tools and methodologies for microbial forensics and attribution.
Promote responsible innovation in the biotechnology, health, and life sciences sectors, shaping global norms and standards on biosafety and biosecurity while simultaneously protecting burgeoning bio-economies.
Facilitate the development of next-generation vaccines and therapeutics, in line with the 100-Days Mission vision supported by G7 leaders in Carbis Bay in 2021 and reaffirmed at the 2023 G7 Summit in Hiroshima.
Strengthen coordination of efforts to counter biological threats, including developing joint measures to address Biological and Toxin Weapons Convention compliance.”

The Cabinet Office added in its own press release, “Announced as part of a joint statement by the UK Cabinet Office and White House National Security Council, the Strategic Dialogue builds on the UK’s position as a global thought-leader on biological security and strengthens our commitment to work with like-minded partners to build international consensus and collaboration towards strengthened global resilience and threat deterrence.”

“In further efforts to strengthen the UK’s biosecurity capabilities, the Deputy Prime Minister Oliver Dowden also announced a £2 million uplift for the Guy’s and St Thomas’ Respiratory Metagenomics Project, which uses genetic sequencing to detect pathogens and improve patient outcomes while providing crucial data sources to support surveillance of new and emerging diseases.”

Scientists Are Exploring How Chrysalis-Based “Living Bioreactors” May Accelerate Production of New Vaccines

A recent news update from the Coalition for Epidemic Preparedness Innovations explains that “Scientists in Spain are to investigate whether moth chrysalises infected with an insect virus known as a baculovirus could act as ‘living bioreactors’ in a new rapid vaccine production technique to help protect people faster from pandemic threats.”

The piece continues, explaining “In a project funded with a CEPI award of up to $3.14 million, researchers at Algenex, a Spanish biotech company, will further develop their chrysalis-based baculovirus vaccine platform technology, known as CrisBio®. The aim of the project is to conduct a pre-clinical proof of concept study for a vaccine against influenza, and to demonstrate CrisBio’s potential application for rapid and large-scale human vaccine production.”

“By enabling swift scalability and early large-scale production of viral antigens needed for vaccines, Algenex’s CrisBio® technology could bypass the need for smaller, iterative bioreaction processes and regulations, potentially expediting vaccine production timelines. The CEPI-Algenex partnership supports the 100 Days Mission – a goal embraced by leaders of the G7 and G20 to reduce new vaccine development timelines to 100 Days in response to a potential pandemic disease threat.”

Learn more here.

“What to Know About JN.1, the Latest Omicron Variant”

Aliza Rosen and Melissa Hartman cover all things JN.1 with Andy Pekosz in this piece from Johns Hopkins SPH: “In early November 2023, the JN.1 variant caused less than 5% of COVID-19 cases in the U.S. Now it is estimated to cause more than 60% of them. Virologists including Andy Pekosz, PhD, a professor in Molecular Microbiology and Immunology, are paying attention.”

“Here, Pekosz explains what virologists are seeing, what this new variant means for case rates and treatments, and why it’s so important for more people to get the updated COVID-19 vaccine rolled out this fall.”

Read more here.

“How Much Less to Worry About Long COVID Now”

Katherine J. Wu tackles the still present threat of Long COVID in this piece for The Atlantic, writing in part, “Compared with the worst days of the pandemic—when vaccines and antivirals were nonexistent or scarce, when more than 10,000 people around the world were dying each day, when long COVID largely went unacknowledged even as countless people fell chronically ill—the prognosis for the average infection with this coronavirus has clearly improved.”

“In the past four years, the likelihood of severe COVID has massively dropped. Even now, as the United States barrels through what may be its second-largest wave of SARS-CoV-2 infections, rates of death remain near their all-time low. And although tens of thousands of Americans are still being hospitalized with COVID each week, emergency rooms and intensive-care units are no longer routinely being forced into crisis mode. Long COVID, too, appears to be a less common outcome of new infections than it once was.”

“Global Risks Report 2024”

From the World Economic Forum: “The Global Risks Report explores some of the most severe risks we may face over the next decade, against a backdrop of rapid technological change, economic uncertainty, a warming planet and conflict. As cooperation comes under pressure, weakened economies and societies may only require the smallest shock to edge past the tipping point of resilience.”

ICYMI: “The Panzootic Spread of Highly Pathogenic Avian Influenza H5N1 Sublineage 2.3.4.4b: A Critical Appraisal of One Health Preparedness and Prevention”

From WHO: “With the world gradually recovering from the COVID-19 pandemic, it is important to think forward when it comes to prevention of infectious disease outbreaks originating from the animal world.”

“There has been a huge body of work on the early detection and response to emerging disease outbreaks following spillover of animal viruses to humans, but far less focus on primary prevention. Primary prevention starts before the first cases of human illness occur, but its implementation is challenging. It requires a focus on understanding underlying principles of disease emergence, and the prevention of spillovers through a One Health approach across human, animal and environmental health sectors. Therefore, in addition to the public health concerns that are currently already widely addressed, One Health requires a focus also on biodiversity conservation and environmental impacts, wildlife health, and livestock production and consumption, and both wild and domestic animal health and welfare concerns. The recent unprecedented shift in the ecology of highly pathogenic avian influenza (HPAI) illustrates this need.”

Read here.

“New NIH Chief Opens Up About Risky Pathogens, Postdoc Salaries and the Year Ahead”

Nature interviewed Monica Bertagnolli in this recent piece for Nature News focused on how the new NIH head plans to make progress in such a challenging political environment. The introduction explains: “Monica Bertagnolli took charge of the US National Institutes of Health (NIH) — the world’s largest public funder of biomedical research — in November, giving the agency a permanent director for the first time in nearly two years. Her predecessor, Francis Collins, was known for his agency-wide initiatives on genomics and precision medicine, but Bertagnolli says she would like to make her mark by advancing health-care delivery and transforming how researchers use and share data, among other things.”

“However, the US presidential election this year could usher in a new government, meaning that Bertagnolli might have only a limited time to accomplish her goals. And researchers say she faces other challenges: trust in science took a hit during the COVID-19 pandemic, congressional investigations continue into the NIH’s response to the massive outbreak and the agency’s US$47-billion budget is likely to remain stagnant in 2024.”

Read more here.

“A Potential CFATS-trophe”

Joseph Gedeon demonstrates pun mastery in this edition of Politico’s cybersecurity newsletter covering Congress’ failure to re-authorize the Chemical Facility Anti-Terrorism Standards. Gedeon writes in part, “It’s been about six months since the nation’s chemical security shield vanished, and now industry and agency officials are banding together today to push Congress to restore the regulation as part of this year’s must-pass spending bills.”

“And in the shadow of a war threatening expansion in the Middle East, anxieties are mounting about the vulnerability of the nation’s potentially weaponizable materials sitting overexposed — all which could be within reach for some of America’s foreign adversaries.”

Gedeon by explaining some challenges CFATS faced, writing “While the program is important, it needs some updates “to justify its monumental historical price tag,” Brian Harrell, CISA’s former assistant director for infrastructure security under the Trump administration, told POLITICO’s Matt Berg. CFATS was last approved with a $74 million budget.”

“Harrell adds that the threat of terrorism is overhyped since there haven’t been any major disasters at such facilities or other high-risk places that don’t use the program.”

‘“The idea that the lack of a terrorist screening database is putting the country at risk is a stretch given that other critical sectors screen without this tool just fine.”’

Read more here.

“Alarm Sounded Over Declining US Radiation Professional Workforce”

David Kramer recently published this article in Physics Today covering the decline of interest in different radiation specialties, including health physics, radiation biology, medical physics and radiology, nuclear engineering, and radiochemistry. Kramer explains in his introduction, “The exact size of the professional radiation workforce is hard to determine, in part because of its fragmentation among different fields and its sometimes ambiguous definitions and qualifications. The JACMP review, which took the authors seven years to complete on a pro bono basis, includes estimates that vary in fidelity depending on the field; some of the radiation specialties do not keep figures at all.”

Read more here.

The Bull Dog DetectiveL William J. Flynn and America’s First War Against the Mafia, Spies, and Terrorists

Jeffrey D. Simon recently published this book covering the life of William J. Flynn, the former Director of the Bureau of Investigation (the predecessor to the FBI): “America in the early twentieth century was rife with threats. Organized crime groups like the Mafia, German spies embedded behind enemy lines ahead of World War I, package bombs sent throughout the country, and the 1920 Wall Street bombing dominated headlines. Yet the story of the one man tasked with combating these threats has yet to be told. The Bulldog Detective: William J. Flynn and America’s First War Against the Mafia, Spies, and Terrorists is the first book to tell the story of Flynn, the first government official to bring down the powerful Mafia, uncover a sophisticated German spy ring in the United States, and launch a formal war on terrorism on his way to becoming one of the most respected and effective law enforcement officials in American history.”

“Long before Eliot Ness and the Untouchables went after Al Capone and the Italian mob in Chicago, Flynn dismantled the first Mafia family to exist in America. Next stop for the indefatigable crime fighter would be Chief of the Secret Service where he would set his crosshairs on the country’s most notorious currency counterfeiters. Coined “the Bulldog” for his tenacity, Flynn’s fame soared as he exposed Kaiser Germany’s sophisticated spy and sabotage ring on the cusp of America’s entry into World War I. As the Director of the Bureau of Investigation (the forerunner of the FBI), the Bulldog would devise the first counterterrorist strategy in U.S. history. In this riveting biography, author Jeffrey D. Simon brings to life the forgotten saga of one of America’s greatest crime and terrorist fighters. Exquisitely researched, The Bulldog Detective finally uncovers the important legacy of this fascinating man who will now no longer be lost in history.”

What We’re Watching 🍿

New Video Series on Promoting Chemical Security

New from the Stockholm Peace Research Institute: “SIPRI is pleased to launch a new video series that explores ways of strengthening the global regime to promote chemical security. The series features interviews with chemical weapons experts.”

“The interviews were conducted during an expert workshop at SIPRI in Stockholm in November 2023, which was part of a project on strengthening the norm against chemical weapon use and promoting the effective implementation of the 1993 Chemical Weapons Convention (CWC). The event was convened to facilitate dialogue among stakeholders in the CWC regime, officials and experts from relevant fields of expertise.”

“The workshop, undertaken with support from the Norwegian Ministry of Foreign Affairs, discussed the status of the CWC regime, including challenges and opportunities in the contemporary security environment. The workshop considered how stakeholders can strengthen the normative and legal dimensions of the regime and enhance national implementation including by bolstering the work of the Organisation for the Prohibition of Chemical Weapons (OPCW). The workshop also considered the difficulties presented by fast-moving scientific and technological developments in chemistry and explored the role of the newly opened OPCW Centre for Chemistry and Technology in this context.”

“The findings of the project will be presented in a paper being published by SIPRI early this year.”

Learn more and watch here.

NEW: 2024 Respiratory Trends: Navigating the Threat of RSV, Influenza, and COVID-19

From Bluedot: “As we enter the new year, concerns are echoing from health officials about the growing triple threat: the combined surge of COVID-19, influenza, and respiratory syncytial virus (RSV). The US Centers for Disease Control and Prevention sounded the alarm with a notable uptick in emergency room visits attributed to COVID-19 and influenza. At the same time, RSV infections remain a significant threat, especially to vulnerable groups such as infants and the elderly.”

“As hospital visits rise, how concerned should we be?”

“Understanding the latest respiratory disease trends is critical to safeguarding public health.”

“Join Andrea Thomas, PhD, DVM, Head of Epidemiology, Anindita Marwah, MPH, Sr. Epidemiologist, and Josephine De Leon, MMASc, Enablement Specialist in Epidemiology, as they navigate the respiratory season and provide insights on:

Current respiratory patterns and predictions for the upcoming season
The trends that pose the greatest risk and deserve your focus
The role COVID-19 is playing and variants of concern
Key risk factors and strategies for an optimized approach”

This event will take place on Wednesday, January 24, at 11 am ET. Register here.

NEW: International Pandemic Preparedness Secretariat to Host Launch Event for Third Annual Implementation Report

From IPPS: “On Wednesday the 24th of January 2024, the IPPS will host a launch event to explore the findings of the third 100 Days Mission annual implementation report. This report is a ‘pulse check’ for how close the world is to achieving the 100 Days Mission, which outlines the progress made in 2023, the barriers to action, and opportunities to overcome them, including leveraging investments that are complementary to tackling other global health issues.”

“This event will:

1. Publicly launch the third implementation report for the 100 Days Mission, sharing its key findings and areas for action in 2024;

2. Explore and explain how the 100 Days Mission can be implemented at the global, regional and national level;

3. Convene partners from all sectors for practical discussions on implementing proposed 2024 priorities”

Learn more and register here.

NEW: Beyond the SCIF: Biosecurity and the Weaponization of Artificial Intelligence

From the Ronald Reagan Institute: “The rapid, global spread of the COVID-19 virus exposed the fragility of pandemic warning systems and response mechanisms in America and around the world. Our lack of preparedness for the next biosecurity threat leaves us vulnerable to adversaries pursuing biological weapons programs, especially with access to advanced capabilities like artificial intelligence and machine learning.”

“While AI promises to accelerate breakthroughs in science and public health, it also threatens to democratize technology that can make it easier to create and use deadly bioweapons. To prove a point, scientists have tasked large language models and other AI software to pull from massive amounts of open-source data and invent lethal novel pathogen strains in a matter of hours. As this technology and other powerful tools like gene editing proliferate, our biodefense is increasingly at risk—both at the hands of strategic competitors like China in its race for AI and biotech dominance and from non-state actors that can now harness technology to design bioweapons without sophisticated bioengineering expertise.”

“The House Permanent Select Committee on Intelligence and the Ronald Reagan Institute’s National Security Innovation Base Program will gather a panel of experts for “Beyond the SCIF: Biosecurity and the Weaponization of Artificial Intelligence” to discuss the threats to our biosecurity posed by technologies like AI, the state of our biodefense, and what concrete actions policymakers can take in light of these new vulnerabilities.”

“The panel will be moderated by Congressman Brad Wenstrup, OH-02, who serves on the House Permanent Select Committee on Intelligence and Chairs the Select Subcommittee on the Coronavirus Pandemic, and will feature panelists Mr. Hirsh Jain, Head of Public Health at Palantir Technologies; Dr. Michelle Rozo, Vice Chair of the National Security Commission on Emerging Biotechnology; Senator Jim Talent, Former Vice Chair of the Commission on the Prevention of Weapons of Mass Destruction Proliferation and Terrorism and Advisory Board Member of the RRI National Security Innovation Base Program; and the Hon. Ken Wainstein, Under Secretary for Intelligence and Analysis at the Department of Homeland Security.”

This event will take place on Thursday, January 25, at 11 am ET. Learn more and register here.

NEW: GP Nonproliferation and Strategic Trade Hub Virtual Launch & Demo

Learn more and register here.

“When Medicine Stops Saving Us: The Antimicrobial Resistance Crisis”

“Interim Dean Abel Valenzuela and the UCLA Division of Social Sciences present an exclusive screening of a new documentary from the team behind the award winning NETFLIX documentary, RESISTANCE. This genre-bending short film, HOLOBIOME, features the harrowing story of UCLA graduate Bradley Burnam’s personal encounter with a deadly superbug. Through a variety of creative elements, HOLOBIOME examines the need for innovation in AMR and questions the overall human relationship with infectious disease and the microbial world. The screening will be followed by an interdisciplinary panel discussing the looming AMR crisis through the lenses of sociology, public policy, industry, and public health.”

This event will be moderated by Biodefense PhD Program alumna Jomana Musmar. It will take place on January 22, at 5 pm PST. Learn more and register here.

AI Executive Order Report Card Reviewing the First 90 Days

This online event will begin at 12 pm EST. Learn more and register here.

International Conference, CBRNE Research & Innovation

“Worldwide, researchers, responders and industrial capacities have been commited to provide adapted response to these challenges.”

“Looking forward to your proposals for communication and to welcoming you at Strasbourg in March 2024!”

Learn more here.

cbrne-ri-conference-2024-_-flyer-ppt-v06.11.2023-1 Download

Registration for GHS 2024 Now Open

Pandora Report 1.5.2024

January 5, 2024January 5, 2024 by dkellogg97, posted in Pandora Report

Happy New Year! This week covers reports of over 450 chemical attacks by Russia since the invasion of Ukraine in 2022, the fifth anniversary of DHS’ CWMD Office, and several recent publications.

Ukraine Reports Hundreds of Chemical Attacks by Russia Since Start of Invasion

In late December, the Kyiv Post published an article explaining a post from Ukraine’s Armed Forces Support Forces Command, which “claims that Russian troops have conducted 465 chemical attacks in Ukraine since the initiation of the full-scale invasion, with over 80 such attacks in December 2023, including one grenade containing a new, unknown chemical agent…The command notes an escalating trend in the use of such weapons by Russian forces, highlighting eight chemical attacks on Dec. 19 alone.”

The article continues, explaining “The commonly used weapons include grenades like K-51, RGR, and Drofa-PM gas hand grenades dropped from unmanned aerial vehicles (UAVs). Additionally, improvised explosive devices equipped with irritant substances and artillery shelling containing chemically dangerous substances are being employed.”

“The report mentions that 28 cases involving dangerous chemicals were documented and forwarded for investigative actions as part of criminal proceedings by groups of radiation, chemical, and biological intelligence from the military units of the Support Forces Command, working in collaboration with the Security Service of Ukraine (SBU).”

In case you missed it: Last summer, the Royal United Services Institute published an article on this topic, exploring the reported limited use of riot control agents and broader deployment of CW by Russia could mean in this war. The piece offers insight into Russia’s potential ogic in using these kinds of weapons in Ukraine, making it helpful in understanding this latest reporting.

DHS Celebrates Five Years of the Countering Weapons of Mass Destruction Office

In late December, the Department of Homeland Security celebrated the fifth anniversary of the founding of the Countering WMD Office. In an email update from the Department, Assistant Secretary for the Countering Weapons of Mass Destruction Office, Mary Ellen Callahan, was quoted saying “The threat of weapons of mass destruction terrorism is real. Five years ago, in the face of a dynamic, evolving threat environment, legislators recognized that the U.S. needed a more holistic approach to countering chemical, biological, radiological, and nuclear threats to the Homeland…By authorizing CWMD, the legislators enabled us to enhance and coordinate the chemical, biological, radiological, and nuclear detection efforts of federal, state, local, tribal, and territorial governments to improve preparedness and response capabilities throughout the United States. We look forward to continuing this essential mission to protect the American people.”

The update further explained “Congress established the CWMD Office in 2018 to elevate, consolidate, and streamline DHS efforts to protect the Homeland from weapons of mass destruction (WMD) and chemical, biological, radiological, and nuclear (CBRN) threats. CWMD serves as the DHS nexus for WMD and CBRN coordination, which includes providing direct financial and operational support nationwide to government and industry partners for full-time biological detection, illicit nuclear material detection, training, and exercises. Additionally, as part of the President’s Executive Order on AI signed in October 2023, President Biden tasked CWMD with helping to evaluate and mitigate the potential for AI to be used to develop WMDs, such as through AI-enabled misuse of synthetic nucleic acids to create biological weapons. The President directed the CWMD Office to evaluate the potential for AI to lower the barriers to entry for developing WMD and to develop a framework to evaluate and stress test synthetic-nucleic acid screening, creating a standardized set of expectations for third parties that audit AI systems to prevent the risk of abuse and proliferation by malicious actors.”

Defense Dossier Issue 38: “Pandemic Preparedness and Biodefense”

The American Foreign Policy Council’s December Defense Dossier is focused on biodefense and pandemic preparedness, featuring an article-“Parsing the Great Gain of Function Debate”-co-authored by Biodefense PhD Program alumni Yong-bee Lim and Saskia Popescu. It also includes other articles like “China’s Evolving Thinking About Biotechnology,” and “Understanding the Cyberbiosecurity Threat.” Read here.

“Virology-the Path Forward”

Rasmusen et al. recently published this commentary article in the Journal of Virology. They write in their abstract, “In the United States (US), biosafety and biosecurity oversight of research on viruses is being reappraised. Safety in virology research is paramount and oversight frameworks should be reviewed periodically. Changes should be made with care, however, to avoid impeding science that is essential for rapidly reducing and responding to pandemic threats as well as addressing more common challenges caused by infectious diseases. Decades of research uniquely positioned the US to be able to respond to the COVID-19 crisis with astounding speed, delivering life-saving vaccines within a year of identifying the virus. We should embolden and empower this strength, which is a vital part of protecting the health, economy, and security of US citizens. Herein, we offer our perspectives on priorities for revised rules governing virology research in the US.”

“Interpreting the Biological Weapons Convention – What Are “Necessary Measures” Under Article IV of the Convention?”

Sally Longworth recently published this report with the Swedish Defence Research Agency. She explains in her summary, “Article IV of the Biological Weapons Convention 1972 (BWC) requires States Parties to implement national implementation measures to prohibit and prevent the development, production, stockpiling, retention, acquisition, transfer, and use of biological agents, toxins and weapons in violation of the Convention. No definition of “national implementation measures” is included in the treaty, but there has been over 50 years of State practice in implementing this obligation, which can provide guidance on how States Parties interpret the obligations under Article IV. The Final Declarations agreed by consensus by States Parties at the Convention Review Conferences held every five years are particularly useful tools in understanding what measures are required and what, if any, development there has been in interpreting Article IV. Using legal methods to interpret international treaties, this memo first analyses the obligations set out in Article IV and then considers the interpretative value of the Final Declarations in relation to the BWC. It goes on to highlight a number of measures identified by the States Parties considered necessary in the implementation of the obligations contained in Article IV and important developments in what must be covered.”

“Vision, Needs, and Proposed Actions for Data for the Bioeconomy Initiative”

The National Science and Technology Council recently released this report from the Interagency Working Group on Data for the Bioeconomy. Its executive summary explains in part, “To realize a thriving bioeconomy, the Data Initiative identifies strategic investments and opportunities to leverage and build upon existing resources. The goal is to create an interwoven data fabric that connects data with the infrastructure and computational resources necessary to analyze, synthesize, and use those data for the widest audience. This vision depends on creation and adoption of community-driven standards, both for data and for repositories to enable interoperability and integration; training and education to build the bioeconomy data workforce of tomorrow; efforts to limit and mitigate security risks; and ongoing coordination to ensure efforts keep pace with transformations in data science, computing, biotechnology and biomanufacturing. While additional data are needed, government coordination and investment in infrastructure are also needed to make best use of the existing and anticipated data.”

Furthermore, in identifies seven Core Action areas the Data Initiative indicates requires “consistent whole-of-government coordination and investments”:

Dedicated long-term funding mechanisms for data and computational resources and infrastructure;
Standards to establish common best practices that foster and strengthen a shared U.S. bioeconomy data ecosystem;
Biodata Catalog to identify extant data and metadata;
Security practices and policies that secure the data landscape while supporting innovation;
Workforce to drive U.S. leadership in the bioeconomy of the future;
Strategically Targeted Areas for Rapid Transformation (START) to determine viability and impact and chart a course for larger investments; and
Coordination of intergovernmental investments, efforts, and resources.

“FACT SHEET: Biden-⁠Harris Administration Releases Global Health Security Partnerships Annual Progress Report Demonstrating Results from United States Investments”

The White House recently released this fact sheet along with the release of its Global Health Security Partnerships Annual Progress Report. The fact sheet explains in its introduction, “The Biden-Harris Administration continues to prioritize global health security as a critical component of national biodefense. The COVID-19 pandemic, as well as HIV/AIDS, Ebola, mpox and other outbreaks in recent years, has demonstrated the catastrophic impacts infectious diseases can have on health, economies, and societies, regardless of where they start. The United States partners with countries around the world to build stronger global health security capacity – the ability to prevent, detect, rapidly respond to, and recover from new and emerging public health threats and prevent their spread across borders. Partnering with countries to stop infectious disease threats at their source, including by strengthening equitable health systems in their own countries and across regions, effectively protects the health of Americans and people across the world.”

“Exploring Actions for Epidemic and Pandemic Preparedness”

The National Academies recently released this Proceedings of a Symposium-in Brief: “Investing in pandemic preparedness ahead of disease outbreaks can greatly reduce the toll of epidemics and pandemics when they occur. Although several tools exist for assessing pandemic preparedness at an epidemiological and operational level, less information and fewer approaches are available to guide the prioritization of preparedness investments at the country level. The National Academies of Sciences, Engineering, and Medicine held an international, virtual symposium series in May and June 2023 to explore possible strategies for evidence-based prioritization of global health capabilities to prepare for future epidemics and pandemics. Speakers and participants discussed assessment tools for national action planning; country and organizational decision-making about funding priorities; effective approaches for disease surveillance and risk communication; governance structures that support robust and reliable systems for global health investments; and specific actions for tools and resource prioritization for preventing and preparing for future epidemics and pandemics. This publication summarizes the presentation and discussions of the symposium.”

“America Should Be More Like Operation Warp Speed”

Gary Hamel and Michele Zanini recently published this Ideas piece in The Atlantic focused on how OWS offers lessons for the rest of the government in achieving goals. They write in their introduction, “The U.S. government can achieve great things quickly when it has to. In November 2020, the Food and Drug Administration granted emergency-use authorization to the Pfizer-BioNTech vaccine for COVID-19. Seven days later, a competing vaccine from Moderna was approved. The rollout to the public began a few weeks later. The desperate search for a vaccine had been orchestrated by Operation Warp Speed, an initiative announced by the Trump administration that May. Developing, testing, manufacturing, and deploying a new vaccine typically takes a decade or more. OWS, which accomplished the feat in months, belongs in the pantheon of U.S. innovation triumphs, along with the Manhattan Project and the Apollo moon-landing program. It’s a case study in how the U.S. government can solve complex, urgent problems, and it challenges the narrative that public institutions have lost their ability to dream big and move fast.”

“Why the World Needs Its Own Immune System”

Atul Gawande, USAID’s Assistant Administrator for Global Health, recently published this opinion piece in The New York Times. He writes in part, “This is now the pattern: one emergency after another, often overlapping, diverting focus away from longer-term public health goals. And there’s no sign of this letting up. Displacement and activities like deforestation have increased contact between humans and wildlife — and thus the incidence of animal diseases leaping to humans. (The Ebola virus, for example, has been linked to bats as a possible source of spread.) The risk of outbreak-causing laboratory accidents is a significant concern as labs proliferate and safety measures lag. On average, between 1979 and 2015, more than 80 laboratory-acquired infections were reported per year, several involving transmission beyond those initially infected, and underreporting is rife. The growing field of synthetic virology has simultaneously generated lifesaving new treatments (mRNA vaccines, for example) and made it easier for bad actors to turn infectious diseases into weapons of mass destruction.”

“But we can break the pattern. Longer-range investment in local preparedness for such events — in building what I think of as a global immune system — could reduce the threat these crises pose and even reduce dependence on foreign aid to weather them. As dangers rise, so can our capacity to get ahead of them. With the right strategy, we could use the mishaps, malefactors and shocks we face to strengthen our capacity to adapt. This is not about developing resilience (the ability to recover from crisis) or robustness (the ability to resist crisis). It is about developing what the writer Nassim Nicholas Taleb has called antifragility — the ability to become stronger from crisis.”

“The OPCW and Civil Society: Considerations on Relevant Themes and Issues”

Alexander Ghionis recently published this working paper for CBWNet. He explains in its executive summary, “This paper explores some key elements of the relationship between the Organisation for the Prohibition of Chemical Weapons (OPCW) and civil society, with the specific and limited aim of supporting ongoing discussions being held within the OPCW regarding options and mechanisms to enhance that relationship. The paper is designed to be practical, providing readers from State Parties, the Technical Secretariat, civil society, and other stakeholders, with some initial perspectives, ideas, and considerations that could inform discussions.”

The paper addresses “The composition and focus of accredited civil society organisations (CSOs); How CSOs have engaged with the OPCW so far and what alternative modes of engagement may be beneficial; and, What foundational aspects can strengthen the relationship between the OPCW and civil society moving forward.”

“The Altered Nuclear Order in the Wake of the Russia-Ukraine War”

Rebecca Davis Gibbons, Stephen Herzog, Wilfred Wan, and Doreen Horschig recently published this research paper with the American Academy of Arts & Sciences. They explain in their executive summary: “On February 24, 2022, Russia invaded nonnuclear-armed Ukraine and leveraged threats with its nuclear arsenal as a “shield” to deter third-party intervention. The well-publicized horrors on the ground in Ukraine are, unfortunately, not the only consequences of Russia’s full-scale invasion of its neighbor. The war is having unmistakable effects on how governments, scholars, and the public think about nuclear arms. Not only has Moscow reintroduced the world to the often-unsavory realities of nuclear deterrence, but its suspension of the New Strategic Arms Reduction Treaty (START) and deratification of the Comprehensive Nuclear-Test-Ban Treaty (CTBT) have been setbacks for arms control and disarmament. Meanwhile, vulnerable states around the globe may be further incentivized to develop nuclear weapons or seek protection from nuclear-armed patrons to avoid being invaded like Ukraine.”

“Given these changing geopolitical circumstances, how might the Russian war on Ukraine affect the global nuclear order? The authors in this publication conclude that the United States and the broader international community must now more seriously engage with alternatives to traditional arms control, nonproliferation, and disarmament endeavors. Specifically, the authors discuss the increasing prominence of approaches such as the Treaty on the Prohibition of Nuclear Weapons (TPNW)—popularly known as the Nuclear Ban—and risk reduction measures. They assess whether these initiatives can have an impact in reducing nuclear dangers. Additionally, they examine temptations for states to pursue more forceful counterproliferation measures and describe the risks of doing so.”

NEW: “When Medicine Stops Saving Us: The Antimicrobial Resistance Crisis”

This event will be moderated by Biodefense PhD Program alumna Jomana Musmar. It will take place on January 22, at 5 pm PST. Learn more and register here.

NEW: AI Executive Order Report Card Reviewing the First 90 Days

This online event will begin at 12 pm EST. Learn more and register here.

International Conference, CBRNE Research & Innovation

“Worldwide, researchers, responders and industrial capacities have been commited to provide adapted response to these challenges.”

“Looking forward to your proposals for communication and to welcoming you at Strasbourg in March 2024!”

Learn more here.

cbrne-ri-conference-2024-_-flyer-ppt-v06.11.2023-1 Download

Registration for GHS 2024 Now Open

Vote: 2023 Arms Control Person(s) of the Year Nominees

“Since 2007, the independent, nongovernmental Arms Control Association has nominated individuals and institutions that have, in the previous 12 months, advanced effective arms control, nonproliferation, and disarmament solutions and raised awareness of the threats posed by mass casualty weapons.”

“In a field that is often focused on grave threats and negative developments, the Arms Control Person(s) of the Year contest aims to highlight several positive initiatives—some at the grassroots level, some on the international scale—designed to advance disarmament, nuclear security, and international peace, security, and justice.”

“Voting will take place between Dec. 8, 2023, and Jan. 11, 2024. The results will be announced on Jan. 12, 2024. Follow the discussion on social media using the hashtag #ACPOY2023.”

Learn about the nominees and vote here.

Pandora Report 12.15.2023

December 15, 2023 by dkellogg97, posted in Pandora Report

This week covers the FDA’s ongoing investigation into contaminated applesauce, the passing of Gao Yaojie-an activist responsible for bringing to light the extent of China’s AIDS epidemic-, and more.

*Biodefense MS Graduates Riley Flynn and Sophie Hirshfield at GMU’s 2023 Winter Commencement Ceremony*

FDA Leadership Says Tainted Applesauce Pouches May Have Been Intentionally Contaminated

Cinnamon applesauce pouches available Weis, WanaBanana, and Schnucks have been pulled from shelves after they were found to be contaminated with lead. Dozens of children in the United States have been sickened by the tainted products. Now, the FDA’s Deputy Commissioner for Human Foods, Jim Jones, says they may have been intentionally contaminated.

In an interview with Politico, Jones said “We’re still in the midst of our investigation. But so far all of the signals we’re getting lead to an intentional act on the part of someone in the supply chain and we’re trying to sort of figure that out.” All of the pouches in question were linked to a manufacturing facility in Ecuador that the FDA is currently inspecting.

‘“My instinct is they didn’t think this product was going to end up in a country with a robust regulatory process,” Jones said. “They thought it was going to end up in places that did not have the ability to detect something like this.”’

Politico further explained that “The FDA continues to investigate a number of theories for how the pouches became contaminated, and has not drawn any conclusions about the way the lead was added, why or by whom. The FDA says it currently believes the adulteration is “economically motivated.” That generally refers to ingredients being altered in order to make products appear higher in value, often so companies can produce a cheaper item and sell it at an elevated price.”

“The agency and the Centers for Disease Control and Prevention have collaborated with state and local health authorities as well as Ecuadorian authorities to trace the origin of the cinnamon in the applesauce pouches, which is believed to be the source of the lead contamination. More than 60 U.S. children under the age of 6 have tested positive for lead poisoning after consuming the pouches — some at levels more than 500 times the acceptable threshold for lead, according to The Washington Post.”

Gao Yaojie, Chinese Physician and Self-Exiled AIDS Activist, Dead at 95

Gao Yaojie, a gynecologist and well-known AIDS activist, died on December 10 in New York City. Gao, formerly based in China’s Henan province, was famous for her work to expose the outbreak of HIV/AIDS in the country in the 1990s and 2000s. The outbreak was large in scale and primarily driven by the country’s Plasma Economy, which arose because of restrictions on foreign imports of blood products in the 1990s. This resulted in blood plasma donation becoming a way for rural populations to make money in government-supported plasma donation centers. However, unsafe practices like repeated use of unsterilized needles and pooling multiple donors’ blood during the plasmapheresis allowed HIV to spread widely.

Because of the Chinese government’s efforts to suppress reporting on this epidemic, poor rural populations were left largely unaware of the dangers of plasma donation and the public in general was unaware of the severity of the crisis. Gao was one of the first to speak publicly about the outbreak, helping draw the attention of media outlets. She later told documentary filmmakers about her motivations for doing this, saying, “My driving thought is: how can I save more people from dying of this disease? We each only live one life.”

It is estimated that at least one million Chinese were infected with HIV during this epidemic, highlighting the importance of Gao’s and others’ bravery. For this, she garnered praise from the United Nations, several Western organizations, and even Hillary Clinton. This rising fame led to her being placed under house arrest in 2007, with about 50 police preventing her from traveling to the United States to accept an award recognizing her work. In response to this, she told NPR “I think they feel I got in the way of their political achievements and their official careers…Otherwise, why would they put me under house arrest? What law did I break to warrant mobilizing all these police?”

NPR further explained her activities later in life in their article on her passing, writing: “Despite pressure from Henan provincial authorities to stop publicizing the AIDS crisis, she continued her work, using all the proceeds from her books and pamphlets to support AIDS families, especially children orphaned by the disease or the many suicides that it caused.”

“Restrictions on her movement began hindering in work in China, however, and in 2009, she abruptly fled to the US, after fearing she would be put under house arrest again. Many admirers continued to visit her apartment in West Harlem, including a group of young Chinese students who kept her company in the loneliness of exile.”

‘”Many Chinese regarded her as a hero, and when they came to New York, if they didn’t know how to contact her , [sic] they would ask me. I would ask them for an email written in Chinese and would forward it to her. So far as I know, she always wrote back to those people and welcomed them to come visit,” remembers Andrew Nathan, a political science professor at Columbia University who handled much of Gao’s affairs in New York.”

“The Biological and Toxin Weapons Convention in 2023: Glimmers of Progress Set Against a Troubled Geopolitical Landscape”

Experts at CSR’s Nolan Center, including Biodefense PhD Program alumna and current faculty member Saskia Popescu, recently authored this blog post focused on the BWC’s potential for success in verification, universalization and effective implementation in Africa, and the creation of an International Agency for Biological Safety. They explain in their introduction: “For nearly two decades, efforts to strengthen the Biological and Toxin Weapons Convention (BWC) were in stasis, with opportunities missed and States Parties unable to agree to definite action. States Parties arrived at the Review Conference last year facing a growing biological weapons threat—augmented by rapidly converging complimentary technologies—coupled with a status quo in the BWC that was insufficient for the task. Yet nations drove a breakthrough: the consensus achieved at last year’s Review Conference proved that action is still possible despite the challenging international security environment.”

“In a world in which biological threats and vulnerabilities are exceedingly complex, there is a critical need to reinforce relationships among global experts, national governments, and civil society. Over the past two weeks, these stakeholders have met to identify, examine, and develop specific and effective measures to strengthen the Convention. An unwavering theme throughout the Meeting of States Parties underscored that preparedness and resilience are investments, rather than costs, reinforcing the deterrence by denial efforts CSR continues to promote. Although the challenging international security environment continues to hinder progress there are glimmers of genuine progress across several fronts…”

“Biosecurity in the Americas: Regional Threat Assessment”

A new from UMD’s START, co-authored by Biodefense MS Program alumna Alexandra Williams: “This publication, currently available in Spanish, provides a breadth and depth of focuses as a high-level assessment of the Central and South America regions and introduction to key topics as:

The needed expansion of understanding of the differences and areas of collaboration between the concepts of biosafety and biosecurity,
Existing international obligations to biosecurity through the BWC and UNSC Resolution 1540,
How biosecurity applies to and may differ in application across a variety of facility types that engage in biological research or production, whether private or public laboratories, agricultural or university-based facilities,
Biosecurity risks that include proliferation, bioterrorism, agroterrorism, and biocrime,
The five pillars and mechanisms of biosecurity,
Lastly, the application of biosecurity in the Central and South American regions.”

“NTI|Bio Convenes Workshop on Disincentivizing State Bioweapons Development and Use”

From NTI: “A week ahead of the Biological Weapons Convention (BWC) Working Group meetings in Geneva, Switzerland, NTI | bio convened a workshop on “Disincentivizing State Bioweapons Development and Use.” This two-day workshop on November 29 and 30 brought together academics, diplomats, biosecurity experts, and government policy makers to begin developing a cross-disciplinary thought and practice community to explore and develop potential disincentivizing solutions. Current thinking and policy on disincentivizing bioweapons acquisition and use is underdeveloped—especially by comparison with the nuclear security field.”

‘“We launched this effort because we see the need for more rigorous thinking on effective approaches to making bioweapons unattractive to nation-states,” said NTI | bio Vice President Jaime Yassif. “NTI’s goal is to bridge theory and practical policy-relevant approaches to develop new ideas that can invigorate international efforts to reduce biological threats.”’

Biodefense Graduate Program Director Gregory Koblentz and Associate Professor Sonia Ben Ouagrham-Gormley both participated in this workshop. Read more about it here.

“Great Powers and the Norms of the BW Prohibition Regime”

A new working paper from CBWNet: “The United States of America and the Soviet Union were instrumental in creating the biological weapons prohibition regime more than 50 years ago. This has left the regime with a big gap in its normative structure related to the verification of treaty compliance. The working paper by Alexander Kelle and Eva Siegmann analyses great power involvement in several areas of regime implementation and concludes that none of the great powers, including China, has supported the addition of declaration and inspection norms. While recent US and Chinese initiatives could still lead to a strengthening of the regime in different areas, Russian policies, most notably false accusations against the US and others, threaten to undermine the regime.”

“AI and Biorisk: An Explainer”

A new explainer from Georgetown’s CSET: “Recent government directives, international conferences, and media headlines reflect growing concern that artificial intelligence could exacerbate biological threats. When it comes to biorisk, AI tools are cited as enablers that lower information barriers, enhance novel biothreat design, or otherwise increase a malicious actor’s capabilities. In this explainer, CSET Biorisk Research Fellow Steph Batalis summarizes the state of the biorisk landscape with and without AI.”

“Bio X AI: Policy Recommendations For A New Frontier”

Jeffrey et al. discuss the work of the Federation of American Scientists’ Bio x AI Policy Development Sprint in this piece, explaining in their introduction: “Artificial intelligence (AI) is likely to yield tremendous advances in our basic understanding of biological systems, as well as significant benefits for health, agriculture, and the broader bioeconomy. However, AI tools, if misused or developed irresponsibly, can also pose risks to biosecurity. The landscape of biosecurity risks related to AI is complex and rapidly changing, and understanding the range of issues requires diverse perspectives and expertise. To better understand and address these challenges, FAS initiated the Bio x AI Policy Development Sprint to solicit creative recommendations from subject matter experts in the life sciences, biosecurity, and governance of emerging technologies. Through a competitive selection process, FAS identified six promising ideas and, over the course of seven weeks, worked closely with the authors to develop them into the recommendations included here. These recommendations cover a diverse range of topics to match the diversity of challenges that AI poses in the life sciences. We believe that these will help inform policy development on these topics, including the work of the National Security Commission on Emerging Biotechnologies.”

“Push to Improve Biosecurity in the Age of Genetic Engineering”

Wilmot James recently authored this opinion piece for Business Day, explaining in part “The possibility of using AI to develop bioweapons raises additional concerns, and remains uncharted territory. While the intersection of AI and biotechnology holds immense potential for positive applications in healthcare, research and diagnostics, it also poses risks if misused. AI algorithms could be employed to analyse vast genetic data sets and identify specific sequences for manipulation. This could accelerate the process of genetic engineering, allowing for the creation of more efficient and potentially harmful pathogens…To safeguard against such threats, multilateral and public-private sector agreements and regulations to govern the ethical use of AI in science, emphasising the prohibition of bioweapon development, should be established, with strong oversight committees responsible for assessing the ethical implications at the intersection of AI and biotechnology. These committees should include experts in AI, virology, bioethics and global health security.”

“Sounding the Alarm on Anti-Science”

Margaret Winchester provides background and overview of Peter Hotez’s latest book-The Deadly Rise of Anti-Science-in this piece for Health Affairs: “In his book, The Deadly Rise of Anti-Science, Hotez, professor and dean of the National School of Tropical Medicine at Baylor College of Medicine, and co-director of the Center for Vaccine Development at Texas Children’s Hospital, paints a bleak picture of public science denial during the pandemic, embedded in historic context. He tells the story of systematic anti-science efforts from his view in the trenches—and as a personal target for anti-science activists. This book, and his commentary in our December issue of Health Affairs on global lessons from COVID-19, highlight the very real effects of this movement, including lives lost, undermined public health efforts, foregone vaccinations, social schisms, and more, that will be felt for generations to come. As he writes, “anti-science now kills more Americans than global terrorism, or other deadly societal forces and social determinants.” Drawing from multiple sources, he estimates that approximately 200,000 people needlessly died in the US after COVID-19 vaccines became widely available.”

EU vs Disinfo Disinformation Review

The most recent edition of EU vs Disinfo’s Disinformation Review is now available and features multiple sections focused on Russia’s continued use of alleged US biological weapons laboratories as a bogeyman. Be sure to check it out for fantastic lines such as “If the only tool that you have is a hammer, everything looks like a biolab,” and “At a staged event, Putin mumbled out an announcement to veterans and the wider public that his regime would continue to rule over Russia after an orchestrated ritual not to be confused with an event known as an ‘election’ in the free world.”

2023 State of the Bioeconomy

From BIOISAC: “We have a lot to celebrate as we close 2023 and just over 12 months since the Executive Order calling for a safe, secure bioeconomy. Join us as we recap the activity, publications, outcomes, and – we will of course share a glimpse of the “behind the scenes” conversations from our 3 regional events and our one-day “Closing the Knowledge Gaps” event, our two-day table top training and the resulting “Going Viral: Bioeconomy Defense TTX” report, and, of course, the industry-demanded outputs from our hardware/software device security workgroup report and supplements, “Fortifying the Bioeconomy” as well as the Bioeconomy Security Questionnaire and Instrument Disposal Guide. We also have a lot left to do! We plan to share a few of our goals for 2024 and our upcoming regional events schedule.”

“Join us December 19th at 2pm Eastern-US for a live discussion.” Register here.

Presidential Advisory Council on Combating Antibiotic-Resistant Bacteria (PACCARB) Virtual Meeting

“The Presidential Advisory Council on Combating Antibiotic-Resistant Bacteria (PACCARB) provides advice, information, and recommendations to the U.S. Secretary of Health and Human Services (HHS Secretary). The council supports and evaluates U.S. government activities focused on fighting antimicrobial resistance (AMR) in human health, animal health, and environmental health. Using this One Health approach, members of the PACCARB have expertise from a range of backgrounds, including academia, industry, public health, advocacy, veterinary, and agricultural production.”

“The PACCARB was established under Executive Order 13676 and included in the Pandemic and All-Hazards Preparedness and Advancing Innovation Act of 2019 (PAHPAIA). Since 2019, the President has given authority to the HHS Secretary as the primary recipient of PACCARB recommendations. Additional information on the authority and activities of the PACCARB can be found on the About Us page in the charter.”

“As a federal advisory committee, the PACCARB looks to engage with the public and all AMR stakeholders. The council holds several public meetings every year both in-person and live streamed on the HHS.gov website. These meetings are open to anyone with an interest in combating AMR. See how to get involved!”

This virtual meeting will take place on December 20 from 9-4 EST. Learn more here.

61st ISODARCO Course: Nuclear Order and International Security after Ukraine

“The war in Ukraine has had an enormous impact on global security, reviving nuclear fears, undermining the prospects for arms control, and shattering many of the norms and constraints that were the foundation of European security. ISODARCO 2024 will examine the global nuclear order in light of the Ukraine war, focusing on the states, the policies and the technologies that will shape the future in a much more difficult environment. How will we cope with this more dangerous world?”

This course will take place January 7-14, 2024, at the University of Trento. Learn more and register here.

International Conference, CBRNE Research & Innovation

“Worldwide, researchers, responders and industrial capacities have been commited to provide adapted response to these challenges.”

“Looking forward to your proposals for communication and to welcoming you at Strasbourg in March 2024!”

Learn more here.

cbrne-ri-conference-2024-_-flyer-ppt-v06.11.2023-1 Download

Registration for GHS 2024 Now Open

WHO Announces Proposed Members of Technical Advisory Group on Response Use of the Life Sciences and Dual-Use Research

The WHO recently announced its proposed membership of its Technical Advisory Group on Responsible use of the life sciences and dual-use research (TAG-RULS DUR). According to WHO, “As per WHO processes, there will be now a two-week public consultation period for WHO to receive feedback on the proposed TAG-RULS DUR members and set in place the modalities for the TAG-RULS DUR’s first meeting, which is planned to take place following this consultation period…The final membership to the TAG-RULS DUR is subject to the above-mentioned public consultation period and relevant WHO practices and procedures.”

The proposed membership and instructions for providing commentary on the individuals included are both available here.

Vote: 2023 Arms Control Person(s) of the Year Nominees

“Voting will take place between Dec. 8, 2023, and Jan. 11, 2024. The results will be announced on Jan. 12, 2024. Follow the discussion on social media using the hashtag #ACPOY2023.”

Learn about the nominees and vote here.

Pandora Report 12.08.2023

December 8, 2023 by dkellogg97, posted in Pandora Report

This week includes coverage of updates to Japan’s End User List, the Taliban’s newly declared war on polio, Biomemory’s $1k DNA storage cards, new publications, upcoming events, and more.

Japan Revises End User List, Includes 101 Chinese Organizations and Institutions

Japan’s Ministry of Economy, Trade, and Industry has revised the country’s End User List, which provides “…exporters with information on foreign entities for which concern cannot be eliminated regarding involvement in activities such as the development of weapons of mass destruction (WMDs) and other items, for the purpose of enhancing the effectiveness of the catch-all control on cargos and other loads relating to WMDs and other items.”

The updated list, which takes effect on Monday, now includes 706 organizations in 15 countries and regions, according to Nikkei. This is an increase of 36 over last year’s list and, notably, it includes the China Academy of Engineering Physics (CAEP)-the main center for Chinese research on and manufacturing of nuclear weapons. Seven total Chinese entities were added to the list, about 90% of which are thought to be involved in missile development. Nikkei notes that “Many universities, academies and research institutes are also listed, which reveals the extent of Xi Jinping’s Military-Civilian Fusion policy. Machine tools produced by Japanese companies and others are suspected of being used by the CAEP, according to a Nikkei investigation.”

223 Iranian organizations and institutions are on the list, in addition to 153 North Korean ones, and 101 each from China and Pakistan. Nikkei further explains that “Japan aims to prevent the outflow of civilian technology that could be diverted to military use. Exporters are required to get approval from the Minister of Economy, Trade and Industry to export products to the listed organizations unless it is clear that the materials will not be used to develop WMDs such as nuclear weapons or missiles.”

“The economy ministry makes the list to enhance the effectiveness of its “catch-all” control system, which obliges exporters to apply for an export license for goods that may be used for the development of WMDs even if the goods are not subject to export restrictions under international agreements. The list has been issued since catch-all controls were introduced in April 2002 and is revised about once a year. It is not an embargo list.”

Taliban Announces Polio Eradication Campaign

Naturally acquired polio remains endemic in just two countries today- Afghanistan and Pakistan- in part because, as Radio Azadi explains, “Islamic militants often target polio-vaccination teams, falsely claiming the vaccination campaigns are a Western conspiracy to sterilize children.” During its 20-year struggle to regain power, the Taliban often banned door-to-door vaccination efforts. In 2021, nationwide door-to-door polio vaccinations were allowed to resume after the Taliban and the United Nations/World Health Organization reached an agreement.

Now, as explained by a recent article in The Washington Post, the Taliban is “declaring war” on polio in an apparent complete reversal of its previous stance. The article explains “Vaccinators in the country’s northeast, the center of the poliovirus outbreak, search cars for unvaccinated children at roadside checkpoints manned by Taliban soldiers. With no deadly attacks on public health campaigners reported in Afghanistan this year, they also feel increasingly comfortable venturing into remote virus hot spots that were previously far beyond their reach.”

The country’s health ministry announced the continuation of its annual polio vaccination campaign in March of this year, marking the second year the program has continued to operate under the Taliban’s rule. The ministry indicated it aimed to reach approximately 9 million children with the campaign, as Afghanistan and neighboring Pakistan continue to struggle with endemic polio due in large part to accessibility difficulties, displacement, regional instability, and concerns about external interference. Pakistan suspended its anti-polio drive in multiple districts this year after police escorting vaccination teams were repeatedly attacked.

French Start-Up Announces Sales of DNA Storage Cards, BIO-ISAC Joins DNA Data Storage Alliance Amid Growing Interest, Concerns

Multiple news outlets have covered the French start-up Biomemory‘s release of $1,000 pairs of DNA cards that promise a “minimum” 150-year lifespan of data storage. The Verge’s Emma Roth explains “DNA has emerged as a theoretical alternative to hard drives, SSDs, and other forms of digital data storage, namely because of its impressive lifespan. Science estimates the technology could potentially last hundreds of thousands of years if stored in a cool, dry environment. That’s a heck of a lot longer than the lifespan of your average hard drive, which typically tops out at around five years.”

However, Biomemory’s cards currently offer just one kilobyte of storage, or about one email according to Wired. The data stored on the card is retrieved by mailing the cards to Eurofins Genomics, who then return the stored information using strings of DNA’s nucleotide bases-adenine (A), cytosine (C), guanine (G) and thymine (T). Users can then use Biomemory’s DNA translation feature to decode the stored information. The card is not returned afterward. The company expects to begin shipping orders from its waitlist in January.

‘”The launch of our DNA Cards represents a significant milestone in the evolution of data storage technology,” Erfane Arwani, CEO of Biomemory, said about the pioneering development. “After years of talk about the potential of molecular computing, we are incredibly proud to bring the first DNA data storage product to market, that not only pushes the boundaries of innovation but also aligns with our commitment to environmental sustainability and efficiency.”‘

This news has coincided with the announcement that the Bioeconomy Information Sharing and Analysis Center, an international organization that aims to address threats unique to the bioeconomy, has joined the DNA Data Storage Alliance. The organization explained in a statement: “This year BIO-ISAC created the Genomic Data Workgroup, informing the National Cybersecurity Center of Excellence at National Institute of Standards and Technology efforts to launch the Cybersecurity Framework Profile for Genomic Data and the forthcoming text on the Privacy Framework Profile for Genomic Data. Prioritizing workgroup efforts to apply and implement this work, BIO-ISAC pursued membership and presentation opportunities with aligned organizations and audiences.”

“Today, BIO-ISAC joins more than 40 members of the DNA Data Storage Alliance, in hopes of creating a future with safe, secure data storage systems and processes for genetic data at all stages of its lifecycle.”

“Founded in 2020, the DNA Data Storage Alliance was built to create and promote an interoperable storage ecosystem based on DNA as a data storage medium. The organization seeks to educate the public and raise awareness about this emerging technology and its vast power to preserve our digital legacy. As the methods of commercially viable DNA storage become better understood, the Alliance will consider recommending the creation of specifications and standards (e.g., encoding, reliability, retention, file systems) which enable end-users to add interoperable DNA-based storage solutions to their existing storage hierarchies.”

On a more fun note, Biomemory’s homepage does include a DNA Translate feature at the bottom which shows users how lines of text may be converted to strings of As, Cs, Gs, and Ts, so we tested it out: AGAGAGACAGTCTCACAGTCAGAGACTCACACAGAGACACAGTCACAGAGTCTGTCAGTCAGACAGTCTGTGAGTGACTCAGTCACAGACTCACACAGAGACTCAGTCAGAGAGTGACACAGTCTGTGAGTGACTCAGTGAGACACTCACACAGTCTCAGAGTGACTGACTCACACAGTGAGACAGTCTCACAGTCAGAGACTCACACAGTCACTCAGTCAGAGAGTGACTGAGTGAGACACTCACACAGTCTGTCAGTCAGAGAGTGCCGAAGTGACTGAGTCTGACAGTCAGAGAGTGAGACAGTGAGACAGTCAGAGAGTGACTCCCGAACAG

The page lacks a feature allowing users to translate their string of nucleotide bases back to regular text, so take our word for it: The Pandora Report is the best newsletter!

WHO Weekly Epidemiological Record One Health-Focused Issue

“The Weekly Epidemiological Record (WER) serves as an essential instrument for the rapid and accurate dissemination of epidemiological information on cases and outbreaks of diseases under the International Health Regulations and on other communicable diseases of public health importance, including emerging or re-emerging infections.”

The most recent issue is focused on One Health and includes pieces on incorporating One Health into the international political agenda, the Collaboration on One Health between WHO, FAO, WOAH, and UNEP, and more.

“Henry Kissinger Supported Wars and Coups. He Also Played a Little-Known Role in Eliminating Bioweapons”

Matt Field recently authored this piece about the late Henry Kissinger in The Bulletin of the Atomic Scientists, writing in part: “By the late 1960s, incidents with chemical weapons—including an accident with VX nerve agent in Utah that killed some 6,000 sheep—had focused Congress’s attention on the US chemical and biological warfare operation. Internationally, there were efforts to begin arms control negotiations around these weapons of mass destruction. And Kissinger led internal government deliberations over what to do with the US program. At one point, according to Tucker and Mahan, Kissinger, unhappy with a policy paper that contained both arguments in favor and against retaining biological weapons, produced his own paper that cut the points in favor of the offensive program. He included his personal recommendation to restrict the US program to biological defense, which involves the development of countermeasures such as vaccines.”

“Insights from BARDA Industry Day 2023”

Tanima Sinha, Director of Life Science Product Development and Government Contracts at the Biomedical Advanced Research and Development Authority (BARDA), recently authored this post covering BARDA Industry Day 2023 and upcoming insights from the conference that will be made available. She explains in part, “Here we will take a quick glimpse at ASPR (Administration for Strategic Preparedness and Response) and BARDA’s programs to enhance the nation’s biomedical industrial base and supply chain capacity. The COVID-19 pandemic brought to light the inadequate availability of essential medical needs. In response to these deficiencies, the USG/ HHS (Health and Human Services) (Health and Human Services) is expanding the public health industrial base through innovative solutions.”

Fortifying the Bioeconomy

From BIO-ISAC: “Standardizing tools for assessing, remediating, and disposing of hardware and software instruments has been a recurring problem in our sector, reducing our ability to operate in a safe, secure way. Earlier this year, BIO-ISAC took action to address this need.”
“Fortifying the Bioeconomy, an in-depth resource about shared responsibility in hardware and software lifecycle management, is now available. This resource includes additional materials including a standardized vendor questionnaire and an instrument disposal guide.”

“We hope these materials guide industry and offer us a safe, secure path forward for our nation’s labs, biomanufacturers, growers, and innovators.”

Access here.

“Country Reports on Terrorism 2022”

“Country Reports on Terrorism 2022 is submitted in compliance with Title 22 of the United States Code, Section 2656f (the “Act”), which requires the Department of State to provide to Congress a full and complete annual report on terrorism for those countries and groups meeting the criteria of the Act.”

This report includes “Chapter 3 — The Global Challenge of Chemical, Biological, Radiological, or Nuclear Terrorism,” explaining the status of CBRN materials and expertise as terrorist threats and the United States’ efforts to counter them in 2022.

“New Information Tool on Nuclear Weapons Seeks to Identify the Next Arms Control Strategies”

Andrew Facini recently authored this piece for The Bulletin of the Atomic Scientists discussing the Council on Strategic Risks’ recently-launched Nuclear Weapons System Project. He explains, “For those of us seeking to cultivate nuclear policies geared toward enhancing strategic stability, the current trend reflects a worrying loss of perspective—a forgetting of the hard-earned lessons of the Cold War. To help put today’s trends in their historical context, a team of the Council on Strategic Risks (CSR) developed a new visualization tool and information system that maps every type of nuclear weapon fielded by the five nuclear weapons states (P5) under the Nuclear Non-Proliferation Treaty (NPT)—China, France, Russia, the United Kingdom, and the United States—from their inception to present day.”

What We’re Listening To 🎧

Technologically Speaking Podcast Ep. 6, Science is Messy

New from the Department of Homeland Security: “Host John Verrico sits down with Dr. Nick Bergman, director of S&T’s National Biodefense Analysis and Countermeasures Center (NBACC). Dr. Bergman is a bit of a germaphobe, but it’s hard not to be when you run a Biosecurity Level 4 lab that studies pathogens for which no vaccine or treatment exists. Hear an insider’s perspective of the COVID pandemic, find out how NBACC regularly helps the FBI, and meet a guy living a “pretty typical life” of helping save us all from superbugs.”

Listen here.

What We’re Watching🍿

Biosecurity

New from the Dutch Ministry of Health, Welfare and Sport: “This film provides an introduction into eight pillars of good practice for biosecurity, that are important when implementing biosecurity control measures.”

“These control measures are necessary to protect high-risk biological materials against theft or misuse by malicious parties.”

“The biosecurity aspects in these eight pillars of good practice are explained, which can help you to implement biosecurity within your organisation. This film is focussed on organisations that work with high risk biological materials.”

The short film is available in Dutch, English, and English with Russian subtitles.

Mitigating Arboviral Threats and Strengthening Public Health Preparedness

“Arboviruses are a broad group of viruses that are spread by arthropods, such as ticks and mosquitoes. Diseases caused by arboviruses, like dengue, chikungunya, Zika, and yellow fever, present a significant public health burden and threaten billions of people worldwide. Despite the global recognition of the devastating health and economic impacts of these diseases, the need persists for improved integration of mitigation efforts into public health systems and environmental and urban planning.”

“The National Academies Forum on Microbial Threats will conduct a two-day workshop that will identify lessons learned from previous outbreaks, outline current arbovirus surveillance capacities, and describe novel approaches to arbovirus mitigation. The workshop will include perspectives from researchers, public health practitioners, and environmental management experts from across the globe.”

This event will take place on December 12 and 13. Learn more here.

Presidential Advisory Council on Combating Antibiotic-Resistant Bacteria (PACCARB) Virtual Meeting

This virtual meeting will take place on December 20 from 9-4 EST. Learn more here.

61st ISODARCO Course: Nuclear Order and International Security after Ukraine

This course will take place January 7-14, 2024, at the University of Trento. Learn more and register here.

International Conference, CBRNE Research & Innovation

“Worldwide, researchers, responders and industrial capacities have been commited to provide adapted response to these challenges.”

“Looking forward to your proposals for communication and to welcoming you at Strasbourg in March 2024!”

Learn more here.

cbrne-ri-conference-2024-_-flyer-ppt-v06.11.2023-1 Download

Registration for GHS 2024 Now Open

“Biodefense Budget Breakdown: Data Visualization of U.S. Biodefense Investments”

New from Council on Strategic Risks: “In recent years, U.S. strategies and policies have advanced greatly in addressing biological risks from all sources. We at CSR have marked several areas of progress through writings and analysis: the beginning of a pivot toward pathogen-agnostic approaches, requiring annual exercises on biological risks, and the creation of the Biodefense Council within the Department of Defense, and more…In September, CSR launched a scorecard process to track signs of implementation of stronger U.S. biodefense and biosecurity policies. CSR’s Biodefense Budget Breakdown will accompany the scorecard, tracking trends in resources and investments.”

“Before the launch of this tool, no publicly-accessible resource provided a detailed analysis of the total budget across the federal biodefense enterprise. By creating the Biodefense Budget Breakdown, we hope to provide a robust and user-friendly resource for the government, key stakeholders, and the general public.”

“This tool is intended to provide focused analyses of the biodefense budget, with multiple interfaces to understand and analyze the federal biodefense portfolio. This tool starts with the cumulative U.S. biodefense totals for each fiscal year dating back to 2019, progresses to agency-specific drill-downs, and culminates with a detailed line item index for biodefense budgets across key agencies. This tool reports biodefense investments across three steps in the budget cycle: requested (R), enacted (E), and actual (A) levels of funding.”

Call for Applications: Ecological Security Fellowship

“The Council on Strategic Risks is pleased to announce a call for applications for its Ecological Security Fellowship, a key part of its broader Ecological Security Program.”

“Tackling complex, converging risks arising from ecological degradation requires the development of resilient leaders spanning international, national, state, and local levels. This program will familiarize participants with novel ways of conceptualizing the security risks posed by ecological disruption driven by human activities, climate change, and other stressors. Participants will acquire expertise and build professional development through networking with experts and practitioners in different areas of ecological security.”

Learn more and apply here.

Pandora Report 12.01.2023

December 1, 2023 by dkellogg97, posted in Pandora Report

This week covers a wide range of topics, including chemical weapons, indictments for those involved in running the illegal laboratory in Reedley, CA, and more. Several new publications follow, as well new upcoming events and newly-available resources in the announcement section.

George Mason University’s Biomedical Laboratory Receives $12 Million in Funding from NIH

From GMU: “Farhang Alem, Interim Director of the Biomedical Research Laboratory, Institute for Biohealth Innovation, and Aarthi Narayanan, Professor, Biology, will receive more than $12 million from the National Institute for Health to support development of Mason’s Biomedical Research Laboratory, advancing the university’s research capabilities for infectious diseases.”

“George Mason University’s Biomedical Laboratory (BRL) is one of 12 Regional Biocontainment Laboratories (RBLs) established through the National Institute of Allergy and Infectious Diseases. The BRL offers Biosafety Level 3 (BSL-3) facilities that conduct cutting edge pathogen research and serve as resources to rapidly address emerging infectious disease outbreaks.”

“Funding will support a number of facility improvements including the implementation of a comprehensive BSL-3 facilities preventative maintenance and upgrade plan to ensure continuity of operations, compliance with federal regulations, and a safe and secure facility. Funding will also enhance safety and quality of BSL-3 laboratory practices and create two new research cores in high containment.”

Read more here.

DOD Chemical and Biological Defense Program Celebrates 30th Anniversary

The Department of Defense recently reached the 30-year anniversary of the formation of its Chemical and Biological Defense Program. “Congress created the DOD wide chemical and biological defense program in November 1993, after a government report noted U.S. forces were not sufficiently prepared to address Iraq’s chemical and biological warfare capabilities…Prior to the creation of the program under the Office of the Secretary of Defense, the military services were each responsible for developing their own chemical and biological defense capabilities.”

Read more here.

Syrian Network for Human Rights Statement On the Day of Remembrance For All Victims of Chemical Warfare

The Syrian Network for Human Rights released its statement yesterday on the Day of Remembrance for all Victims of Chemical Warfare, highlighting CW attacks perpetrated by the Assad regime and the ongoing struggle for victims to hold the regime accountable. The statement is available below.

s231115e Download

2023 OPCW-The Hague Award Recipients Announced

OPCW Director-General Amb. Fernando Arias and the Mayor of the Municipality of The Hague, Mr. Jan van Zanen, announced last week the three recipients of the 2023 OPCW-The Hague Award. These recipients are the Spiez Laboratory in Switzerland, Dr. Syeda Sultana Razia at the Bangladesh University of Engineering and Technology, and Mr. Hubert K. Foy at the African Centre for Science and International Security in Ghana.

‘“All three of these recipients have demonstrated that everyone has a role to play in ridding the world of chemical weapons and preventing their re-emergence,” said OPCW Director-General, Ambassador Fernando Arias. “We must together strive to continue to ensure that toxic chemicals are never used as instruments of harm and that our populations are protected.”’

Read more about the recipients and their work here.

NTI, NextGen, iGEM, SynBio Africa, GHSN, and 80,000 Hours Announce Winners of 7th Annual Next Generation for Biosecurity Competition

The winners of the Seventh Annual Next Generation for Biosecurity Competition were recently announced. They are Gupreet Dhaliwal, Ph.D. candidate in Synthetic Biology and Immunology at the University of Cambridge, Askar Kleefeldt, Ph.D. candidate in Synthetic Biology at the MRC Laboratory of Molecular Biology and the University of Cambridge, and Alexandra Klein, Ph.D. candidate in Science, Technology, Engineering and Public Policy at the University College London and research assistant at the Centre for the Study of Existential Risk, University of Cambridge.

“In their winning paper, Biosecurity-By-Design to Safeguard Emerging Bioeconomies: Integrating Biosecurity Considerations into the Full Biotechnology Innovation and Development Pipeline, the team proposes a ‘biosecurity-by-design’ approach to ensure that biosecurity is integrated into every stage of the life science research and development pipeline, especially project conceptualization. The three authors outline a set of recommendations to achieve this goal, including fostering a culture of responsibility among scientific communities through the adoption of the Tianjin Biosecurity Guidelines for Codes of Conduct for Scientists as a global standard in emerging bioeconomies. The authors emphasize the importance of engaging with the private sector and encourage governments to incentivize biosecurity in product design by using levers such as market access regulations or reputational rewards through seals of approval. The authors also propose that States Parties at the Biological Weapons Convention adopt a systematic review mechanism for science and technology to raise awareness of emerging biotechnology risks. Overall, these recommendations aim to make biosecurity an integral part of biotechnology innovation while allowing the bioeconomy to flourish.”

Read more here.

No Cost COVID-19 Tests Available in United States Again

The US Government is once more offering four at-home viral tests delivered via the US Postal Service. Those who did not order any in September can order up to eight of them during this round. Order tests at COVIDtests.gov.

ICYMI: Select Committee on the CCP Releases Report on Reedley Lab, DOJ Announces Indictment of Operator

Last month “Chairman Mike Gallagher (R-WI) of the House Select Committee on the Chinese Communist Party unveiled a report on its investigation into the illegal People’s Republic of China-tied biolab discovered in Reedley, CA. The members were joined by Rep. Jim Costa (D-CA), whose district includes Reedley, CA, Former Speaker Kevin McCarthy (R-CA), Rep. Dan Newhouse (R-WA), and Rep. Neal Dunn (R-FL).”

According to the report, the Committee’s main findings were:

“The illegal biolab was run by a PRC citizen who is a wanted fugitive from Canada with a $330 million Canadian dollar judgment against him for stealing American intellectual property.
This PRC citizen was a top official at a PRC-state-controlled company and had links to military-civil fusion entities.
The illegal biolab received millions of dollars in unexplained payments from PRC banks while running the illegal biolab.
The illegal biolab contained thousands of samples of labeled, unlabeled, and encoded potential pathogens, including HIV, malaria, tuberculosis, and Covid.
The illegal biolab also contained a freezer labeled “Ebola,” which contained unlabeled, sealed silver bags consistent with how the lab stored high risk biological materials. Ebola is a Select Agent with a lethality rate between 25-90%.
The biolab contained nearly a thousand transgenic mice, genetically engineered to mimic the human immune system. Lab workers said that the mice were designed “to catch and carry the COVID-19 virus.”
After local officials who discovered the lab sought help from the CDC and others, the CDC refused to test any of the samples.”

Meanwhile, the Department of Justice announced a three-count indictment against operators of the lab, saying in a press statement “A federal grand jury returned a three-count indictment today against Jia Bei Zhu, aka Jesse Zhu, Qiang He, and David He, 62, a citizen of China who formerly resided in Clovis, charging him with distributing adulterated and misbranded medical devices in violation of the federal Food, Drug, and Cosmetic Act and for making false statements to the Food and Drug Administration (FDA), U.S. Attorney Phillip A. Talbert announced.”

“According to court documents, between January 2020 and March 2023, through the companies Universal Meditech Incorporated (UMI) and Prestige Biotech Incorporated (PBI), Zhu sold hundreds of thousands of COVID-19 test kits to companies throughout the United States. UMI and PBI were based in Fresno and Reedley and did not obtain pre-market approval, pre-market clearance, emergency use authorization, or other applicable exemption from the FDA as was required. UMI and PBI received millions of dollars for the sales of the test kits.”

“When questioned by FDA officials, Zhu made several false statements to them, including that (1) his name was Qiang “David” He, (2) he was hired by UMI as a COVID-19 consultant in 2021, (3) he was hired by PBI just a couple of weeks prior to meeting with the FDA to communicate with government agencies on PBI’s behalf, and (4) he did not know anything about the manufacturing or distribution histories for UMI or PBI.”

“This case is the product of an investigation by the FDA Office of Criminal Investigations with assistance from the Federal Bureau of Investigation and the California Department of Public Health – Food and Drug Branch. Assistant U.S. Attorneys Joseph D. Barton, Arelis M. Clemente, and Henry Z. Carbajal III are prosecuting this case.”

“Why AI-Assisted Bioterrorism Became a Top Concern for Open AI and Anthropic”

Louise Matsakis covers the now constant concern about the potential for AI to aid in bioterrorism, explaining in her introduction “In the spring of 1995, U.S. lawmakers were becoming concerned that material uploaded to the nascent internet might pose a threat to national security. The Oklahoma City bombing had happened several weeks earlier, drawing attention to publications circulating online like The Big Book of Mischief, which included instructions on how to build homemade explosives.”

“Worried the information could be used to orchestrate another attack, then-Senator Dianne Feinstein pushed to make publishing bomb recipes on the internet illegal. The effort sparked a national debate about “Open Access vs. Censorship,” as one newspaper headline put it at the time.”

“Nearly 30 years later, a similar debate is now unfolding about artificial intelligence. Rather than DIY explosives, some U.S. officials and leading AI companies say they are increasingly worried that large language models could be used to develop biological weapons. The possibility has been repeatedly cited as one reason to be cautious about making AI systems open source.”

Matsakis interviewed George Mason’s Sonia Ben Ouagrham-Gormley as well in writing this piece, writing ‘“With new technologies, we tend to project in the future as though their development was linear and straightforward, and we never take into consideration the challenges and the contingencies of the people using them,” said Sonia Ben Ouagrham-Gormley, an associate professor at George Mason University who has interviewed former scientists in both the U.S. and Soviet Union’s now-defunct biological weapons programs.”

And later: “Ben Ouagrham-Gormley said her research has shown that achieving each of these steps requires employing different, highly-trained experts, including people who specialize in the exact type of pathogen being used. An AI model might be able to replace some of their work in the future, but she argued it can’t replicate the hands-on wisdom that comes from working in a laboratory.”

‘“This kind of tacit knowledge exists everywhere, but in the bio field, it’s really important because of the fragility of the raw material,” Ben Ouagrham-Gormley said.”

“Artificial Intelligence and Synthetic Biology Are Not Harbingers of Doom”

David Bray provides an optimistic outlook on the potential of AI and synthetic biology in this policy memo for the Stimson Center. Bray writes, “Contrary to many people’s fears, artificial intelligence (AI) can be a positive force in advancing biological research and biotechnology. The assumption that AI will super-empower the risks that already exist for the misuse of biotech to develop and spread pathogens and fuel bioterrorism misses three key points. First, the data must be out there for either an AI or a human to use it. Second, governments stop bad actors from using bio for nefarious purposes by focusing on the actors’ precursor behaviors. Third, given how wrong large language models (LLMs) often are and their risk of hallucinations, any would-be AI intended to provide advice on biotech will have to be checked by a human expert. In contrast, AI can be a positive force in advancing biological research and biotechnology — and insights from biology can power the next wave of AI for the benefit of humankind. Private and public-sector leaders need to make near-term decisions and actions to lay the foundation for maximizing the benefits of AI and biotech. National and international attention should focus on both new, collective approaches to data curation and ensuring the right training approaches for AI models of biological systems.”

“Going Viral: Bioeconomy Defense”

This report from Johns Hopkins’ Applied Physics Lab summarizes the findings of a May tabletop exercise:

“The May tabletop exercise at APL revealed four key areas of action to ensure a safe and secure bioeconomy.

Trust in lab equipment performance and data is foundational to the bioeconomy. Recommendations include developing digital security standards for lab equipment, hardening waypoints at each step in the data life cycle, and introducing a system of tiered levels of compliance.

Awareness of vulnerabilities, cyber and physical, and the steps for prevention and intervention are needed. Recommendations include additional exercises to strengthen intra-agency coordination and training and extending this activity to private sector companies.

Responsibility for responding to threats in the bioeconomy, and the roles for each team member, need to be defined with a process workflow, using a shared responsibility model, and teams need regular training opportunities to practice.

Preparedness is lacking, and threat-mitigation strategies specific to the bioeconomy need to be identified, tested and distributed. The exercise pushed the limits of participants’ traditional threat-mitigation strategies and identified the need for assessments of critical infrastructure and functions, cross-domain training, and the establishment of policies and procedures for an inter-agency group to rapidly respond to threats.”

“Security Considerations At the Intersection of Engineering Biology and Artificial Intelligence”

New from the Engineering Biology Research Consortium: “This white paper describes three areas at the intersection of engineering biology and artificial intelligence that may yield significant security concerns: de novo biological design, closed-loop autonomous laboratories, and natural language Large Language Models. It describes each area, identifies potential security concerns, and offers ideas for the potential mitigation of those concerns, ultimately calling for an international forum to continually address this evolving issue.”

“Pascale Ferrier and the Threat of Bioterror”

Markus K. Binder recently published this piece in NCT’s CBNW: “Drawing upon the START CBRN Data Suite and other research, Markus Binder considers the five ricin bio-attacks directed at the U.S. President and other officials that have taken place since 2013 to assess what, if anything, they can tell us about bioterrorism.”

“Americans’ Trust in Scientists, Positive Views of Science Continue to Decline”

New work from the Pew Research Center has found that “…the share of Americans who say science has had a mostly positive effect on society has fallen and there’s been a continued decline in public trust in scientists.”

“Overall, 57% of Americans say science has had a mostly positive effect on society. This share is down 8 percentage points since November 2021 and down 16 points since before the start of the coronavirus outbreak.”

“About a third (34%) now say the impact of science on society has been equally positive as negative. A small share (8%) think science has had a mostly negative impact on society.”

Read the report here.

“A Systematic Review Of COVID-19 Misinformation Interventions: Lessons Learned”

Smith et al. recently published this article with Health Affairs: “Governments, public health authorities, and social media platforms have employed various measures to counter misinformation that emerged during the COVID-19 pandemic. The effectiveness of those misinformation interventions is poorly understood. We analyzed fifty papers published between January 1, 2020, and February 24, 2023, to understand which interventions, if any, were helpful in mitigating COVID-19 misinformation. We found evidence supporting accuracy prompts, debunks, media literacy tips, warning labels, and overlays in mitigating either the spread of or belief in COVID-19 misinformation. However, by mapping the different characteristics of each study, we found levels of variation that weaken the current evidence base. For example, only 18 percent of studies included public health–related measures, such as intent to vaccinate, and the misinformation that interventions were tested against ranged considerably from conspiracy theories (vaccines include microchips) to unproven claims (gargling with saltwater prevents COVID-19). To more clearly discern the impact of various interventions and make evidence actionable for public health, the field urgently needs to include more public health experts in intervention design and to develop a health misinformation typology; agreed-upon outcome measures; and more global, more longitudinal, more video-based, and more platform-diverse studies.”

“Coffee As a Dietary Strategy to Prevent SARS-CoV-2 Infection”

Wu et al.‘s recent article in Cell & Bioscience offers further validation for coffee drinkers (as if we needed it): “Background: To date, most countries lifted the restriction requirement and coexisted with SARS-CoV-2. Thus, dietary behavior for preventing SARS-CoV-2 infection becomes an interesting issue on a daily basis. Coffee consumption is connected with reduced COVID-19 risk and correlated to COVID-19 severity. However, the mechanisms of coffee for the reduction of COVID-19 risk are still unclear.”

“Results: Here, we identified that coffee can inhibit multiple variants of the SARS-CoV-2 infection by restraining the binding of the SARS-CoV-2 spike protein to human angiotensin-converting enzyme 2 (ACE2), and reducing transmembrane serine protease 2 (TMPRSS2) and cathepsin L (CTSL) activity. Then, we used the method of “Here” (HRMS-exploring-recombination-examining) and found that isochlorogenic acid A, B, and C of coffee ingredients showed their potential to inhibit SARS-CoV-2 infection (inhibitory efficiency 43–54%). In addition, decaffeinated coffee still preserves inhibitory activity against SARS-CoV-2. Finally, in a human trial of 64 subjects, we identified that coffee consumption (approximately 1–2 cups/day) is sufficient to inhibit infection of multiple variants of SARS-CoV-2 entry, suggesting coffee could be a dietary strategy to prevent SARS-CoV2 infection.”

“Conclusions: This study verified moderate coffee consumption, including decaffeination, can provide a new guideline for the prevention of SARS-CoV-2. Based on the results, we also suggest a coffee-drinking plan for people to prevent infection in the post-COVID-19 era.”

“WHO: ‘Collective Action’ Needed to Effectively Reduce Antimicrobial Resistance”

CIDRAP’s Chris Dall covers WHO officials’ answers to questions about AMR in this piece written in recognition of World AMR Awareness Week. Dall explains “Encouraging the medical community, world leaders, and other stakeholders to do their part in staving off that grim future is one of the goals of World AMR Awareness Week, a global campaign of the World Health Organization (WHO) this week aimed at raising public awareness and promoting practices that help mitigate the threat posed by drug-resistant infections…CIDRAP News recently submitted a series of questions to WHO officials about the themes of this year’s World AMR Awareness Week, their assessment of the progress that countries have made in addressing AMR, and the challenges that lay ahead. Responses were provided by Sarah Sheppard, the WHO’s communications lead for Medicines, Health Products & AMR.”

“The World’s Chemical-Weapons Stockpiles Are Gone – But a New Challenge Looms”

Peter J. Hotchkiss, science policy adviser to the OPCW’s Scientific Advisory Board, recently published this World View piece with Nature. He explains in part, “In 2019, the OPCW’s 193 member states decided unanimously, for the first time in history, to add compounds to the schedules, the lists of chemicals that are regulated under the convention. The four entries comprise toxic nerve agents with no known civilian use: three cover phosphorus-based agents (in the ‘novichok family’), and the fourth is a family of carbamates, another kind of nerve agent. The convention already prohibited using these (or any chemical) to intentionally kill or harm people through toxicity. Now, their production, transfer and storage are subject to stringent verification by the OPCW, through declarations and on-site inspections.”

“Yet some states have been reticent to share data on these chemicals with the OPCW. The lack of information on the newly scheduled chemicals is in jarring contrast to what we have on other weapons listed in the convention and on their precursors. To ensure the health and safety of staff members during inspections, the OPCW needs the best understanding of these chemicals’ properties, the types of personal protective equipment and medical countermeasures that are effective against them and the analytical methods for detecting them. These data would also help us to provide the best information and training to all member states, ensuring that they are prepared in the event that any of these chemicals are used as a weapon.”

“29 Morally Bankrupt Governments, Headed by Russia, Voted Against the OPCW’s Resolutions”

The Syrian Network for Human Rights recently released this report “…emphasizing that many states worldwide must bring cases against the Syrian regime before the International Criminal Court (ICC) over the regime’s repeated violations of the Chemical Weapons Convention (CWC).”

“In the 15-page report, SNHR notes that the Syrian regime has carried out 184 chemical attacks since ratifying the Convention in September 2013. The report outlines the decisions adopted by the Organization for the Prohibition of Chemical Weapons (OPCW), identifying the states that voted against those decisions, or in other words the states that support the continuation of the Syrian regime’s chemical weapons program. Through this action, it notes, these states are, in effect, encouraging the regime to use weapons of mass destruction – chemical weapons – and emboldening it to carry out more chemical weapons attacks against the Syrian people.”

“Scientific Experts Provide Key Recommendations on Biotoxin Analysis to the OPCW”

“The Scientific Advisory Board (SAB) of the Organisation for the Prohibition of Chemical Weapons (OPCW) endorsed a report outlining key recommendations on biotoxin analysis and investigations of their alleged use as weapons submitted by a SAB Temporary Working Group (TWG) earlier this year.”

“Biotoxins are toxic chemicals produced by living organisms, which vary widely in properties such as structure, size, and mechanisms of toxicity. Some biotoxins can be more toxic than traditional nerve agents. There are two biotoxins subject to stringent verification measures under the Chemical Weapons Convention – ricin and saxitoxin – with many others also posing safety and security concerns.”

“The risk of misuse of biotoxins as weapons requires the OPCW to be prepared to conduct various investigations and missions related to their alleged use. To ensure the Organisation’s readiness to do so, the TWG’s report makes critical recommendations to the OPCW…”

Read more here.

“2023 Catalogue of Civil Society Activities Supporting the Chemical Weapons Convention”

The Stimson Center recently released its 2023 Catalogue of Civil Society Activities Supporting the Chemical Weapons Convention, “a catalogue of civil society capacity-building, assistance, and/or research programs supporting the Chemical Weapons Convention (CWC). The catalogue highlights all interested parties, including the CWC States Parties, the Organisation for the Prohibition of Chemical Weapons (OPCW), the Global Partnership Against the Spread of Weapons and Materials of Mass Destruction, international organizations, and industry stakeholders, civil society’s contributions to strengthen reducing the threat of chemical weapons and promoting the peaceful use of chemistry. By providing a uniform product, interested parties will be able to easily identify programs, experts, and organizations that support the CWC and related chemical weapons nonproliferation instruments.”

“Emerging and Re-Emerging Chemical Threats (Part 2)”

MRIGlobal continues their discussion of CW threats with “Chemical Threats on the Battlefield and Home Front” in this blog post, explaining in part “Today’s conflicts around the world highlight the current and pressing need for continued research to help ensure the safety of anyone in danger. And though we touched on “Emerging and Re-emerging Chemical Threats” earlier in the year, because emerging and re-emerging chemical threats pose an ever-present challenge to both warfighters and civilians, we are revisiting the topic to share additional expertise. To learn more, we visited with Cristina Youngren and Evan Durnal, subject matter experts in MRIGlobal’s Integrated Defense Solutions division.”

“What Does a French Arrest Warrant Mean for Normalization With Assad?”

Julia Neumann discusses what France’s arrest warrants for Bashar al-Assad and several associates mean in practice and for regional normalization in this piece for Syria Direct.

“Why Cheap Drones Pose a Significant Chemical Terrorism Threat”

Zachary Kallenborn recently published this piece with The Bulletin of the Atomic Scientists, writing in part “Relatively cheap drones are becoming a mainstay of conflicts, from the war in Ukraine to the Israel-Hamas conflict in Gaza. Though drones were once the purview of rich and powerful militaries, it’s now possible to use cheap consumer drones in battle. With a few tweaks, they can whistle past even sophisticated air defenses. As Al-Bared’s case highlights, they may also present a significant chemical terrorism threat. Drones can be equipped with sprayers to deliver chemical weapons, or they could be used in an attack on a chemical plant. They could also provide critical attack support, helping with reconnaissance to plan out and conduct an attack, monitor law enforcement response, and create propaganda to highlight terrorist activities.”

“Stanford Emerging Technology Review: Reporting on Key Technology Areas and Their Policy Implications”

“Emerging technologies are transforming societies, economies, and geopolitics. This moment brings unparalleled promise and novel risks. In every era, technological advances buoy nations that develop and scale them—helping to save lives, win wars, foster greater prosperity, and advance the human condition. At the same time, history is filled with examples where slow-moving governments stifled innovation in ways policymakers never intended, and nefarious actors used technological advances in ways that inventors never imagined. Technology is a tool. It is not inherently good or bad. But its use can amplify human talent or degrade it, uplift societies or repress them, solve vexing challenges or exacerbate them. These effects are sometimes deliberate but often accidental.”

“The stakes of technological developments today are especially high. Artificial intelligence (AI) is already revolutionizing industries, from music to medicine to the military, and its impact has been likened to the invention of electricity. Yet AI is just one among many technologies that are ushering in profound change. Fields like synthetic biology, materials science, and neuroscience hold potential to vastly improve health care, environmental sustainability, economic growth, and more. We have experienced moments of major technological change before. But we have never experienced the convergence of so many technologies with the potential to change so much, so fast.”

“The Stanford Emerging Technology Review (SETR) is the first product of a major new Stanford technology education initiative for policymakers. Our goal is to help both the public and private sectors better understand the technologies poised to transform our world so that the United States can seize opportunities, mitigate risks, and ensure that the American innovation ecosystem continues to thrive.”

ICYMI: FBI Director Statement Before the House Committee on Homeland Security

FBI Director Christopher Wray delivered this statement to the House Committee on Homeland Security last month, highlighting the work of his agency across several mission areas, including emerging technologies and counter WMD. Wray explained in part of this statement that, “In addition to fighting terrorism, countering the proliferation of weapons-of-mass-destruction materials, technologies, and expertise, preventing their use by any actor, and securing nuclear and radioactive materials of concern are also top national security priority missions for the FBI. The FBI considers preventing, mitigating, investigating, and responding to weapons of mass destruction (“WMD”) terrorism a “no-fail” mission because a WMD attack could result in substantial injuries, illness, or loss of lives, while yielding significant social, economic, political, and other national security consequences. In collaboration with federal, state, local, tribal, territorial, and other partners, the FBI integrates complementary efforts to counter WMD terrorism. An example of this collaboration is the FBI-led Weapons of Mass Destruction Strategic Group. This interagency crisis action team spans more than 15 departments and agencies to coordinate the federal government’s response to WMD threats and incidents. Alongside the FBI, the Department of Homeland Security maintains the largest footprint on the strategic group.”

Read the full statement here.

NEW: Looking Ahead in Ukraine: What Could Increase the Risk of Escalation?

“As U.S. lawmakers debate the question of continued defense and humanitarian aid to Ukraine, the Ukrainian fight to expel Russian invaders continues with no end in sight. The stalemate on the front lines in Ukraine masks continued intense fighting and demands for resources on both sides that may drive longer-term changes—on the battlefield, inside Russia, and beyond. This could lead to further escalation, including the potential to turn the conflict into a wider war. Understanding which circumstances and policies may risk escalation in Ukraine is paramount: not only are decisions about supporting Ukraine critical to the long-term trajectory of the conflict but also the United States confronts a broad set of challenges across the globe.”

“Please join RAND’s National Security Research Division on Tuesday, December 5, 2023, 9:30 – 11:00 am ET, for a moderated panel discussion about which circumstances or policies may risk escalation in Ukraine—either deliberate or inadvertent—and the potential triggers and restraining factors likely to shape Russian escalation decisions in particular.”

“Missy Ryan, a national security reporter at the Washington Post, will moderate the discussion.”

Learn more and register here.

NEW: Threat Agnostic Biodefense Webinar: Assessing the Zoonotic Risk of Pre-Emergent Viruses

From PNNL: “Exploration of the “virosphere” is in its golden age. The sheer number of new viruses discovered daily, and the fact that most cannot be cultured, creates enormous uncertainty about where to allocate attention and resources. It is not an intractable problem, however, to distinguish those few viruses that are likely to emerge as zoonoses from the many others that are not. This talk describes two diametric approaches to addressing this problem. The first approach involves a field-to-lab investigative methodology that, when combine with biologically informed predictive computational models, can assess the zoonotic risk of viruses that have not yet been identified in humans. The second approach relies on the power of modern methods in anthropology and ethnography to identify zoonotic transmission pathways, even before the identification of any pathogens that might traverse those pathways. A unifying example is simian hemorrhagic fever virus and its relatives in the family Arteriviridae, which cause important animal diseases but have never been documented to infect humans. Both approaches identify these viruses as high-risk pre-emergent zoonoses.”

Learn more and register for this December 6 event here.

NEW: Bio & Beer

“As a rising global leader in the bioeconomy, investments in the future STEM workforce are critical in order to secure the U.S.’s position as a world resource for biohealth technology and innovations. Join us and our three guest speakers as we discuss the importance of a diverse, skilled STEM workforce to address rapidly increasing industry demand. We will also talk about training and other opportunities designed to prepare individuals for STEM careers. Enjoy an evening of networking, drinks, and fun!”

Learn more and RSVP here.

Meeting the Moment: Biodefense Policy, Procurement, and Public Health

From the Bipartisan Commission on Biodefense: “As the Nation continues to endure the consequences of recent pandemics, and with continued interest in biological weapons by nation states and other enemies, the federal government has an opportunity to address vulnerabilities in the biodefense enterprise. At this meeting, titled Meeting the Moment: Biodefense Policy, Procurement, and Public Health, the Commission intends to further explore : (1) biodefense policies and activities at the Department of Defense; (2) federal stockpile evaluation and decision-making for smallpox medical countermeasures; (3) needed authorities of the Department of Health and Human Services, including the Centers for Disease Control and Prevention; and (4) biodefense leadership.”

This meeting will take place on December 5, from 10:30 am until 4 pm ET. Register here.

2023 EPA International Decontamination Research and Development Conference-“Advancing Preparedness through Science and Collaboration”

“The clean-up of chemical, biological, or radiological (CBR) contamination incidents and natural disasters is a critical challenge for the United States. Understanding how to characterize and remediate affected areas of environmental contamination and waste is necessary for daily life to return.”

“The Decon Conference is designed to facilitate presentation, discussion, and further collaboration of research and development topics focused on an all-hazards approach to remediate contaminated indoor and outdoor areas, critical infrastructure, water distribution systems, and other environmental areas/materials.”

“This conference is free and open to the public. Content and presentations are geared towards the emergency response community, including local and state emergency managers, homeland security officials, first responder coordinators, private sector industry, risk managers, educators in the field of emergency management, and others.”

This event will take place December 5-7 in Charleston, SC. Learn more and register here.

Mitigating Arboviral Threats and Strengthening Public Health Preparedness

This event will take place on December 12 and 13. Learn more here.

Presidential Advisory Council on Combating Antibiotic-Resistant Bacteria (PACCARB) Virtual Meeting

This virtual meeting will take place on December 20 from 9-4 EST. Learn more here.

61st ISODARCO Course: Nuclear Order and International Security after Ukraine

This course will take place January 7-14, 2024, at the University of Trento. Learn more and register here.

International Conference, CBRNE Research & Innovation

“Worldwide, researchers, responders and industrial capacities have been commited to provide adapted response to these challenges.”

“Looking forward to your proposals for communication and to welcoming you at Strasbourg in March 2024!”

Learn more here.

cbrne-ri-conference-2024-_-flyer-ppt-v06.11.2023-1 Download

Registration for GHS 2024 Now Open

Council on Strategic Risks Launches the Nuclear Weapon Systems Project

“How states view the roles and relevance of nuclear weapons is changing. While these perspectives have been dynamic since the dawn of the atomic age, the changes occurring today and drivers of these changes are particularly worrisome—in particular given that they seem to be on the cusp of reversing a period heavily characterized by arms control agreements, reductions in global arsenals, and advances in international cooperation to reduce nuclear weapons risks.”

“CSR’s core nuclear policy work to address this challenging time has focused largely on qualitative approaches to reducing the risks of nuclear miscalculations, uses of these weapons, arms racing behavior, and other dangerous trends. Going beyond numbers of weapons—which has been a major policy focus given numerical limitations in past nuclear treaties—a qualitative view of the nuclear weapons landscape is done through the lens of the nuclear capabilities nations seek, and associated policies and postures. This can help to show where multiple nations might find areas for potential cooperation that would be mutually beneficial. It can also help to show where nations currently possess the capabilities they claim to need, and thereby in what ways cooperative or unilateral measures of restraint are the most appropriate.”

“In order to facilitate this work by CSR and by others, we are launching The Nuclear Weapon Systems Project to help visualize how the types of nuclear capabilities fielded in the world have evolved since the advent of these weapons.”

“This project seeks to document and characterize every deployed nuclear weapons system that NPT-recognized nuclear states have developed in history. More than just a list of bombs, missiles, and artillery shells, the resulting dataset illustrates a complex story of risks, strategies, and lessons learned—and lost. We consider this data to be a living resource, and encourage outside contributions and feedback.”

Read more here.

“Georgetown Global Health Center Launches First Open-Access Wildlife Disease Database”

Georgetown University Medical Center’s Center for Global Health Science and Security recently announced “the launch of a first-of-its-kind wildlife disease database — a system for collecting records of viruses, bacteria, fungi, parasites, etc. — designed to support an early warning system for potential viral emergence. The Pathogen Harmonized Observatory, or PHAROS, is open to the global community and free to access.”

“Scientists in GHSS’ Verena program, a collaborative institute comprising a global team of scientists, designed PHAROS to advance research and education around viral emergence — the process of viruses jumping from animals to humans. Verena co-founder and director Colin Carlson, PhD, says most platforms designed to track diseases in wild animals are very limited and are developed only in response to a major outbreak, such as birds dying off suddenly due to avian flu.”

‘“Our goal is to build a data sharing system that lets us eventually predict pandemics like the weather,” Carlson says. “When we collect data on wildlife viruses, it gets published in journals and then lost forever, because it isn’t ever standardized or compiled. After COVID, there’s no excuse to keep working that way.”’

Texas A&M Research Assistant Professor (Pandemic Preparedness/Biosecurity) Openings

Texas A&M University’s Scowcroft Institute of International Affairs is seeking up to two Research Assistant Professors with expertise in pandemic preparedness and/or biosecurity. The Research Assistant Professor will be in the Scowcroft Institute of International Affairs, Bush School of Government & Public Service, and will work with the Pandemic Preparedness & Biosecurity Policy Program. Responsibilities include teaching graduate courses, conducting research, and writing policy-relevant publications on biosecurity, global health security, bio and agro-defense, federal life sciences policy, one health, biotechnology, or related policy topics.

Learn more and apply here.

Pandora Report 4.21.2023

April 21, 2023April 21, 2023 by dkellogg97, posted in Pandora Report

This week is another mixed bag highlighting recent alumni achievements and program happenings, discussing the release of annual State Department reports on global compliance with the NPT, CWC, and BWC, and Senate Republicans’ latest report on the origins of SARS-CoV-2. Several new publications and upcoming events are included, as well as open calls for experts and fellowship opportunities.

Fairfax County Health Department Recognizes Mason for Pandemic Response

Recently, “George Mason University was recognized by the Fairfax County Health Department (FCHD) for being an outstanding system partner in managing and operationalizing the university’s pandemic planning, response, and recovery. The partnership, which began long before the COVID-19 pandemic, has been vital in enhancing the health and well-being of the shared communities.”

The same piece announcing this interviewed a Biodefense PhD alumna, Julie Zobel, who is currently associate vice president of Safety, Emergency, and Enterprise Risk Management and Mason’s COVID director-“Julie Zobel…expressed her gratitude for the partnership between Mason and FCHD. “We are honored to have worked alongside the Fairfax County Health Department to serve our community during these challenging times,” said Zobel. “The success of our pandemic response would not have been possible without this partnership. We look forward to continuing our collaboration and commitment to public health”’

Pathogens Project Convenes Meeting in Geneva

The initiative on “Creating the Framework for Tomorrow’s Pathogen Research” hosted a public meeting in Geneva, Switzerland this week. This conference included Pathogens Project taskforce members, policy leaders, journalists, scientists, and civic leaders, among others.

The conference featured both private and public (recorded) workshops. Furthermore, according to the Project’s site, “It will produce a final summary report with recommendations, along with individually prepared papers focused on risk assessment and mitigation of high-risk pathogen research. Conference papers will be published in a special edition of the Bulletin of the Atomic Scientists and made available on the Bulletin’s website.”

Biodefense Graduate Program Director Dr. Gregory Koblentz was on a panel at the event, “Empirical studies tracking risks”, alongside Dr. Rocco Casagrande (Founder and Chair of the Board, Gryphon Scientific), Dr. Weiwen Zhang (Distinguished Professor of Synthetic Biology and Biochemical Engineering, Tianjin University of China), and Dr. Sandra López-Vergès (Senior Health Researcher and Chief, Gorgas Memorial Institute of Health Sciences). Koblentz discussed ongoing work from the Global BioLabs project, which he co-leads with Dr. Filippa Lentzos of King’s College London. Global BioLabs offers an interactive map of BSL-4 and BSL-3+ facilities globally and recently released Global BioLabs Report 2023.

Biodfense Graduate Program Director Dr. Gregory Koblentz on the “Empirical studies tracking risks” panel

Visit https://www.globalbiolabs.org/ to access this interactive map feature

State Department Releases Arms Control, Nonproliferation, and Disarmament Compliance Reports

The State Department’s Bureau of Arms Control, Verification, and Compliance recently released the 2023 Annual Report on Compliance with the Chemical Weapons Convention (CWC) and the 2023 Adherence to and Compliance with Arms Control, Nonproliferation, and Disarmament Agreements and Commitments Report. The latter notes BWC compliance issues in the People’s Republic of China, Islamic Republic of Iran, Democratic People’s Republic of Korea, and the Russian Federation. This includes discussion of the lack of information needed to assess if China has eliminated its BW program, concerns about Iran’s ability to produce lethal BW agents, knowledge of North Korea’s BW program, and Russia’s violations of Articles I and II of the BWC.

The report also notes concerns about lack of transparency in Myanmar’s nuclear work (though evidence does not indicate that the country violated the NPT). The appended report on CWC compliance discusses further concerns with Myanmar and other countries’ compliance with the treaty. The report explains that “Four States Parties – Burma, Iran, Russia, and Syria – are certified in non-compliance with the CWC. Russia and Syria were first certified in non-compliance in April 2018. Iran was first certified in non-compliance in November 2018. Burma was first certified in non-compliance in 2019. Additional information is available in the 2023 classified Condition (10)(C) Reports. The United States also cannot certify the People’s Republic of China’s compliance, which was first reported in 2021.”

Dr. Gregory Koblentz and Madeline Roty (Biodefense MS ’21) authored a piece in the Bulletin of the Atomic Scientists in 2020 discussing Myanmar’s past with CW and US efforts to get the country to reconcile and come into compliance with the CWC. Following the 2021 coup d’état and the ouster of Aung San Suu Kyi, Myanmar is unlikely to meet the requirements needed to be in compliance, despite the progress outlined by Koblentz and Roty.

Senate Republicans Release COVID Origins Report

Senate Republicans have released their report exploring the origins of the COVID-19 pandemic, building on the short interim report released in October 2022. Two documents titled “Muddy Waters: The Origins of COVID-19” were released; one by the Muddy Waters Group and another prepared by Senator Roger Marshall alongside Dr. Bob Kadlec, Bob Foster, and members of the 117th GOP Health, Education, Labor & Pensions (HELP) Committee’s staff. The report was a product of the work of former Senator Richard Burr of North Carolina, who commissioned the report and oversaw the release of the October HELP committee interim report. Readers may recall the controversy that accompanied the release of that interim report, which coincided with the release of articles by Vanity Fair and ProPublica that were widely criticized for poor quality translations and other inaccuracies we discussed in November.

That troubled trend seems to continue in this new report, with admitted circumstantial evidence used to find that “The preponderance of information affirms the plausibility of a research-related incident that was likely unintentional resulting from failures of biosafety containment during vaccine-related research.”

Axios explains that the report “…argues that scientists haven’t found any naturally occurring viruses with the same composition of the coronavirus, and that there’s evidence the virus was circulating in Wuhan before the first known cases connected to the wet market were reported…It also argues that it appears Chinese researchers began development of at least two COVID vaccines in November 2019, including at the WIV, which “means SARS-CoV-2 would have been present at the WIV before the known outbreak of the pandemic,” and “It also documents numerous instances of lab safety concerns throughout 2019, including around the time when the virus may have first appeared.”

Much of this, however, relies on the same previously disputed points made in the interim report and the accompanying ProPublica and Vanity Fair pieces. Furthermore, as Caitlin Owens highlights in another piece for Axios, the reports rely on circumstantial evidence which means “The absence of evidence pointing, for example, to a precise transmission route from animals to humans will lead to very different interpretations of the same information.”

Dr. Angela Rasmussen, a virologist who has worked on high-profile studies supporting the idea of a natural origin of SARS-CoV-2 told Owens that the report “…demonstrates, in my view, a political agenda that’s meant to bolster the idea that the lab leak hypothesis is more supported than it is. But also it is so full of just factual errors.” Rasmussen also counters a number of key assertions made in the new report, including those such as the presence of a furin cleavage site on SARS-CoV-2’s spike protein is in itself suspicious and that the Wuhan Institute of Virology was dealing with substantial biosafety problems that Party leadership was concerned about.

All told, this report seems unlikely to change much or anything in this ongoing public debate.

Understanding Cyber-Warfare: Politics, Policy and Strategy

Chris Whyte and Brian Mazanec (a Biodefense PhD alumnus) are pleased to announce the publication of the second edition of their textbook Understanding Cyber-Warfare: Politics, Policy and Strategy (Routledge, 2023). This second edition of their popular textbook offers an accessible introduction to the historical, technical, and strategic context of global cyber conflict. The second edition has been revised and updated throughout, with three new chapters, to include coverage of the role of cyber in the war in Ukraine as well as a discussion of the role of emerging information technologies like artificial intelligence and quantum computing in shaping the dynamics of global cyber conflict. The second edition has recieved positive reviews. For example James R. Clapper, the former Director of National Intelligence, called it “an authoritative tutorial on the arcane complexities of cyber warfare” and said this edition “updates a previous version and makes the book more contemporary. It is a must-read for those who are serious about mastering this unique medium of combat, in all its dimensions.” More details can be found here.

“Artificial Intelligence and Machine Learning for Bioenergy Research: Opportunities and Challenge”

New from the US Department of Energy’s Genomic Science Program: “The integration of artificial intelligence and machine learning (AI/ML) with automated experimentation, genomics, biosystems design, and bioprocessing represents a new data-driven research paradigm poised to revolutionize scientific investigation and, particularly, bioenergy research. To identify the opportunities and challenges in this emerging research area, the U.S. Department of Energy’s (DOE) Biological and Environmental Research program (BER) and Bioenergy Technologies Office (BETO) held a joint virtual workshop on AI/ML for Bioenergy Research (AMBER) on August 23–25, 2022.”

“Approximately 50 scientists with various expertise from academia, industry, and DOE national laboratories met to assess the current and future potential for AI/ML and laboratory automation to advance biological understanding and engineering. They particularly examined how integrating AI/ML tools with laboratory automation could accelerate biosystems design and optimize biomanufacturing for a variety of DOE mission needs in energy and the environment.”

The report describing the workshop findings is now available here.

“The Making of a Biosafety Officer”

David Gillum discusses the roles of biosafety professionals in this piece for Issues in Science and Technology, writing in part “The question of how the biosafety community generates and transmits knowledge is interesting in itself, but it is also an urgent issue. The need for biosafety workers is growing just as current professionals are skewing older: an estimated 54% are over 50 and one of the few surveys of the field suggests there are six times as many biosafety officers over 70 as there are under 30. Preparing more of us—and keeping the public safe as the complexity of biological research, health, and manufacturing projects burgeons—is made more difficult by the importance of tacit knowledge in our education. Methods for understanding, communicating, and mitigating risk are difficult to transfer to others. To enhance public health and safety, people in my line of work should ease this transfer by considering how the profession might be standardized and formalized.”

“Viral Families and Disease X: A Framework for U.S. Pandemic Preparedness Policy”

In this policy brief for the Center for Security and Emerging Technology, Schuerger et al. explain that “Pandemic threats are increasing as globalization, urbanization, and encroachment on animal habitats cause infectious outbreaks to become more frequent and severe. It is imperative that the United States build a pipeline of medical countermeasure development, beginning with basic scientific research and culminating in approved therapies. This report assesses preparedness for families of viral pathogens of pandemic potential and offers recommendations for steps the U.S. government can take to prepare for future pandemics.”

“Integrating Public and Ecosystem Health to Foster Resilience: Proceedings of a Workshop”

“Ecosystems form the foundation upon which society can survive and thrive, providing food, water, air, materials, and recreation. The connections between people and their environments are under stress from human-driven climate change, pollution, resource exploitation, and other actions that may have implications for public health. Existing intellectual frameworks including One Health, Planetary Health, ecosystem services, and nature-based solutions help to connect different elements related to the resilience of public health and ecological health systems. However, because of the breadth of this issue, many implications regarding public health are not well characterized, leading to gaps in understanding the interconnections between public health and ecosystem health systems and how ecosystem resiliency may affect public health.”

“The National Academies of Sciences, Engineering, and Medicine held a workshop in September 2022 focused on the integration of public and ecosystem health to foster resilience. This workshop was designed to inform the development of a research agenda aimed at bridging the knowledge-to-action gap and spur a move from research to policy and practice. Participants included a broad range of interdisciplinary researchers and practitioners from the public health, natural resource management, and environmental protection communities. The workshop provided a forum for the exchange of knowledge, discussion of critical gaps in understanding and practice, and identification of promising research that could support the development of domestic and international policy and practice.”

“The proceedings summarizing the workshop is now available for free download, and a public webinar exploring the workshop topics will take place virtually in early May. Click below to download the proceedings, register for the webinar, and visit the project page to more about this publication.”

“The Right People and the Right Question: Getting Chemical Weapons Out of Syria”

In this recent video story for the Stanley Center for Peace and Security, Tom Countryman discusses his tenure as the Assistant Secretary of State for Non-Proliferation as the Department navigated concerns about Syria’s chemical weapons. He highlights key lessons learned in doing this, including the need to mind the political context one is operating in, the importance of knowing who the right people are and being able to motivate and mobilize them, appropriately identifying goals and what is needed to achieve them, and, finally, not allowing the difficulties of political relationships to overshadow common interests.

“Reducing the Problem: Eliminating Syria’s Chemical Weapons”

Andy Weber discusses elimination of the Syrian CW stockpile in this video story for the Stanley Center. He covers how he came to be the Assistant Secretary of Defense for Nuclear, Chemical, and Biological Defense Programs and more, saying in part “Sometimes, whether it’s Gaddafi in Libya, or Assad in Syria, it’s unsavory characters, who have these horrific weapons. And you have to work with them sometimes, and it’s hard, and it’s challenging, and you have to keep your eyes open. You need to make sure you’re not indirectly helping them in another area. But that’s where good oversight comes in, and you have to think about the objective of all these programs. The objective is to save lives, to prevent mass casualties in any country, anywhere in the world. These are global programs that improve global security.”

“Armed Conflict and Nuclear Security: Implications for Europe”
Muhammed Ali Alkiş discusses the efficacy of the traditional approach to nuclear security in this recent publication for SIPRI: “The traditional approach to nuclear security is unlikely to be effective against the full spectrum of current threats, including those posed by state actors. The lessons learned from the Russian occupation of Ukrainian nuclear power plants, the potential radiological consequences of armed attacks against nuclear facilities and the potential increase in the number of nuclear power states in the future underscore the need for a strong international framework to address nuclear security challenges.”

“The European Union (EU) is committed to implementing the highest international standards for nuclear security and may therefore be in a position to lead efforts to address threats of armed attacks against nuclear installations. This paper provides a range of potential policy recommendations and actionable steps that the EU and its member states could take at legal, institutional and operational levels to minimize the nuclear security threats posed by armed conflict in the future. While they may appear politically challenging or even unrealistic at present, the conflict in Ukraine highlights the very real need for the types of actions recommended by this paper.”

“Technology Primer: Artificial Intelligence & Machine Learning”

Checkout this new report from the Harvard Belfer Center: “Artificial Intelligence (AI), can be defined as the theory and application of machines—especially computer programs—to perform tasks that typically require human intelligence, such as image captioning and generation, speech recognition and synthesis, natural language understanding and production, tool assembly and utilization, as well as various other perception-action based engagements. AI, in its current technological state, is being applied in various industries and domains, such as online advertising, financial trading, healthcare, pharmaceutical, and robotics. The lucrative market opportunities offered by AI applications have attracted investments from tech giants like Alphabet, Apple, Meta, Amazon, and Microsoft, as well as research universities and startups.”

“Machine Learning (ML), commonly categorized as a subfield of AI, is a field of study concerning the automatic discovery of historical patterns in data using statistical algorithms. ML’s driving principle is that historical patterns are likely to reappear in the future. The discovered historical patterns can therefore be leveraged to make accurate predictions on data that has not been seen before. Once an algorithm is trained, it can be applied to new, larger streams of data. ML is already an integral component of many deployed commercial applications, such as content generation (e.g., text, image, audio, video generation), virtual assistants, social media feed ranking, content recommendation systems, financial market prediction, and healthcare screening and diagnostic tools, as well as administrative applications. In addition, ML is foundational in various other emerging technologies, such as autonomous vehicles and next-generation cybersecurity.”

“Currently, United States policy with regards to AI often derives from interpretations of various pre-existing legislations and legal precedents. However, with the increased awareness of AI-related risks (e.g., bias, accountability, misuse, etc.), and the potential size of their impact, over the last decade, the number of proposed bills containing AI provisions significantly increased at both the state and federal levels (i.e., from two bills in 2012 to 131 in 2021), with 2% of them becoming law at the federal level and 20% of them becoming law at the state level. Similarly, policies and regulatory frameworks are being crafted to guide the development and application of AI in other continents too, with Europe and Asia leading the process. Acknowledging the potential impact of this technology on human life and societal dynamics, there is a pressing need for U.S. legislators and policymakers to remain engaged in the ethical and practical development of artificial intelligence.”

Lessons From the COVID War: An Investigative Report

book-talk-save-the-date Download

The independent, nonpartisan Covid Crisis Group has spent two years investigating the causes and consequences of the COVID-19 pandemic. The Schar School of Policy and Government and Biodefense Graduate Program are proud to host two members of the group, Andrew Kilianski and Melissa Harvey, for an in-depth discussion of the group’s long-awaited report on what went wrong—and right—with America’s response to the pandemic: Lessons from the Covid War: An Investigative Report (Public Affairs, 2023).

The Covid Crisis Group is a remarkable group of 34 distinguished practitioners and scholars from a variety of backgrounds who came together determined to learn and share the most valuable lessons from the worst peacetime catastrophe of modern times. Lessons from the Covid War is plain-spoken and clear-sighted. It cuts through the jumble of information to make some sense of it all and answer: What just happened to us, and why? And crucially, how, next time, could we do better? Because there will be a next time.

Book Event: Open Source Investigations in the Age of Google

From the Center for Strategic and International Studies: “How did a journalist find out who was responsible for bombing hospitals in Syria without leaving his desk in New York? How can South Sudanese activists safely track and detail the weapons in their communities, and make sure that global audiences take notice? What are policy makers, lawyers, and intelligence agencies doing to keep up with and make use of these activities? A team of authors tackle these questions in their new book “Open Source Investigations in the Age of Google.”‘

“This new interdisciplinary book seeks to answer these questions and more, with contributions by prize-winning practitioners, experts, and rising stars from across the open source investigation community. Painting a comprehensive picture of the digital information space today, it explores the manner and methods in which current open source investigations are conducted, as well as examines the opportunities and challenges they present to salient issues to the information environment such as trust and transparency, accountability, justice, amongst others.”‘

“Please join CSIS virtually on April 24, 1-2 pm EDT for a panel discussion on open-source investigations moderated by Diane Cooke, visiting fellow with the International Security Program. The conversation will include Hans Kristensen, Director of the Nuclear Information Project, Federation of American Scientists; Christiaan Triebert, journalist on the New York Times Visual Investigation Team; and Henrietta Wilson, Senior Analyst for the Strategic Concept for the Removal of Arms and Proliferation, SOAS University of London & King’s College London.”

Online Event: Civil Society at the 5th CWC Review Conference

From the CWC Coalition: “The Fifth Five-Year Review Conference (RC-5) for the 1997 Chemical Weapons Convention will be held in the Hague from May 15-19, 2023.”

“At the CWC RevCon, member states and the broader chemical weapons disarmament community will gather to assess past achievements, treaty implementation and compliance, and discuss plans to strengthen the CWC in the years ahead.”

“You are invited to join a virtual discussion on the upcoming Fifth Five-Year CWC Review Conference (RC-5), major issues to be addressed, and the role of civil society and non-governmental organizations.”

“We will be joined by Elisabeth Waechter, Head of Public Affairs at the OPCW. Paul Walker, the Chair of the CWC Coalition, will moderate.”

This event will take place on April 26 at 10 am EST. Register here.

National Biodefense Science Board Public Meeting

The NBSB will meet virtually on May 4 at 2 pm EST to discuss lessons from COVID-19 and will present recommendations on several topics, including collection, analysis, and sharing of operational health data, uses of virtual healthcare during disaster response, and disaster response challenges specific to rural and underserved communities. Register here.

Virtual Workshop: Prioritizing Actions for Epidemic and Pandemic Preparedness

From the National Academies: “Please join us May 4 & 18, 2023 from 8 a.m. to 12 p.m. ET for a virtual symposium examining how to strengthen the evidence-based prioritization of epidemic and pandemic preparedness and response capabilities.

The symposium will convene global health planning stakeholders, including those in government and academia, and across health- and non-health sectors to:

Review assessment tools and how, independently and together, they relate to national action planning.
Gain insight into how countries and organizations currently select priorities in funding for epidemic prevention, detection, and response.
Assess evidence for effective prioritization approaches to building disease surveillance and risk communication capabilities.
Identify governance structures that can support robust and reliable systems for epidemic and pandemic preparedness and response investments.

This symposium is in collaboration with the Division on Earth and Life Studies. Learn more about this workshop by visiting the event webpage.”

Nobel Prize Summit-Truth, Trust and Hope

Taking place May 24-26 this year in DC and virtually, this Nobel Prize Summit asks “How can we build trust in truth, facts and scientific evidence so that we can create a hopeful future for all?”

“Misinformation is eroding our trust in science and runs the risk of becoming one of the greatest threats to our society today.”

“Join us at this years’ Nobel Prize Summit which brings together laureates, leading experts and you in a conversation on how we can combat misinformation, restore trust in science and create a hopeful future.”

Learn more and register here.

CSWMD 2023 Annual Symposium: WMD in the Decisive Decade

“The National Defense University’s Center for the Study of Weapons of Mass Destruction (CSWMD) invites you to join us on 14 June 2023 for the virtual Annual CSWMD Symposium, titled WMD in the Decisive Decade.”

“This year’s symposium will explore the cognitive impacts WMD has on strategic decision making and the challenges associated with operating in an environment where WMD has been employed. It will be an opportunity for the WMD community to engage with officials and thought leaders on current WMD challenges at the unclassified level, including keynote addresses by Richard Johnson, Deputy Assistant Secretary of Defense for Nuclear and CWMD Policy and Rebecca Hersman, Director of the Defense Threat Reduction Agency.”

“For more information and to register for this event click here. Please RSVP by 9 JUNE 2023.”

“We look forward to hosting you for the event. For more information about the WMD Center and reference our research, please visit our website at https://wmdcenter.ndu.edu/ and follow us on Twitter and on LinkedIn.”

Gordon Research Conference: Cross-Cutting Science Facilitating Collaboration Across the Threat-Science Research Community

“The Nonproliferation, Counterproliferation and Disarmament Science GRC is a premier, international scientific conference focused on advancing the frontiers of science through the presentation of cutting-edge and unpublished research, prioritizing time for discussion after each talk and fostering informal interactions among scientists of all career stages. The conference program includes a diverse range of speakers and discussion leaders from institutions and organizations worldwide, concentrating on the latest developments in the field. The conference is five days long and held in a remote location to increase the sense of camaraderie and create scientific communities, with lasting collaborations and friendships. In addition to premier talks, the conference has designated time for poster sessions from individuals of all career stages, and afternoon free time and communal meals allow for informal networking opportunities with leaders in the field.”

This conference will take place July 9-14 in Ventura, CA. Learn more and register here.

Call for Applications: Early-Career Fellowship for Reducing Nuclear Weapons Risks

The Council on Strategic Risks “is announcing a continuation of its Early-Career Fellowship for Reducing Nuclear Weapons Risks. Through this six-month program, early-career professionals will work with leading experts from CSR’s team and network to develop a better understanding of practical risk reduction concepts and to generate new ideas regarding:

Nuclear strategic stability
Strengthening norms against nuclear weapons threats and use
Avoiding miscalculations and preventing accidents/incidents
Preventing and addressing nuclear proliferation
Responsibilities of nuclear weapons-capable states”

Learn more and apply here.

Seeking Subject Matter Expert(s) (SMEs) with Experience Educating Global Audiences on the Importance of Securing Emerging Technologies

“CRDF Global is seeking subject matter expert(s) (SMEs) to engage and educate global audiences. The expert(s) will work on deliverables relating to building a culture of security in the private sector. These deliverables will include the development of an online asynchronous course and four hybrid hackathons, which will take place at local incubator hubs in several countries.”

“The expert(s) will design and develop an asynchronous course to counter misuse and raise awareness of emerging technologies with potential weapons of mass destruction (WMD)-related applications by state and non-state actors. The audience for this course will be individuals in the private sector (particularly in start-ups, innovation hubs, and incubator spaces) in various countries globally. This asynchronous course should train key stakeholders on how to develop and foster a culture of security.”

Learn more here.

Weekly Trivia Question

You read the Pandora Report every week and now it’s time for you to show off what you know! The first person to send the correct answer to biodefense@gmu.edu will get a shout out in the following issue (first name last initial). Our question this week is: “In 1984, what group spread Salmonella enterica at restaurants and shops in Dulles, Oregon in an attempt to influence local elections?”

Last week, our question was: “In the 2011 film Contagion, Dr. Erin Mears (played by Kate Winslet) is an officer in which CDC program?” The answer is the Epidemic Intelligence Service.

Pandora Report 3.3.2023

March 3, 2023March 3, 2023 by dkellogg97, posted in Pandora Report

Happy end to yet another very eventful week! Today we are covering the Department of Energy’s updated assessment on the start of the pandemic, the subsequent discourse, the IC’s assessment on Havana syndrome, the newly-signed NSM 19, and Iran’s investigation into alleged poisonings of schoolgirls.

Spy Agencies Gone Wild RE: COVID-19 Origins? Not Quite…

This week, the Department of Energy (DOE) and Federal Bureau of Investigation (FBI) provided assessments and statements indicating that they believe the initial spread of SARS-CoV-2 was the result of a lab leak in Wuhan. The initial firestorm was kicked off by a Wall Street Journal article with a less-than-helpful headline regarding DOE’s delivery of an assessment to the White House. In the following days, the FBI director provided statements indicating his agencies reached the same conclusion. Subsequent discussion has been rife with poor understandings of the Intelligence Community (IC) and intelligence itself, in addition to flawed claims about what these assessments actually mean. This section aims to break down what all has happened in this area this week and highlight the intrinsically interdisciplinary nature of intelligence and national security more broadly.

What Actually Happened This Week

As previously mentioned, the Wall Street Journal published an article on Sunday entitled “Lab Leak Most Likely Origin of COVID-19 Pandemic, Energy Department Now Says” to much uproar from all matter of folks. The assessment referenced by the article stemmed from analysis conducted by Z-Division at Lawrence Livermore National Laboratory, which led DOE to conclude “as part of a new government-wide intelligence assessment that a lab accident was most likely the triggering event for the world’s worst pandemic in a century.”

As the Washington Post explains, “…other intelligence agencies involved in the classified update — completed in the past few weeks and kept under wraps — were divided on the question of covid-19’s origins, with most still maintaining that a natural, evolutionary “spillover” from animals was the most likely explanation. Even the Energy Department’s analysis was carefully hedged, as the officials expressed only “low confidence” in their conclusion, according to U.S. officials who spoke on the condition of anonymity to describe a classified report.”

“U.S. officials confirmed that an updated assessment of covid-19’s origins was completed this year, and said the document was based on fresh data as well as new analysis by experts from eight intelligence agencies and the National Intelligence Council.” Furthermore, the IC remains firm in its view that SARS-CoV-2 was absolutely not developed as a biological weapon.

Of course, this news sparked a lot of conversation from lab leak and natural origin proponents alike. As NPR notes:

…at the end of the day, the origin of the pandemic is also a scientific question. Virologists who study pandemic origins are much less divided than the U.S. intelligence community. They say there is “very convincing” data and “overwhelming evidence” pointing to an animal origin.

In particular, scientists published two extensive, peer-reviewed papers in Science in July 2022, offering the strongest evidence to date that the COVID-19 pandemic originated in animals at a market in Wuhan, China. Specifically, they conclude that the coronavirus most likely jumped from a caged wild animal into people at the Huanan Seafood Wholesale Market, where a huge COVID-19 outbreak began in December 2019.

Virologist Angela Rasmussen, who contributed to one of the Science papers, says the DOE’s “low confident” conclusion doesn’t “negate the affirmative evidence for zoonotic [or animal] origin nor do they add any new information in support of lab origin.”

“Many other [news] outlets are presenting this as new conclusive proof that the lab origin hypothesis is equally as plausible as the zoonotic origin hypothesis,” Rasmussen wrote in an email to NPR, “and that is a misrepresentation of the evidence for either.”

The FBI also re-iterated its moderate confidence assessment that the virus originated in a lab, with FBI Director Christopher Wray highlighting this in an interview with Fox News. To summarize, the FBI maintained its moderate confidence assessment that the COVID-19 pandemic began with a lab accident, DOE changed its view to that above, and the CIA and another agency remain undecided as they did in the 2021 unclassified assessment. The others continue to favor a natural origin. So where does that leave us?

#FBI Director Wray confirmed that the Bureau has assessed that the origins of the COVID-19 pandemic likely originated from a lab incident in Wuhan, China. pic.twitter.com/LcBVNU7vmO
— FBI (@FBI) March 1, 2023

The Breakdown

As this discussion has been fraught with confusion about the IC, we will cover some brief basics about the IC’s structure and work. First, the IC is broad and diverse. It is composed of 18 organizations, including the Office of the Director of National Intelligence (ODNI) and the 17 constituent organizations that report to ODNI. ODNI and the Central Intelligence Agency are independent organizations. Nine others are Department of Defense elements (including the Defense Intelligence Agency, the National-Geospatial Intelligence Agency, the National Reconnaissance Office, and the DoD service intelligence elements). Seven other organizations are elements of other departments and agencies. These include the “Department of Energy’s Office of Intelligence and Counter-Intelligence; the Department of Homeland Security’s Office of Intelligence and Analysis and US Coast Guard Intelligence; the Department of Justice’s Federal Bureau of Investigation and the Drug Enforcement Agency’s Office of National Security Intelligence; the Department of State’s Bureau of Intelligence and Research; and the Department of the Treasury’s Office of Intelligence and Analysis.”

Naturally, each of these agencies has its strong suits and purposes, though there is intentional overlap. The intelligence failures in the lead up to the events of September 11, 2001, significantly changed the IC, bringing the abolition of the Director of Central Intelligence, the establishment of ODNI and the Director of National Intelligence position, creation of new agencies and restructurings of existing ones, and an overall effort to improve coordination, collaboration, and communication in the community. The main failure in the case of 9/11 was in not “connecting the dots”, so there have been strong efforts to make agencies share information in a timely, useful manner. Of course, this has not made the IC immune to failures, but it has been a positive step in improving coordination and creating appropriate overlap that can help provide more comprehensive intelligence to decision makers.

Furthermore, far from simply being “spy stuff”, intelligence draws on broad expertise and knowledge sources in a cycle of evaluation and feedback. In fact, it is estimated that about 80% of intelligence relies on open information, including news and academic sources. Information gaps and limitations may require further collection, but the bulk of information is often times openly available. Furthermore, the community is simply not full of a bunch of spies. For example, in 2003, it was estimated that just 10% of the CIA’s workforce were clandestine officers-the ones that recruit sources and go on covert missions like you might see in the movies. The rest are all kinds of analysts, mission management and admin folks, and even all kinds of scientists, physicians, public health experts, and so on. Agencies oftentimes have entire directorates dedicated to S&T work, and there are entire sub-organizations dedicated to specific S&T-related topics, including the National Center for Medical Intelligence.

There is also confusion about how analysts conduct their work. The 2011 IC Consumers Guide referenced by many news outlets and scholars discussing these assessments and their confidence levels explains how analysts conduct their work. It reads in part “Intelligence analysts are generally assigned to a particular geographic or functional specialty area. Analysts obtain information from all sources pertinent to their area of responsibility through information collection, processing, and forwarding systems. Analysts may tap into these systems to obtain answers to specific questions or to generate information they may need.”

“Analysts receive incoming information, evaluate it, test it against other information and against their personal knowledge and expertise, produce an assessment of the current status of a particular area under analysis, and then forecast future trends or outcomes. The analyst also develops requirements for the collection of new information…Analysts rarely work alone; they operate within a system that includes peer review and oversight by more senior analysts.“

With this information in mind, it is clear that statements that paint the IC as a hive mind that produces assessments on political whims without oversight, methodologies, or internal review processes are unhelpful and untrue. Though it is not publicly known who specifically wrote these assessments, it is reasonable to believe they were made in good faith and in accordance with the above information. In addition to personal knowledge and expertise, importantly, IC analysts do have access to classified information-a fact seemingly overlooked by many in the last week.

One of the main points of confusion in public discussion of this has centered on why the Department of Energy is making an assessment on the origins of a virus. It is true that the Department of Energy, as the name implies, oversees national energy policy and manages nuclear power and weapons, but that is not its only tasking. In fact, the idea that eventually led to the Human Genome Project was conceived in the Department’s Office of Science. DOE has an intelligence element (as referenced above) and also oversees the National Laboratories, a broad system that aims to address critical scientific challenges “from combating climate change to discovering the origins of our universe”. Three of these laboratories (Lawrence Livermore, Los Alamos, and Sandia) are National Nuclear Security Administration labs, meaning they do work related to nuclear weapons in addition to other kinds of research-including global security research. The labs do work in conjunction with other organizations and, in some cases, support the IC. Lawrence Livermore National Laboratory, for example, has its Laboratory Intelligence Program, which has been at the heart of this frenzy and provides “critical science and technology support to the intelligence community’s foundational intelligence missions in strategic intelligence and anticipatory intelligence, as well as mission objectives in counterproliferation, cyber intelligence and counterterrorism.” The point is-DOE is not just a bunch of physicists working on the nuclear weapons stockpile. The Department is as large and diverse as its taskings, including those requiring expertise in the life and social sciences.

Much attention has also been paid to the confidence levels of the assessments. WSJ noted later in its piece that the assessment was made with low confidence, a term used by analysts when “…information used in the analysis is scant, questionable, fragmented, or that solid analytical conclusions cannot be inferred from the information, or that the IC has significant concerns or problems with the information sources.” Unfortunately, this information is not particularly helpful for the general public as the assessment itself is classified, so it is not known what information led to the assessment and why specifically it was rated low confidence. Analytical confidence can be influenced by several factors, including analyst expertise (which is likely limited given the nature of this specific assessment), time constraints, source reliability and corroboration, and more.

As ODNI identified in its unclassified October 2021 Intelligence Community Assessment on COVID-19 Origins, at the time, four elements and the National Intelligence Council also assessed with low confidence that initial SARS-CoV-2 infection was likely caused by natural exposure to an infected animal. One agency (the FBI) was noted to assess that the first human infection with SARS-CoV-2 most likely was the result of a laboratory-associated incident. This assessment was made with moderate confidence, which “…generally indicates that the information being used in the analysis may be interpreted in various ways, or that the IC has alternative viewpoints on the significance or meaning of the information, or that the information is credible and plausible but it is not sufficiently corroborated to warrant a higher level of confidence.” At that time, three other IC elements remained unable to coalesce around either explanation. Again, however, these assessments are classified, so there is no way of knowing why they were judged this way in the open source.

Others have taken aim at a low confidence assessment finding a lab origin “very likely”, arguing that these terms are mutually exclusive. Analytic confidence is separate from the estimative language employed by the IC. Estimative language (“very likely”, “almost certainly”, “unlikely”, etc.) expresses an assessment or judgement. Assessments are oftentimes based on incomplete information, which is why analysts use estimative language to express the likelihood or probability of something given what information is available. Because information gaps are inherent to this work, these products include declarations of underlying assumptions and judgements analysts made in their processes. Confidence levels “reflect the scope and quality of the information supporting its judgements.” In fact, to avoid confusion, the ODNI indicates that a confidence level and degree of likelihood should not be included in the same sentence. Again, as these assessments are classified, we do not know what assumptions were made nor what sources were used. However, it is possible and okay to judge that something is very likely with low confidence, particularly when dealing with something as complex as the origin of this virus.

The Bottom Line

Flashy news headlines aside, what have we really learned from these reports? Well…not much. It was well-established in late 2021 that the IC is unclear on the origins of SARS-CoV-2, and the events of this week have not settled that debate. As the NSC Coordinator for Strategic Communications, John Kirby, told the press this week, “There is not a consensus right now in the U.S. government about exactly how covid started…That work is still ongoing, but the president believes it’s really important that we continue that work and that we find out as best we can how it started so that we can better prevent a future pandemic.”

Furthermore, it is important to address the question of to what extent we can know this and what it would change at this point. China is clearly not going to cooperate on any kind of investigation into COVID-19’s origin. That has been clear since the early days of the pandemic and is part of a pattern of behavior on the part of the CCP. Irrespective of where this virus actually came from, it is clear that China did cover up its initial spread in the population, censoring netizens and healthcare professionals until it was impossible to conceal further. While an in-depth investigation into the start of this pandemic has always been needed, hyper focusing on this runs the risk of diverting attention from other critical issues we have much more information readily available on. China did cover up the initial spread of this virus and has been disingenuous in its reporting and handling of it ever since. The United States failed to adequately respond to this pandemic for a variety of reasons, a fact that does not depend on how the virus initially spread. It is vital to balance desires to find the truth of COVID-19’s origins, something that is indisputably important, with using the information that is available and can reasonably be acquired to address these problems before the next pandemic. This information could inform debates on laboratory safety and oversight, though, as Biodefense Graduate Program Director Dr. Gregory Koblentz demonstrated in his interview with the New York Times this week, there is a wealth of information available already driving these discussions.

Finally, this all demonstrates the intrinsically inter/multidisciplinary and cross-sectoral nature of these problems. False dichotomies pitting national defense against public health, particularly in terms of funding, are not helpful, particularly as it is increasingly clear that public health threats are critical national security threats. As the IC learned in the early years of this century, siloing information is incredibly dangerous-a lesson we cannot afford to have to re-learn at the intersection of public health and national security. While respect for expertise and experience is an absolute necessity, understanding the need to collaborate, work across lanes, and recognize what unique capabilities others can offer is equally vital. These threats are not going anywhere, so learning to understand how different disciplines approach these problems and how best to work together is of the utmost importance.

New ICA-Havana Syndrome Very Likely Not Caused by Foreign Adversary

Director of National Intelligence Avril Haines released a statement this week regarding the Intelligence Community’s assessment of the mysterious “Havana syndrome”, indicating the IC finds it very unlikely a foreign adversary is responsible for the phenomenon. The Washington Post writes “The new intelligence assessment caps a years-long effort by the CIA and several other U.S. intelligence agencies to explain why career diplomats, intelligence officers and others serving in U.S. missions around the world experienced what they described as strange and painful acoustic sensations. The effects of this mysterious trauma shortened careers, racked up large medical bills and in some cases caused severe physical and emotional suffering.”

The DNI Statement reads in part “Today we are sharing key judgments and investigative efforts from our Intelligence Community Assessment (ICA) on Anomalous Health Incidents (AHIs). This assessment builds on the Intelligence Community’s (IC) interim findings released last year, which described the IC’s judgment that U.S. adversaries, including Russia, were not engaged in a global campaign resulting in AHIs, but indicated that we continued to investigate whether a foreign actor was involved in a subset of cases. Since then, we continue to surge resources and expertise across the government to explore all possible explanations.”

“Based on the latest IC-wide effort, which has resulted in an ICA that will be issued today, I can share with you that most IC agencies have now concluded that it is “very unlikely” a foreign adversary is responsible for the reported AHIs. IC agencies have varying confidence levels because we still have gaps given the challenges collecting on foreign adversaries — as we do on many issues involving them.”

President Biden Signs National Security Memorandum to Counter Weapons of Mass Destruction Terrorism and Advance Nuclear and Radioactive Material Security

This week, President Biden signed National Security Memorandum (NSM) 19 to Counter Weapons of Mass Destruction (WMD) Terrorism and Advance Nuclear and Radioactive Material Security. According to the White House, “This comprehensive new strategy advances several of President Biden’s most enduring national security priorities: protecting our nation and the international community from the existential threats posed by WMD terrorism and preventing non-state actors from using chemical, biological, radiological, and nuclear weapons.”

Among its central aims is that of keeping radioactive materials used in industry out of terrorists’ hands, notes the New York Times. The same article explains that “Details of the new memorandum are classified. Previous versions of the policy focused on securing fissile material commonly used in nuclear weapons such as the ones the United States used against Hiroshima and Nagasaki in 1945. The effort focuses on specific radioisotopes that terrorists could potentially use in so-called dirty bombs — improvised weapons that use explosives to blast radiological materials into the surrounding area, potentially sickening or killing people and causing environmental harm.”

President Biden’s Homeland Security Advisor, Elizabeth Sherwood-Randall, explained the impact of NSM 19 on the medical field at an event at the Nuclear Threat Initiative: “In her remarks, the homeland security adviser said that medical devices for treating blood with X-rays — a process that makes transfusions safer — have traditionally used cesium-137 as the radioactive source to produce those rays, but that alternatives that use less dangerous materials now exist…The Department of Veterans Affairs, which manages the largest public health care network in the country, recently removed all cesium-based blood irradiators from its hospitals, she said, and transitioned in October to machines that produce X-rays though different processes.”

This comes just over a month after a small quantity of cesium-137 went missing in Western Australia, prompting a large search for the tiny cylinder that lasted six days.

Iran Investigating Reports of Schoolgirl Poisonings

Iran announced this week it is investigating reports that several schoolgirls were poisoned as revenge for the role of young women in recent protests in the country. The Guardian explains “Iran’s deputy education minister, Younes Panahi, told reporters yesterday: “After the poisoning of several students in [the city of] Qom … it was found that some people wanted all schools, especially girls’ schools, to be closed.” He added: “It has been revealed that the chemical compounds used to poison students are not war chemicals … the poisoned students do not need aggressive treatment and a large percentage of the chemical agents used are treatable.”

OK. As promised, a thread about allegations of poisoning incidents in Iran. (Long thread.) Hold all questions until the end. (1 of xxx) #IranianSchoolgirls
— Dan Kaszeta 🇺🇦🇱🇹 (@DanKaszeta) March 2, 2023

Dan Kaszeta, author of multiple well-known works on chemical weapons, discussing Iran’s investigation

“Report: A Summary on Ending Biological Threats-Event Summary”

From the Council on Strategic Risks: “This report summarizes discussions held during a workshop hosted by the Council on Strategic Risks (CSR) on September 26, 2022, focused on ending extreme risks from biological threats. For several years, CSR has convened diverse experts who agree that it is more feasible than ever to halt the spread of infectious disease threats from all sources before they cause significant damage. After several years of virtual discussions during the heights of the COVID-19 pandemic, this in-person, invitation-only event brought together experts from government, academia, industry, and non-profit organizations to discuss how to use technological advances, policy, and other tools to gauge progress, identify open questions and ongoing challenges, and think strategically about what steps must be done next.”

“Conversations and panels held during “The Summit on Ending Biological Threats” were held under the Chatham House Rule. This report does not represent consensus among participants, nor does it assign specific perspectives to any individual participant. Though many topics were covered throughout the Summit, conversation centered around a few core subject areas: pathogen early warning, public-private collaboration, interagency efforts and collaboration, and strategic communications. This summary report will discuss these central topics and provide a general overview of discussions.”

“A Bipartisan Approach to Pandemic Security? It’s Within Reach”

Beth Cameron, Gary Edson, and J. Stephen Morrison recently published this opinion piece with STAT News in which they discuss the findings of the “Democracy and Pandemic Security” roundtable convened by their respective organizations. They write in part “Covid-19 laid bare persistent inequities across America. Polarization, a comorbidity that made the pandemic worse, continues to impede a unified and effective response to public health threats, and not just those caused by viruses. When the next threat emerges — and it will — it is uncertain if most Americans will adhere to public health measures.”

“That is why our organizations — the Brown University School of Public Health Pandemic Center, the Covid Collaborative, and the Center for Strategic and International Studies Global Health Policy Center — recently convened a diverse group of leaders to discuss how to better protect Americans from pandemic threats while at the same time reinforcing American values of freedom and democracy. The group included former governors and mayors; officials from red, blue, and purple states and from the Biden, Trump, Obama, and Bush administrations; as well as experts in incident management and pandemic inequity.”

“Prevention of Zoonotic Spillover”

From the WHO: “The devastating impact of COVID-19 on human health globally has prompted extensive discussions on how to better prepare for and safeguard against the next pandemic. Zoonotic spillover of pathogens from animals to humans is recognized as the predominant cause of emerging infectious diseases and as the primary cause of recent pandemics.”

“This spillover risk is increased by a range of factors (called drivers) that impact the nature, frequency and intensity of contact between humans and wild animals. Many of these drivers are related to human impact, for instance, deforestation and changes in land use and agricultural practices. While it is clear that the triad of prevention-preparedness-response (P-P-R) is highly relevant, there is much discussion on which of these three strategic activities in the field of emerging infectious disease should be prioritized and how to optimally target resources. For this, it is important to understand the scope of the respective activity and the consequences of prioritization. “

Read this position paper here.

“WHO Warns of Worsening Health Situation in Ukraine”

This Devex Inside Development piece discusses the WHO’s data on health care in Ukraine since Russia invaded the country last year. It reads in part “About 44% of people in liberated areas are seeking health care for chronic conditions, such as kidney and heart disease. One in 3 people can no longer afford to buy medicines. An estimated 10 million people may have a mental health condition. All this is happening against a backdrop of continued attacks on health care in the country. Since the war started, WHO has recorded more than 800 attacks on health care, a huge majority of which damaged or destroyed facilities, including hospitals and pharmacies.”

Third International Summit on Human Genome Editing

The Royal Society will host this hybrid summit March 6-8, 8:30- 6 pm GMT. “Building on previous events held in Washington, DC (2015) and Hong Kong (2018), the London meeting will continue the global dialogue on somatic and germline human genome editing. Major themes for discussion include developments in clinical trials and genome editing tools such as CRISPR/Cas9, as well as social, ethical and accessibility considerations these scientific developments entail.”

“The three-day Summit is being organised by the Royal Society, the UK Academy of Medical Sciences, the US National Academies of Sciences and Medicine and The World Academy of Sciences. Find out more about the Summit’s Organising Committee, chaired by Professor Robin Lovell-Badge FMedSci FRS.”

Report Launch– Preparing for Success at the Fifth Review Conference of the CWC: A Guide to the Issues

“The United Nations Institute for Disarmament Research (UNIDIR) is pleased to invite you to the in-person launch of a new report on Preparing for Success at the Fifth Review Conference of the Chemical Weapons Convention: A Guide to the Issues. This is the first in a series of events the Institute is hosting in preparation for the Fifth CWC Review Conference, which is scheduled to take place from 15 to 19 May 2023.” One version will be hosted in The Hague on Monday, March 6 from 12:30-14:30 CET and another in Brussels on Tuesday, March 7 from 12:30-14:30 CET. Both will also be broadcast via Zoom.

Penetrate, Exploit, Disrupt, Destroy – with Dr. Craig J. Wiener

From the Alperovitch Institute: “Join us on Wednesday, March 15th at 5pm at the SAIS Hopkins Kenney Auditorium. Dr. Craig J. Wiener is recognized as an expert in major foreign adversary espionage, sabotage and strategic capabilities that pose threats to the U.S. Government (USG) and North Atlantic Treaty Organization. Dr. Wiener’s previous position was as the Senior Technical Analyst for the Department of Energy’s (DOE) Office of Intelligence and Counterintelligence where he fulfilled a role as DOE’s lead all source cyber threat analyst, the Department’s representative to the National Security Council for Cyber Operations, a key member of National Intelligence Council Special Analytic Groups, and a government briefer and/or advisor for Defense Science Board studies on Cyber as a Strategic Capability, Homeland Defense, Strategic Surprise and the future of US Military Superiority among other topics. Additionally, Dr. Wiener initiated and led studies for special nuclear weapons related threat and vulnerability analyses and advanced technical security threats to USG equities by foreign adversaries and engaged in the development, planning and operationalization of counter-adversary strategies across multiple domains of operations. Dr. Wiener joined the MITRE Corporation as a Technical Fellow in early-2020, where he supports key U.S. Government (USG) national security initiatives. He was recently appointed by the Secretary of Energy to the Electricity Advisory Committee to advise DOE on current and future electric grid reliability, resilience, security, sector interdependence, and policy issues.”

Dr. Wiener is an alumnus of the Biodefense PhD Program! Learn more and register for this event here.

Intelligence Studies Consortium

“On March 24, 2023, the Intelligence Studies Consortium is convening its third symposium, entitled New Perspectives in Intelligence Studies. This year, George Mason’s Schar School of Policy and Government is hosting. The symposium will be from 8 AM to 4 PM in Rooms 125-126 Van Metre Hall, 3351 Fairfax Drive, Arlington, VA. The closest Metro is Virginia Square/GMU on the Orange and Silver lines.

The symposium will feature student presentations in four panels:

Russia and China
Violent Non-State Actors
Emerging Technologies
Transnational Challenges

There will be an 8:30 AM keynote address from the Assistant Secretary of the Treasury, Shannon Corless, and a lunchtime conversation with General Michael V. Hayden.

We encourage students to attend in person. We have also provided a livestream option for those not in the Washington DC area.”

Learn more and register here.

Charity Entrepreneurship 2023 Charity Ideas

Charity Entrepreneurship currently has a call open to support the launch of a nonprofit in Biosecurity and Large-Scale Global Health. Possible organizations includes: “An organization that addresses antimicrobial resistance by advocating for better (pull) funding mechanisms to drive the development and responsible use of new antimicrobials,” and “An advocacy organization that promotes academic guidelines to restrict potentially harmful “dual-use” research.” Learn more and apply for these grants here.

Sustainable Diagnostic Containment Laboratories – Request for Expressions of Interest

“This Expression of Interest (RFEI) is seeking bold ideas that will reinvent the diagnostic laboratory, making it fit-for-purpose in resource-limited contexts globally. These innovative solutions are expected to reimagine the physical laboratory in order to reduce ongoing operational and maintenance costs and allow sustainable presence of safe and secure handling of high-consequence pathogenic materials, whilst maintaining and/or optimizing core functions of a diagnostic laboratory in low- and middle- income countries.”

“This RFEI represents Phase I of a dual-phase approach to development of a Grand Challenge for Sustainable Diagnostic Laboratories. The pool of Expressions of Interest received will be used to inform the scope of a full Grand Challenge program in Phase II, under which Grand Challenges Canada will award funding. Submission of an Expression of Interest does not constitute an application for funding; however, Expressions of Interest will receive feedback from an external review process designed to improve the quality of full proposals submitted for an open call for funding applications in Phase II. Most promising Expressions of Interest may also be shortlisted for direct invitations to submit full proposals for funding in Phase II.”

Learn more and register here.

Weekly Trivia Question

You read the Pandora Report every week and now it’s time for you to show off what you know! The first person to send the correct answer to biodefense@gmu.edu will get a shout out in the following issue (first name last initial). This week, we are throwing it back to middle school English class: This chemical agent features in Roald Dahl’s famous short story, The Landlady, in which the main character is given a tea that tastes of bitter almonds. What is the name of this agent?

The correct answer to last week’s question, “What is the first multilateral disarmament treaty that banned an entire category of WMD?” is the Biological Weapons Convention.

Share this:

Share this:

Share this:

Share this:

Share this:

Share this:

Share this:

Share this:

Share this:

Share this: