chemical weapons – The Pandora Report

Pandora Report 5.10.2024

May 10, 2024 by dkellogg97, posted in Pandora Report

This week’s Pandora Report covers a new interim staff report from the House Select Subcommittee on the Coronavirus Pandemic, the new United States Government Policy for Oversight of Dual Use Research of Concern and Pathogens with Enhanced Pandemic Potential, the OPCW’s statement on Russia’s alleged use of toxic chemicals as weapons in Ukraine, and more.

GMU Biodefense Students Visit National Museum of Health and Medicine

“Late last month a cadre of students from the Schar School of Policy and Government’s biodefense graduate program visited the National Museum of Health and Medicine in Silver Spring, Maryland, not far from the George Mason University campuses.”

“The 150-year-old museum is known for its collections that depict the human anatomy and everything that can befall it, in sometimes stark and gory detail. What else would you expect from a museum with a pathology guide with listings for “bilateral nephrolithiasis (kidney stones),” “liver, hydatid cyst from tape worm,” and an all-time-favorite, “trichobezoar (human hairball from stomach).”’

Read more about this visit here on the Schar School’s website.

*GMU Biodefense students at the National Museum of Health and Medicine*

Select Subcommittee on the Coronavirus Pandemic Interim Staff Report Calls for Daszak, EcoHealth Alliance Debarment

Earlier this month, the House Select Subcommittee on the Coronavirus Pandemic’s chairman, Rep. Brad Wenstrup (R-OH), released an interim staff report-“An Evaluation of the Evidence Surrounding EcoHealth Alliance, Inc.’s Research Activities”. The press release explains in part, “This report details the Select Subcommittee’s comprehensive investigation into the U.S. government’s funding and lack of oversight of gain-of-function research, EcoHealth Alliance (EcoHealth), and the Wuhan Institute of Virology (WIV). The report reveals serious, systemic weaknesses in the National Institute of Allergy and Infectious Diseases (NIAID) and National Institutes of Health’s (NIH) grant procedures and examines how these failures enabled EcoHealth President Dr. Peter Daszak to fund dangerous gain-of-function research in Wuhan, China without sufficient oversight.”

The select subcommittee’s recommendations include:

“The Select Subcommittee on the Coronavirus Pandemic recommends that EcoHealth Alliance and Dr. Peter Daszak are formally debarred and cut off from receiving any future U.S. taxpayer funding.”
“The Select Subcommittee also recommends that the U.S. Department of Justice conduct a formal investigation into Dr. Daszak.”
“Further, the Select Subcommittee recommends eight improvements to NIAID and NIH procedures that will improve grant compliance, increase biosafety and biosecurity of high-risk research, and advance transparency and accountability in America’s federal health agencies.”

Daszak testified before the select subcommittee on the day the report was released, which was covered by Matt Field in The Bulletin of the Atomic Scientists. Field explains in his coverage that Daszak was grilled by members of both major political parties during the subcommittee’s hearing on May 1, writing “On Wednesday, however, members of both US political parties came armed with blistering criticism for Peter Daszak, the head of the nonprofit EcoHealth Alliance, questioning his honesty in dealing with federal agencies and skewering his alleged conflicts of interests as he attempted to assume the role of a leading scientific voice on the pandemic’s origins. Beginning in 2014, EcoHealth ran a US-funded, multimillion-dollar project to identify hotspots where patterns of interaction between humans and animals could spark disease outbreaks.”

He later writes, “They hammered away on one of the plot points in the origins debate, EcoHealth’s transparency in reporting on its studies to the National Institutes of Health (NIH). Over the course of one five-year grant, EcoHealth was supposed to submit annual reports. One of those, covering 2018-2019, came two years late. Daszak claimed that EcoHealth had tried to submit the report, but the NIH had a problem with its computerized reporting platform. According to a report by the subcommittee’s Democrats, however, a forensic audit found no evidence for this assertion.”

Chairman Wenstrup said in a statement, ““EcoHealth Alliance President Dr. Peter Daszak is not a good steward of U.S. taxpayer dollars and should never again receive funding from the U.S. taxpayer. Dr. Daszak and his organization conducted dangerous gain-of-function research at the WIV, willfully violated the terms of a multi-million-dollar NIH grant, and placed U.S. national security at risk. This blatant contempt for the American people is reprehensible. It is imperative to establish higher standards of oversight at the NIH. The Select Subcommittee’s detailed and comprehensive report today holds Dr. Daszak and EcoHealth Alliance accountable and sheds light on severe shortcomings in our public health systems.”

US Agencies Set to Tighten Gain-of-Function Research Oversight

This White House announced this week the new United States Government Policy for Oversight of Dual Use Research of Concern and Pathogens with Enhanced Pandemic Potential and accompanying implementation guidance, following years of public debate and recommendations made by the National Science Advisory Board for Biosecurity. As the New York Times explains, “The new policy, which applies to research funded by the federal government, strengthens the government’s oversight by replacing a short list of dangerous pathogens with broad categories into which more pathogens might fall. The policy pays attention not only to human pathogens, but also those that could threaten crops and livestock. And it provides more details about the kinds of experiments that would draw the attention of government regulators.”

Read Max Kozlov’s summary and discussion of this new policy in Nature.

Emergent BioSolutions Announces Layoff Plans, Plant Closures

Emergent BioSolutions, the Gaithersburg-based company best known for producing Narcan, has announced it is shuttering its Maryland manufacturing facilities and laying off about 300 employees. This includes its Baltimore-Bayview Drug Substance manufacturing facility and its Rockville Drug Product facility, according to The Baltimore Banner. The company has also said it will eliminate 85 currently vacant positions. This is all on top of the more than 230 Maryland employees Emergent laid off last year.

Emergent drew national attention in the summer of 2021 after the company, which had secured a government contract to produce COVID-19 vaccines on behalf of Johnson & Johnson and AstraZeneca, came under Congressional scrutiny for potentially contaminating at least 75 million vaccine doses. Furthermore, as The New York Times highlighted at the time, “With its stock price cut in half, Emergent faces several shareholder lawsuits accusing it of securities fraud, and a pension fund filed a complaint last Tuesday claiming that some executives and board members — including several former federal officials — had engaged in insider trading by unloading more than $20 million worth of stock over the past 15 months.”

An investigation found that Emergent was forced to destroy or discard up to 400 million doses’ worth of ingredients for COVID-19 vaccines. ABC News explained in a piece about the report that “Congressional investigators probing the Maryland-based biotech company found that Emergent executives had privately raised urgent quality-control concerns even before the company began manufacturing the vaccines’ key ingredient — despite publicly expressing confidence in their ability to deliver on their multimillion-dollar government contract.”

‘”Despite major red flags at its vaccine manufacturing facility, Emergent’s executives swept these problems under the rug and continued to rake in taxpayer dollars,” House Oversight and Reform Committee Chairwoman Carolyn Maloney, D-N.Y., said of the report, which determined that the company’s “manufacturing failures and deceptive tactics” led to the large-scale waste of ingredients that could have helped make millions of vaccine doses.”

Emergent’s stock price did jump following the announcement of the layoffs, finishing yesterday at $4.37 up from $1.93 on May 1, a far cry from the $130 its shares were traded for in August 2020. According to The Baltimore Banner, “The company estimated that the restructuring will cost up to $21 million this year and save the company about $80 million annually. In a filing with the U.S. Securities and Exchange Commission, Emergent said most of those initial costs will be related to severance and benefits.”

OPCW Releases Statement on Ukraine

The OPCW released this week a statement about Russia’s alleged use of toxic chemicals as weapons in Ukraine. It reads in part “The Secretariat of the Organisation for the Prohibition of Chemical Weapons (OPCW) has been monitoring the situation on the territory of Ukraine since the start of the war in February 2022 in relation to allegations of use of toxic chemicals as weapons…The information provided to the Organisation so far by both sides, together with the information available to the Secretariat, is insufficiently substantiated.”

Read more here.

Mason Biodefense Graduate Program Director Discusses AI, Biological Weapons Risks with CNN

Biodefense Graduate Program Director Gregory Koblentz was recently interviewed in this May 5 CNN Newsroom segment covering AI and biological weapons proliferation risks. It was filmed ahead of the release of an episode of CNN’s “How It Really Happened” focused on the 2001 Amerithrax attacks.

“2024 U.S. Department of State Report on North Korea’s ‘Genetic Scissors’ Technology and Capabilities and Its National Security Implications”

This report from the Institute for National Security Strategy was co-authored by Biodefense PhD Program alumnus Hyun Jung Kim: “The recent U.S. State Department’s report, titled “2024 Adherence to and Compliance with Arms Control, Nonproliferation, and Disarmament Agreements and Commitments,” articulates that North Korea has acquired the capability to genetically engineer biological products utilizing CRISPR. This report raises alarms over the potential transformation of this genetic engineering technology into an offensive biological weapons program. CRISPR, often referred to as ‘genetic scissor’ technology, renowned for its ability to precisely cut and replace sections of the genome, holds promise for groundbreaking developments in medicine, agriculture, and energy sectors. However, this technology also faces several challenges, including ethical and institutional issues and safety concerns. The national security threats posed by the advancement of North Korea’s genetic engineering technology include unconventional warfare tactics such as terrorism and targeted assassinations, the potential leakage of genetically modified bioagents due to laboratory accidents, and the proliferation of weapons of mass destruction. Furthermore, the same report notes the development of ‘dual-use marine toxins’ by the Chinese People’s Liberation Army, which may imply possible strategic cooperation and coordination between China and North Korea in the development of biological toxins, posing a significant challenge to the international security landscape.”

“China, Biotechnology, and BGI: How China’s Hybrid Economy Skews Competition”

Anna Puglisi and Chryssa Rask recently published this issue brief with Georgetown’s Center for Security and Emerging Technology: “As the U.S. government considers banning genomics companies from China, it opens a broader question about how the United States and other market economies should deal with China’s “national champions.” This paper provides an overview of one such company—BGI—and how China’s industrial policy impacts technology development in China and around the world.”

“The National Blueprint for Biodefense: Immediate Action Needed to Defend Against Biological Threats”

This latest report from the Bipartisan Commission on Biodefense urges policymakers to adopt several measures to help sustain and grow US biodefense, including establishing a congressional working group focused on biodefense at the start of each Congress, making amendments to the Public Health Service Act in order to “produce a research and development plan for reducing pathogen transmission in built environments,” and replacing BioWatch.

In addition to the report linked above, Axios’ Alison Snyder has summarized the report and provided context to its recommendations here.

“Twenty Years of Preparedness: Reflecting on the Legacy of the Project BioShield Act of 2004”

Adey Pierce-Watkins and Tanima Sinha recently published this report for BDO: “This July 2, 2024, marks the 20th anniversary of The Project BioShield Act of 2004 (P.L. 108-276); legislation enacted in response to the anthrax attacks of September 2001, which revealed the need for development and acquisition of medical countermeasures (vaccines, therapeutics, and diagnostics) to protect the U.S. population from chemical, biological, radiological, and nuclear (CBRN) threats. This Act, and associated Congressional Appropriations, established a Special Reserve Fund (SRF) of $5.593B advanced funding available over a 10-year period for the advanced development and procurement of medical countermeasures with the intent of initiating a new posture of national preparedness.1 Simultaneously, this legislation created new market incentives for pharmaceutical and biotech companies to engage in the development of CBRN medical countermeasures and transformed the partnership between the federal government and industry into a shared responsibility for increasing preparedness against CBRN threats. As a result, this legislation and the SRF created a “guaranteed market” for pharmaceutical companies to produce CBRN medical countermeasures for which there previously was no commercial demand…In recognition of the 20th Anniversary of The Project BioShield Act, it is fitting to highlight the impact and milestones of this legislation based on its intended purpose and outcomes to date.”

“It Shouldn’t Be Easy to Buy Synthetic DNA Fragments to Recreate the 1918 Flu Virus”

Kevin M. Esvelt recently authored this piece for STAT News, writing in part “It should be hard — exceedingly hard — to obtain the synthetic DNA needed to recreate the virus that caused the deadly 1918 influenza pandemic without authorization. But my lab found that it’s surprisingly easy, even when ordering gene fragments from companies that check customers’ orders to detect hazardous sequences…Our experiment demonstrates that the immense potential benefits of biotechnology are profoundly vulnerable to misuse. A pandemic caused by a virus made from synthetic DNA — or even a lesser instance of synthetic bioterrorism — would not only generate a public health crisis but also trigger crippling restrictions on research.”

Applied Biosafety Special Issues on Biosafety and Biosecurity for Synthetic Genomics

Applied Biosafety‘s first and second special issues focused on biosafety and biosecurity for synthetic genomics is now available online. Articles include “Enhancing Gene Synthesis Security: An Updated Framework for Synthetic Nucleic Acid Screening and the Responsible Use of Synthetic Biological Materials,” “Developing a Common Global Baseline for Nucleic Acid Synthesis Screening,” Biosecurity Risk Assessment for the Use of Artificial Intelligence in Synthetic Biology,” “Biosecurity Assessments for Emerging Transdisciplinary Biotechnologies: Revisiting Biodefense in an Age of Synthetic Biology,” and more.

“Supporting Follow-Up Screening for Flagged Nucleic Acid Synthesis Orders”

Tessa Alexanian and Sella Nevo recently published this briefer with CSR’s Nolan Center, writing in part “Medical diagnostics, biomanufacturing, and many other parts of the bioeconomy rely on synthetic DNA and RNA purchases, which are ordered from commercial providers and shipped to laboratories around the globe. In addition to enabling beneficial biotechnology, affordable and accessible nucleic acid synthesis raises biosecurity concerns: some sequences can be used to reconstruct pathogen genomes or engineer dangerous biological agents, and it’s necessary to ensure those sequences are not misused by actors seeking to cause harm.”

“Most commercial synthesis providers screen the orders they receive to identify sequences of concern that could facilitate the construction of dangerous biological agents. When sequences in an order are flagged, follow-up screening determines whether the order is fulfilled. This screening centers on the customer: do they have a legitimate, peaceful purpose for obtaining the flagged sequences of concern?”

“This follow-up screening is the subject of this briefer. Between July and August 2023, we interviewed industry contacts and other policy and biosecurity experts. In the subsequent months, we conducted independent research and solicited expert feedback on report drafts. This process made clear that today, the follow-up screening process is ad-hoc. The customer service representatives, bioinformaticians, and security experts conducting follow-up screening often lack support for handling ambiguous cases, and there is little infrastructure to support information-sharing with other synthesis providers or law enforcement…”

“Developing a Customer Screening Framework for the Life Sciences”

A new report from Blueprint Biosecurity: “Since the 1970’s and the advent of recombinant DNA, biology has consistently become easier to engineer, and the pace of these advances is increasing. Many tools and capabilities for engineering biology are becoming more powerful, more affordable, and more widely available. These capabilities are critical for basic scientific research as well as advances in health, agriculture, and a wide range of applications in the burgeoning bioeconomy. However, access to these tools also raises the possibility that they could be accidentally or deliberately misused to cause harm by enabling development of toxins, pathogens, or other dangerous biological agents, including some not found in nature. Potential biological harms include high-consequence events such as the development and release of an engineered pathogen that causes a global catastrophe as well as a wide range of lower-consequence, higher-likelihood events. To prevent this type of misuse, policy experts have recommended expanding customer screening practices and policy frameworks to include a broad range of life sciences products, services, and infrastructure (Carter and DiEuliis, 2019a). Recent advances in artificial intelligence (AI) have increased this type of risk and have intensified these calls for action (Carter, et al., 2023; Helena, 2023).”

“To Combat Cow Flu Outbreak, Scientists Plan to Infect Cattle with Influenza in High-Security Labs”

Science’s Kai Kupferschmidt discusses current efforts to better understand H5N1 in this piece, writing in part “The avian influenza virus that has been infecting dairy cows and spreading alarm in the United States was expected to reach Germany this week. But that’s actually good news. A shipment of samples of the H5N1 virus from Cornell University virologist Diego Diel is destined for the Federal Research Institute for Animal Health in Riems, which has one of the rare high-security labs worldwide that are equipped to handle such dangerous pathogens in cattle and other large animals. There, veterinarian Martin Beer will use the samples to infect dairy cows, in search of a fuller picture of the threat the virus poses, to both cattle and people, than researchers have been able to glean from spotty data collected in the field.”

“Biodiversity Loss is Biggest Driver of Infectious Disease Outbreaks, Says Study”

This piece from The Guardian discusses the findings of a recent Nature meta-analysis: “New infectious diseases are on the rise and they often originate in wildlife. In meta-analysis published in the journal Nature, researchers found that of all the “global change drivers” that are destroying ecosystems, loss of species was the greatest in increasing the risk of outbreaks. Biodiversity loss was followed by climate change and introduction of non-native species.”

“Washington Accuses Russia of Chemical Weapons Attacks in Ukraine”

Andrea Stricker and Anthony Ruggiero recently authored this piece for the Foundation for Defense of Democracies that summarizes the United States’ claim that Russia has used CW in Ukraine, writing in part “The United States last week accused Russia of using chemical weapons against Ukrainian troops and sanctioned 12 Russian entities and individuals associated with Vladimir Putin’s ongoing chemical weapons program. The finding points to yet another instance of Moscow’s violation of international norms and conventions through the continued possession, stockpiling, and use of chemical weapons.”

“The Alleged Use of Chemical Weapons in Ukraine: How the International Community Can Investigate”

Ahmet Üzümcü recently authored this commentary piece for the European Leadership Network, explaining in part “I have summarised above the different mechanisms employed in the recent past to investigate allegations of the use of chemical weapons. I believe that one of them might be activated to investigate reported incidents in Ukraine. Whichever is selected may not enjoy the support of the whole membership; however, if one of the options is chosen, it needs to be practical and produce concrete results despite the challenges associated with the ongoing conflict. One of the strengths of the OPCW’s robust verification and compliance regime has always been its level of expertise and objectivity in the area of chemical weapons. The international community could leverage these strengths to test the veracity of the allegations that have been levelled against Russia about chemical weapons use during the armed conflict in Ukraine. The States Parties to the Chemical Weapons Convention should support such an initiative for two reasons: first, to provide a deterrent effect against further alleged uses of chemical weapons, and second, to uphold the integrity and credibility of the Chemical Weapons Convention, which is one of the pillars of the rules-based international order.”

ICYMI: Biological Weapons Convention Scientific and Technological Advisory Mechanism

From the UN Institute for Disarmament Research: “The Friends of the Chair, together with UNIDIR and @unitednations_disarmament, organized this informal webinar on a BWC scientific and technological advisory mechanism. This webinar was designed to support ongoing activities of the BWC Working Group and to stimulate thinking and discussion around a mechanism during the intersessional period. The event consisted of an expert panel followed by a moderated question-and-answer session with the audience.”

Watch here.

NEW-Slaves to the Bomb: The Role & Fate of N. Korea’s Nuclear Scientists

“The Committee for Human Rights in North Korea (HRNK) is delighted to invite you to the rollout of its latest report, Slaves to the Bomb: The Role & Fate of North Korea’s Nuclear Scientists by Robert Collins. The event will be open to the press and on the record. The report will be published on HRNK’s website on the day of the report rollout.”

This event will take place on May 17, at 3 pm EST. Learn more and RSVP here.

NEW-Getting Ahead of Avian Influenza: Why Organizations Need to Prepare Today

From Bluedot: “Highly Pathogenic Avian Influenza A(H5N1), commonly referred to as bird flu, has been making headlines around the world, as the virus rapidly spreads to new animal species. Already the cause of a panzootic (global animal pandemic), last month a human H5N1 case was reported in the U.S. after likely contracting it from infected dairy cattle. The virus has now been detected in dairy herds across multiple states, with evidence to suggest it has been spreading more widely than previously thought — begging the question: Are we at risk for an avian influenza-instigated pandemic?”

“Join us for a deep dive into avian influenza as we explore why and how organizations should prepare to safeguard against bird flu. Together, through collaborative efforts and informed decision-making, we can mitigate the risk of increased transmission to humans. BlueDot’s experts have been closely monitoring the situation and potential risks, issuing multiple alerts on H5N1 — and other avian influenzas — over the past 15 months.”

This event will take place on May 23, at 11 am ET. Learn more and register here.

Biosafety and the Origin of the COVID-19 Pandemic: Evidence and Policy Implications

From Brookings: “The world just lived through the COVID-19 pandemic, with more than 7 million reported direct deaths globally, more than 775 million reported cases, more than 14 million indirect excess deaths, and likely millions more unreported deaths. Despite the devastating effects on people and economies around the world, we still do not know with certainty how the pandemic originated, with the two most likely hypotheses either a natural spillover from an animal host or a research lab leak. Finding an answer to this question is not just a matter of doing justice to the millions of victims of COVID-19—it will have significant ramifications for policy implementation to help prevent the next pandemic.”

“Importantly, the catastrophic impact of the COVID-19 disease has shown us that preventing the next pandemic and biosafety in general should be top of mind for researchers, regulators, policymakers and public health officials, and it will likely require an array of measures by private, public, and nongovernmental organizations. This includes reconsidering our early warning systems for emergent diseases from the natural world, and taking a closer look at research with dangerous pathogens in biolabs. Identifying the origins of the recent pandemic can help target those efforts.”

“On May 14, the Brookings Center on Regulation and Markets will address these complex questions. First, Alina Chan, scientific advisor at the Broad Institute, and Alison Young, Curtis B. Hurley chair in public affairs reporting at the University of Missouri School of Journalism, will explain why the origin of the SARS-CoV-2 virus matters for public policy. Then, a balanced expert panel will debate the two most likely origins: natural spillover or a leak from a lab. A final panel of biosafety experts will discuss what measures would be best suited to improve biosafety and reduce the risks for research-related lab incidents as well as future pandemics. This event is a part of the CRM series on Reimagining Modern-day Markets and Regulations.”

This online event will take place on May 14 at 1:30 pm EDT. Learn more and access the event here.

Addressing the Challenges Posed by Chemical and Biological Weapons: Intensive Online Introductory Course for Students of Technical Disciplines

“SIPRI and the European Union Non-Proliferation and Disarmament Consortium (EUNPDC) invite graduate and postgraduate students of the technical or natural science disciplines to apply for an intensive online introductory course on chemical and biological weapons—their proliferation, the efforts to eliminate them, the various mechanisms used to control their spread—and endeavours underway to reduce the risk of chemical or biological agents in terrorist attacks. The course will take place online, during four half-days on 28–31 May 2024, 14:00 to 18:00 Central European Summer Time (CEST).”

“The course will cover the fundamentals of chemical and biological weapons as well as of missiles and other means of delivery; the history of chemical and biological warfare; the evolution of international norms against these weapons; the threats associated with potential terrorist uses of chemical and biological material; bioweapons and other related scientific advances; the current challenges posed by chemical weapons; arms control treaties; and mechanisms to curb the spread of dangerous substances, including export controls.”

“The course will also discuss the role of the EU institutions and industry to address the challenges mentioned above. The course will be instructed by renowned experts on non-proliferation, arms control, disarmament, export controls, verification and related subjects from SIPRI, other European research centres, think tanks and international organizations.”

Learn more and apply here.

Registration for GHS 2024 Now Open

Registration is now open for the Global Health Security 2024 conference in Sydney, Australia. This iteration will take place 18-21 June, 2024. The call for abstracts is also still open. “The mission of the Global Health Security conference is to provide a forum where leaders, researchers, policy-makers, and representatives from government, international organisations, civil society, and private industry from around the world can engage with each other, review the latest research and policy innovations, and agree solutions for making the world safer and healthier. To that end, our mission is to help foster a genuinely multidisciplinary community of practice that is committed to working collaboratively to enhance global health security and eliminate disease, irrespective of its origin or source.”

SBA.3 International Synthetic Biology, and Biosecurity Conference in Africa

“Join us for the SBA.3 International Synthetic Biology and Biosecurity Conference in Africa, a groundbreaking event that brings together experts, researchers, and enthusiasts in the field of synthetic biology. This in-person conference will take place at the Laico Regency Hotel from Wed, Jul 17, 2024 to Friday, Jul 19, 2024.”

“Get ready to dive into the exciting world of synthetic biology and explore its potential applications in Africa. From cutting-edge research to innovative solutions, this conference offers a unique opportunity to learn, network, and collaborate with like-minded individuals.”

“Discover the latest advancements, trends, and challenges in synthetic biology through engaging keynote speeches, interactive workshops, and thought-provoking panel discussions. Immerse yourself in a vibrant atmosphere where ideas flow freely and new connections are made.”

“Whether you’re a seasoned professional or just starting your journey in synthetic biology, this conference provides a platform to expand your knowledge, exchange ideas, and contribute to the growth of the field in Africa.”

“Don’t miss out on this extraordinary event that promises to shape the future of synthetic biology and biosecurity in Africa. Mark your calendars and join us at the SBA.3 International Synthetic Biology and Biosecurity Conference in Africa!”

Learn more and register here.

IBBIS Announces The Common Mechanism

The International Biosecurity and Biosafety Initiative for Science (IBBIS) recently launched The Common Mechanism, “An open-source, globally available tool for DNA synthesis screening.” The organization explains on its website that “The Common Mechanism helps providers of synthetic DNA and RNA to effectively screen orders to prevent synthesis technology from being exploited. We provide free, distributed, open-source, automated software for screening sequences of nucleic acids (including DNA and RNA) as well as resources to facilitate customer screening.”

Learn more and access the tool here.

Pandora Report 1.26.2024

January 26, 2024January 26, 2024 by dkellogg97, posted in Pandora Report

This week covers the updated Doomsday Clock time, new HHS cybersecurity performance goals for the health sector, a podcast episode with our own Sonia Ben Ouagrham-Gormley covering her work on barriers to biological weapons, new publications, and more!

Bulletin of the Atomic Scientists Science and Security Board Leaves Doomsday Clock at 90 Seconds to Midnight

The Bulletin of the Atomic Scientists Science and Security Board recently announced that it left the Doomsday Clock at 90 seconds to midnight this year, based on threats like nuclear risk, climate change, biological threats, and disruptive technologies. In its statement, the board said in part “Ominous trends continue to point the world toward global catastrophe. The war in Ukraine and the widespread and growing reliance on nuclear weapons increase the risk of nuclear escalation. China, Russia, and the United States are all spending huge sums to expand or modernize their nuclear arsenals, adding to the ever-present danger of nuclear war through mistake or miscalculation.”

“In 2023, Earth experienced its hottest year on record, and massive floods, wildfires, and other climate-related disasters affected millions of people around the world. Meanwhile, rapid and worrisome developments in the life sciences and other disruptive technologies accelerated, while governments made only feeble efforts to control them.”

In its in-depth explanation of biological risks that factored into this decision, the board explains that “The revolution in the life sciences and associated technologies continues to accelerate and expand in scope, enabling an increasing number of individuals, in groups and alone, to pose threats arising from both accidental and deliberate misuse. During the past six months, the potential for artificial intelligence tools to empower individuals to misuse biology has become far more apparent.”

The same sidebar also explains that “Two other types of biological risks remain causes for concern: accidental release of organisms from laboratories and naturally occurring infectious diseases, especially those with pandemic potential. Deforestation, urbanization, and climate change continue to destabilize microbe-host relationships and facilitate the emergence of infectious diseases. Meanwhile, high-biosafety-level laboratories have proliferated around the world, as has risky research motivated by interests in controlling these diseases. Despite the importance of understanding and countering naturally occurring biological threats, it isn’t clear that all of these high-biosafety-level laboratories or high-risk experiments are needed for achieving these goals. As the number of laboratories and amount of risky research increases, and the failure to standardize safe laboratory practices and to institute adequate research oversight persists, the risk of accidental release of dangerous pathogens worsens.”

HHS Announces New Voluntary Performance Goals, Resources for Health Sector Cybersecurity

This week, the Department of Health and Human Services announced via the Administration for Strategic Preparedness and Response (ASPR) that it is releasing “voluntary health care specific cybersecurity performance goals (CPGs) and a new gateway website to help Health Care and Public Health (HPH) sector organizations implement these high-impact cybersecurity practices and ease access to the plethora of cybersecurity resources HHS and other federal partners offer.”

The statement further explained “As outlined in the recent HHS Health Care Sector Cybersecurity concept paper, HHS is publishing the CPGs to help health care organizations, and health care delivery organizations in particular, prioritize implementation of high-impact cybersecurity practices. The HPH CPGs are designed to better protect the healthcare sector from cyberattacks, improve response when events occur, and minimize residual risk. HPH CPGs include both essential goals to outline minimum foundational practices for cybersecurity performance and enhanced goals to encourage adoption of more advanced practices.”

Read more here.

“Sonia Ben Ouagrham-Gormley on Barriers to Bioweapons”

From Hear This Idea: “Sonia Ben Ouagrham-Gormley is an associate professor at George Mason University and the deputy director of their biodefense program. Sonia has written extensively on the proliferation and non-proliferation of bioweapons, being one of the key voices to have emphasized the challenges that organizations, tacit knowledge, and other factors have caused for states and terrorists that have attempted to acquire weapons of mass destruction.”

“In this episode we talk about:

Misconceptions around the ease of bioweapon production — how and why bioweapons programs face unique challenges compared to nuclear weapons programs
The crucial role of tacit knowledge in bioweapons production
Will AI make bioweapons much easier to develop, or will human expertise remain a major bottleneck?
Case studies of bioweapons programs, illustrating the practical difficulties and failures encountered even by well-resourced state actors.
(How) has Biological Weapons Convention prevented bioweapon proliferation?
Do global political trends point towards proliferation, even without AI?”

“How Reliable is ISIS’s Claiming Responsibility for Deadly Attacks in Iran?”

Schar School associate professor Mahmut Cengiz recently authored this piece for Homeland Security Today, in which he writes in part “These discrepancies related to the twin blasts bring up a question of how reliable ISIS is when the group claims responsibility for terrorist attacks. Terrorist groups aim to take credit when a group spokesperson, on behalf of the organization, states that the group is the perpetrator of the attack. They tend to claim responsibility for attacks—targeting state institutions and the military rather than civilians— when they aim to gain publicity and when the backlash from the government is not likely. As opposed to terrorist attacks that claimed most responsibility in the 1980s and 1990s, every one of seven attacks has been recorded claiming responsibility since 2018. According to the Global Terrorism and Trends Analysis Center (GTTAC) Records of Incidents Database (GRID), the attacks by ISIS and its affiliated organizations steadily increased from 2018 to 2022. They conducted 873 attacks in the first ten months of 2023. Contrary to increasing attacks, its attacks of claiming responsibility slightly increased between 2018 and 2020 and dropped in 2021 and 2022. ISIS groups claimed responsibility in its 161 attacks. “

“Beyond Borders, Beyond Biases: Building a Biosecure Future with Diverse Voices”

Aparupa Sengupta, Senior Program Officer for Global Biological Policy and Programs at NTI, discusses the importance of diversity and inclusion in biosafety and biosecurity governance in this piece for NTI. She writes in part “At NTI, we believe the greatest risk of these catastrophic effects is from the accidental or intentional misuse of a bio-engineered agent. Therefore, we focus on developing stronger biosafety and biosecurity policies and practices to protect against these manmade risks. This work requires global cooperation and shared responsibility, and an understanding that diverse perspectives and experiences are essential. Without them, we will face widening knowledge gaps and international resentment, ultimately sabotaging our ability to collectively address bio threats.”

“Recently, the Center for Security and International Studies (CSIS) published a report recommending actions to strengthen global biosafety and biosecurity. As someone with more than 15 years of experience working in the interface of science, technology, and biosafety/security, I endorse all eight recommendations in the report but suggest adding a ninth one to the list: “Prioritize diversity and inclusion for effective global biosafety and biosecurity governance.”’

“Did China Keep the COVID Virus Sequence Secret for Weeks?”

Matt Field breaks down questions surrounding China’s sharing of the SARS-CoV-2 genetic sequence in the early days of COVID-19 in this piece for the Bulletin of the Atomic Scientists: “In outbreak response, speed is critical as authorities seek to quickly determine the cause of a disease and prevent it from spreading. A new report is now raising fresh questions about China’s early response to COVID-19. The Wall Street Journal revealed Wednesday that a researcher in Beijing attempted to upload the genetic sequence SARS-CoV-2, the virus that causes COVID, to a US-based public database about two weeks before the Chinese government publicized the pathogen’s sequence, a lag that potentially robbed scientists and health officials of valuable time.”

“Investigating the Potential Strategic Implications of COVID-19 for Biological Weapons Pursuit: A New Expert Simulation”

Ackerman et al. recently published this article in Health Security: “To investigate the impact of the COVID-19 pandemic on the strategic decisionmaking of leaders with respect to biological weapons, this study employed a prospective simulation technique called Asynchronous Strategic Dynamics Red Teaming. Using an immersive, multimedia simulation conducted remotely and asynchronously, the effort engaged 240 carefully selected and curated expert participants in either biological weapons or the countries of interest (as well as 60 naïve participants). Across our sample of 30 countries, simulated interest in pursuing some type of biological weapons program (defensive or offensive) remained low to moderate. While such interest increased after the simulated onset of the COVID-19 pandemic, it was limited overall, with only a handful of states showing salient increases in offensive biological weapon interest. When directly referencing why their countries might have changed their post-COVID-19 interest in biological weapons, the most commonly cited reasons were: (1) COVID-19 demonstrated the power of biological weapons to disrupt societies and cause large-scale economic harm, and (2) the pandemic revealed either the state’s own or its rivals’ vulnerability to diseases like COVID-19, as well as an inability to efficiently respond and contain such diseases. In sum, despite a global pandemic with massive consequences, the simulation revealed that most states are not likely to dramatically change their strategic posture regarding pursuit of offensive biological weapons.”

“Catalogue of Civil Society Assistance for BWC States Parties”

From the Stimson Center: “The Catalogue of Civil Society Assistance to States Parties annually highlights the contributions of civil society to the BWC and States Parties and to the enhancement of biological safety and security. From Ottawa to Hamburg, there are civil society assistance programs across the world that are available to support the implementation of the BWC. The catalogue includes organization and project descriptions and points of contact for each program, which aims to facilitate stronger connections between civil society and State Parties in need of assistance.”

“The Operational Risks of AI in Large-Scale Biological Attacks”

New from RAND: “The rapid advancement of artificial intelligence (AI) has far-reaching implications across multiple domains, including concern regarding the potential development of biological weapons. This potential application of AI raises particular concerns because it is accessible to nonstate actors and individuals. The speed at which AI technologies are evolving often surpasses the capacity of government regulatory oversight, leading to a potential gap in existing policies and regulations.”

“In this report, the authors share final results of a study of the potential risks of using large language models (LLMs) in the context of biological weapon attacks. They conducted an expert exercise in which teams of researchers role-playing as malign nonstate actors were assigned to realistic scenarios and tasked with planning a biological attack; some teams had access to an LLM along with the internet, and others were provided only access to the internet. The authors sought to identify potential risks posed by LLM misuse, generate policy insights to mitigate any risks, and contribute to responsible LLM development. The findings indicate that using the existing generation of LLMs did not measurably change the operational risk of such an attack.”

“Implementing The Bioeconomy Executive Order: Lessons Learned And Future Considerations”

Nazish Jeffrey breaks down the Federations of American Scientists’ Bioeconomy EO Tracker in this piece, writing “With the U.S. bioeconomy valued at over $950 billion and predicted to steadily increase, the potential for significant economic impact is unmistakable. To leverage this economic opportunity, the 2022 Bioeconomy Executive Order (EO) took a significant step towards addressing the complexities of the bioeconomy and creating a whole-of-government approach. The scope of the EO was vast, assigning around 40 tasks to many different federal agencies, in order to create a national framework to leverage bio-based innovations for sustainable economic growth.”

“To track the numerous tasks assigned by the EO, the Federation of American Scientists have put together a living Bioeconomy EO tracker to monitor the progress of these tasks, enhance accountability and to allow stakeholders to stay informed on the state of the U.S. bioeconomy as it evolves. This FAS tracker was inspired by the initial tracker created by Stanford University when the EO was first published.”

“Public Health Preparedness: HHS Emergency Agency Needs to Strengthen Workforce Planning”

In this new Government Accountability Office report, GAO recommends that “ASPR (1) establish specific goals and performance measures to use for its new hiring office once it is fully operational, (2) develop tailored strategies for recruiting and hiring human capital staff for the new office, (3) identify the critical areas that need workforce assessments and develop plans to implement them, and (4) conduct an agency-wide workforce assessment. HHS neither agreed nor disagreed with the first two recommendations and agreed with the last two recommendations. GAO believes actions are needed to address all of the recommendations.”

Read more here.

“Dissecting Pandemic-Prone Viral Families Volume 2: The Paramyxoviridae”

Amesh A. Adalja covers the Paramyxoviridae family in this volume of Johns Hopkins Center for Health Security’s Dissecting Pandemic-Prone Viral Families,” writing in part “Paramyxoviridae is a large viral family that contains many once common and wellknown human pathogens, such as measles and mumps, as well as other pathogens that pose concerns for their potential to cause epidemic or pandemic disease.1″

“This family of viruses infects a wide variety of species, ranging from reptiles to rodents and fish to birds. While diseases such as measles and mumps cause little morbidity and mortality in advanced societies today—because of high levels of vaccine-induced immunity—other members of this viral family have considerable burdens of infection with attendant morbidity and mortality risks. Also, within this family, there is one genus of consequence – Henipavirus – that has already been responsible for a number of serious emerging infectious diseases. The table below summarizes key genera and viruses of this family.1”

“The Overlooked Bacterial Pandemic”

Moriel et al. recently published this work in Seminars in Immunopathology: “The COVID-19 pandemic had a significant economic and health impact worldwide. It also reinforced the misperception that only viruses can pose a threat to human existence, overlooking that bacteria (e.g., plague and cholera) have severely haunted and shaped the course of human civilization. While the world is preparing for the next viral pandemic, it is again overlooking a silent one: antimicrobial resistance (AMR). This review proposes to show the impact of bacterial infections on civilization to remind the pandemic potential. The work will also discuss a few examples of how bacteria can mutate risking global spread and devastating outcomes, the effect on the global burden, and the prophylactic and therapeutic measures. Indeed, AMR is dramatically increasing and if the trend is not reversed, it has the potential to quickly turn into the most important health problem worldwide.”

“Etymologia: Ring Vaccination”

Sharma et al. recently published this short piece covering ring vaccination’s etymology in Emerging Infectious Diseases: “Ring Vaccination [rɪŋ-væk-sɪ′-neɪ-ʃn] Ring vaccination (expanding ring, surveillance and containment) is a public health measure designed to prevent spread of disease from infected persons to others. This approach targets persons who have had close contact with confirmed or suspected cases and are at a higher risk of infection by vaccinating them first (Figure).”

Read more here.

“Russian Military Thought and Doctrine Related to Non-strategic Nuclear Weapons: Change and Continuity”

William Alberque tackles Russian nuclear doctrine in this report for the International Institute for Strategic Studies: “Russian nuclear doctrine, especially regarding its large stockpile of non-strategic nuclear weapons, has become one of the most pressing issues in Euro-Atlantic security. This report aims to build an understanding of Russia’s strategic nuclear weapons doctrine through empirical research, including by examining the continuities and discontinuities in doctrine across time, through the Cold War, to the collapse of the Soviet Union, to Russia’s annexation of Crimea, and in Russia’s ongoing war on Ukraine.”

Global Partnership Against the Spread of Weapons and Materials of Mass Destruction Newsletter

The Global Partnership Against the Spread of Weapons and Materials of Mass Destruction’s newsletter is published quarterly and is available for subscription here. This quarter’s edition focuses on Italy’s upcoming Global Partnership presidency, the Partnership’s 2023 Programming Annex, featured articles, community updates, and more.

“UNITAD – Key Investigations as UN Mechanism Reaches Its Final Reporting Year”

Sam Biden covers the work of the UN Investigate Team to Promote Accountability Crimes Committed by Da’esh/ISIL (UNITAD), providing an overview of its key investigations in the last two years in this piece for the Human Security Centre. This includes UNITAD’s work on biological and chemical weapons, under which Biden explains in part, “2023 marked a significant stride in the relentless pursuit of accountability for ISIL’s chemical and biological weapons program. The investigation during this reporting period yielded substantial evidence from earlier inquiries strategies regarding the production and delivery of the weapons themselves. These key lines of inquiry harnessed new collaborations with technical experts, including those from the Mine Action Service, provided essential insights into a wide array of attacks. UNITADs work extended to collecting and preserving evidence linked to 12 attacks yet continued to focus on gathering further evidence from the 2016 attack on Tazah Khurmatu. This ultimately led to the collection of new battlefield evidence and files, shedding light on ISIL’s operations in Kirkuk and implicating specific persons of interest. A comprehensive report focused on the 2016 attack on Tazah Khurmatu was shared with the Iraqi judiciary, encapsulating critical findings from the ongoing investigation.”

ICYMI-“Event Summary: U.S.–UK Strategic Dialogue on Biosecurity”

“On January 16, the Council on Strategic Risks (CSR) hosted senior government leaders for the launch of the U.S.–UK Strategic Dialogue on Biosecurity at the historic National Academy of Sciences Building in Washington, D.C.”

“Building upon decades of partnership between the two countries, the Strategic Dialogue is a core component of the Atlantic Declaration—the new bilateral economic partnership established in 2023 to adapt, reinforce, and reimagine the U.S.-UK alliance for the challenges of the twenty-first century. Following the event, the U.S. National Security Council and the UK Cabinet Office released a joint statement outlining the Strategic Dialogue’s intent, including coordination to uphold global norms and commitments to lead on innovation in biotechnology and biosecurity.”

Read more here.

NEW: AI Rewards, Risks, and the Future of Biosecurity by Design (Pandemic Center Webinar)

From the Brown School of Public Health: “On January 24th at 1:00 PM EST the Pandemic Center will host a webinar titled AI Rewards, Risks, and the Future of Biosecurity by Design.”

“This event will bring together experts in biosecurity, global health, and pandemic prevention and response. Together, they will discuss the relationship between AI and biosecurity, with a focus on benefits, risks, and pragmatic solutions.”

“This event will be hosted and moderated by Beth Cameron, PhD, Professor of the Practice and Senior Advisor to the Pandemic Center.”

Learn more and register here.

NEW: Kazakhstan’s Actions to Address Nuclear and Biological Risks

From the Cargenie Endowment for International Peace: “Upon the 1991 collapse of the Soviet Union, Kazakhstan found itself in possession of the world’s fourth-largest nuclear weapons stockpile and the former union’s most significant biological weapons factory. Kazakhstan’s subsequent decision to return and dismantle these weapons has solidified its position as a leader in nuclear and biological risk reduction. For the last thirty years, Kazakhstan’s actions have served as a core model for regional and international security.”

“Please join the Carnegie Endowment and the Council on Strategic Risks for a hybrid panel on Kazakhstan’s increasingly global role in the changing threat landscape of weapons of mass destruction. The discussion will feature Kazakhstan’s Ambassador to the United States of America Yerzhan Ashikbayev, the Honorable Andrew Weber, and Dr. Toghzan Kassenova. It will be moderated by Shannon Green, senior fellow at the Council on Strategic Risks.”

This event will take place on January 30 at 1:30 pm EST. Learn more and RSVP here.

NEW: WEBINAR: State Department 2023 Global Terrorism Data: Trends & Warnings

From Homeland Security Today: “Join HSToday for a Law Enforcement-only analysis of global terrorism trends from 2023 and threat forecasts for 2024. The Department of State’s yearly Annex of Statistical Information Reports uses The Global Terrorism Trends and Analysis Center (GTTAC) database.”

“Dr. Mahmut Cengiz, a senior data analyst at GTTAC since 2018, will discuss terrorism trends from 2023 and areas of concern for law enforcement in the United States (US). More specifically, his analyses will focus on HAMAS and Iran-backed terror groups targeting American facilities in the Middle East, Al Qaeda- and ISIS-affiliated organizations actively involved in terrorist attacks worldwide, increasing far-right terrorism and emerging lone actor threats in the US and Europe. The Terrorism, Transnational Crime and Corruption Center (TraCCC) is the first center in the United States devoted to understanding the links among terrorism, transnational crime and corruption, and to teach, research, train and help formulate policy on these critical issues. TraCCC is a research center within the Schar School of Policy and Government at George Mason University. TraCCC also houses the innovative and highly-respected Anti-Illicit Trade Institute (AITI).”

This event will take place on February 8 at 2 pm EST. Learn more and register here.

AI Executive Order Report Card Reviewing the First 90 Days

“On October 30, 2023, the Biden Administration issued a call to action outlining a host of requirements and deliverables for U.S. government agencies on artificial intelligence. The executive order touched on a range of AI-relevant issues, including testing and evaluation of new AI systems, developing a healthy and capable U.S. AI workforce, and ensuring U.S. competitiveness in the years to come.”

“Join CSET researchers on January 31, 2024, for a discussion of what the U.S. Government has accomplished so far, what have we learned, and what’s left to do to complete the EO’s ambitious goals.”

This online event will begin at 12 pm EST. Learn more and register here.

GP Nonproliferation and Strategic Trade Hub Virtual Launch & Demo

“The Strategic Trade Research Institute (STRI) invites you to participate in the Global Partnership Nonproliferation and Strategic Trade Hub Virtual Launch and Demo event taking place on February 27, 2024, from 9:00-10:00 am EST.”

“Please join us to learn about the main features of the Hub, how to use it, and how it can be useful and impactful for nonproliferation and export control professionals. The event will feature Andrea Viski, Director of STRI, as well as introductory remarks from the Hub’s sponsor, the United Kingdom’s Counter-proliferation and Arms Control Center (CPACC).”

Learn more and register here.

International Conference, CBRNE Research & Innovation

“The last 40 years have demonstrated that both military and civilian populations could be exposed to highly hazardous CBRNE agents following conflicts, natural outbreaks and disasters, industrial incidents or terrorist attacks.”

“Worldwide, researchers, responders and industrial capacities have been commited to provide adapted response to these challenges.”

“Building on the success of the first 5 International Conferences « CBRNE Research and Innovation » which took place in Antibes (2015), Lyon (2017), Nantes (2019), on line (2021) and Lille (2022), we want to give you a new opportunity to build up or strengthen collaborative networks in Strabourg (March 19^th – 21^rst 2024).”

“The CBRNE R&I Conference is specifically devoted to scientific updates, responders’ feedbacks and expression of needs. It also includes workshops and demonstrations of innovative materials, technologies and procedures, according to the following themes: DETECTION – IDENTIFICATION, PROTECTION – DECONTAMINATION, MEDICAL COUNTERMEASURES, RISKS & CRISIS MANAGEMENT.”

“Looking forward to your proposals for communication and to welcoming you at Strasbourg in March 2024!”

Learn more here.

cbrne-ri-conference-2024-_-flyer-ppt-v06.11.2023-1 Download

Registration for GHS 2024 Now Open

Pandora Report 1.5.2024

January 5, 2024January 5, 2024 by dkellogg97, posted in Pandora Report

Happy New Year! This week covers reports of over 450 chemical attacks by Russia since the invasion of Ukraine in 2022, the fifth anniversary of DHS’ CWMD Office, and several recent publications.

Ukraine Reports Hundreds of Chemical Attacks by Russia Since Start of Invasion

In late December, the Kyiv Post published an article explaining a post from Ukraine’s Armed Forces Support Forces Command, which “claims that Russian troops have conducted 465 chemical attacks in Ukraine since the initiation of the full-scale invasion, with over 80 such attacks in December 2023, including one grenade containing a new, unknown chemical agent…The command notes an escalating trend in the use of such weapons by Russian forces, highlighting eight chemical attacks on Dec. 19 alone.”

The article continues, explaining “The commonly used weapons include grenades like K-51, RGR, and Drofa-PM gas hand grenades dropped from unmanned aerial vehicles (UAVs). Additionally, improvised explosive devices equipped with irritant substances and artillery shelling containing chemically dangerous substances are being employed.”

“The report mentions that 28 cases involving dangerous chemicals were documented and forwarded for investigative actions as part of criminal proceedings by groups of radiation, chemical, and biological intelligence from the military units of the Support Forces Command, working in collaboration with the Security Service of Ukraine (SBU).”

In case you missed it: Last summer, the Royal United Services Institute published an article on this topic, exploring the reported limited use of riot control agents and broader deployment of CW by Russia could mean in this war. The piece offers insight into Russia’s potential ogic in using these kinds of weapons in Ukraine, making it helpful in understanding this latest reporting.

DHS Celebrates Five Years of the Countering Weapons of Mass Destruction Office

In late December, the Department of Homeland Security celebrated the fifth anniversary of the founding of the Countering WMD Office. In an email update from the Department, Assistant Secretary for the Countering Weapons of Mass Destruction Office, Mary Ellen Callahan, was quoted saying “The threat of weapons of mass destruction terrorism is real. Five years ago, in the face of a dynamic, evolving threat environment, legislators recognized that the U.S. needed a more holistic approach to countering chemical, biological, radiological, and nuclear threats to the Homeland…By authorizing CWMD, the legislators enabled us to enhance and coordinate the chemical, biological, radiological, and nuclear detection efforts of federal, state, local, tribal, and territorial governments to improve preparedness and response capabilities throughout the United States. We look forward to continuing this essential mission to protect the American people.”

The update further explained “Congress established the CWMD Office in 2018 to elevate, consolidate, and streamline DHS efforts to protect the Homeland from weapons of mass destruction (WMD) and chemical, biological, radiological, and nuclear (CBRN) threats. CWMD serves as the DHS nexus for WMD and CBRN coordination, which includes providing direct financial and operational support nationwide to government and industry partners for full-time biological detection, illicit nuclear material detection, training, and exercises. Additionally, as part of the President’s Executive Order on AI signed in October 2023, President Biden tasked CWMD with helping to evaluate and mitigate the potential for AI to be used to develop WMDs, such as through AI-enabled misuse of synthetic nucleic acids to create biological weapons. The President directed the CWMD Office to evaluate the potential for AI to lower the barriers to entry for developing WMD and to develop a framework to evaluate and stress test synthetic-nucleic acid screening, creating a standardized set of expectations for third parties that audit AI systems to prevent the risk of abuse and proliferation by malicious actors.”

Defense Dossier Issue 38: “Pandemic Preparedness and Biodefense”

The American Foreign Policy Council’s December Defense Dossier is focused on biodefense and pandemic preparedness, featuring an article-“Parsing the Great Gain of Function Debate”-co-authored by Biodefense PhD Program alumni Yong-bee Lim and Saskia Popescu. It also includes other articles like “China’s Evolving Thinking About Biotechnology,” and “Understanding the Cyberbiosecurity Threat.” Read here.

“Virology-the Path Forward”

Rasmusen et al. recently published this commentary article in the Journal of Virology. They write in their abstract, “In the United States (US), biosafety and biosecurity oversight of research on viruses is being reappraised. Safety in virology research is paramount and oversight frameworks should be reviewed periodically. Changes should be made with care, however, to avoid impeding science that is essential for rapidly reducing and responding to pandemic threats as well as addressing more common challenges caused by infectious diseases. Decades of research uniquely positioned the US to be able to respond to the COVID-19 crisis with astounding speed, delivering life-saving vaccines within a year of identifying the virus. We should embolden and empower this strength, which is a vital part of protecting the health, economy, and security of US citizens. Herein, we offer our perspectives on priorities for revised rules governing virology research in the US.”

“Interpreting the Biological Weapons Convention – What Are “Necessary Measures” Under Article IV of the Convention?”

Sally Longworth recently published this report with the Swedish Defence Research Agency. She explains in her summary, “Article IV of the Biological Weapons Convention 1972 (BWC) requires States Parties to implement national implementation measures to prohibit and prevent the development, production, stockpiling, retention, acquisition, transfer, and use of biological agents, toxins and weapons in violation of the Convention. No definition of “national implementation measures” is included in the treaty, but there has been over 50 years of State practice in implementing this obligation, which can provide guidance on how States Parties interpret the obligations under Article IV. The Final Declarations agreed by consensus by States Parties at the Convention Review Conferences held every five years are particularly useful tools in understanding what measures are required and what, if any, development there has been in interpreting Article IV. Using legal methods to interpret international treaties, this memo first analyses the obligations set out in Article IV and then considers the interpretative value of the Final Declarations in relation to the BWC. It goes on to highlight a number of measures identified by the States Parties considered necessary in the implementation of the obligations contained in Article IV and important developments in what must be covered.”

“Vision, Needs, and Proposed Actions for Data for the Bioeconomy Initiative”

The National Science and Technology Council recently released this report from the Interagency Working Group on Data for the Bioeconomy. Its executive summary explains in part, “To realize a thriving bioeconomy, the Data Initiative identifies strategic investments and opportunities to leverage and build upon existing resources. The goal is to create an interwoven data fabric that connects data with the infrastructure and computational resources necessary to analyze, synthesize, and use those data for the widest audience. This vision depends on creation and adoption of community-driven standards, both for data and for repositories to enable interoperability and integration; training and education to build the bioeconomy data workforce of tomorrow; efforts to limit and mitigate security risks; and ongoing coordination to ensure efforts keep pace with transformations in data science, computing, biotechnology and biomanufacturing. While additional data are needed, government coordination and investment in infrastructure are also needed to make best use of the existing and anticipated data.”

Furthermore, in identifies seven Core Action areas the Data Initiative indicates requires “consistent whole-of-government coordination and investments”:

Dedicated long-term funding mechanisms for data and computational resources and infrastructure;
Standards to establish common best practices that foster and strengthen a shared U.S. bioeconomy data ecosystem;
Biodata Catalog to identify extant data and metadata;
Security practices and policies that secure the data landscape while supporting innovation;
Workforce to drive U.S. leadership in the bioeconomy of the future;
Strategically Targeted Areas for Rapid Transformation (START) to determine viability and impact and chart a course for larger investments; and
Coordination of intergovernmental investments, efforts, and resources.

“FACT SHEET: Biden-⁠Harris Administration Releases Global Health Security Partnerships Annual Progress Report Demonstrating Results from United States Investments”

The White House recently released this fact sheet along with the release of its Global Health Security Partnerships Annual Progress Report. The fact sheet explains in its introduction, “The Biden-Harris Administration continues to prioritize global health security as a critical component of national biodefense. The COVID-19 pandemic, as well as HIV/AIDS, Ebola, mpox and other outbreaks in recent years, has demonstrated the catastrophic impacts infectious diseases can have on health, economies, and societies, regardless of where they start. The United States partners with countries around the world to build stronger global health security capacity – the ability to prevent, detect, rapidly respond to, and recover from new and emerging public health threats and prevent their spread across borders. Partnering with countries to stop infectious disease threats at their source, including by strengthening equitable health systems in their own countries and across regions, effectively protects the health of Americans and people across the world.”

“Exploring Actions for Epidemic and Pandemic Preparedness”

The National Academies recently released this Proceedings of a Symposium-in Brief: “Investing in pandemic preparedness ahead of disease outbreaks can greatly reduce the toll of epidemics and pandemics when they occur. Although several tools exist for assessing pandemic preparedness at an epidemiological and operational level, less information and fewer approaches are available to guide the prioritization of preparedness investments at the country level. The National Academies of Sciences, Engineering, and Medicine held an international, virtual symposium series in May and June 2023 to explore possible strategies for evidence-based prioritization of global health capabilities to prepare for future epidemics and pandemics. Speakers and participants discussed assessment tools for national action planning; country and organizational decision-making about funding priorities; effective approaches for disease surveillance and risk communication; governance structures that support robust and reliable systems for global health investments; and specific actions for tools and resource prioritization for preventing and preparing for future epidemics and pandemics. This publication summarizes the presentation and discussions of the symposium.”

“America Should Be More Like Operation Warp Speed”

Gary Hamel and Michele Zanini recently published this Ideas piece in The Atlantic focused on how OWS offers lessons for the rest of the government in achieving goals. They write in their introduction, “The U.S. government can achieve great things quickly when it has to. In November 2020, the Food and Drug Administration granted emergency-use authorization to the Pfizer-BioNTech vaccine for COVID-19. Seven days later, a competing vaccine from Moderna was approved. The rollout to the public began a few weeks later. The desperate search for a vaccine had been orchestrated by Operation Warp Speed, an initiative announced by the Trump administration that May. Developing, testing, manufacturing, and deploying a new vaccine typically takes a decade or more. OWS, which accomplished the feat in months, belongs in the pantheon of U.S. innovation triumphs, along with the Manhattan Project and the Apollo moon-landing program. It’s a case study in how the U.S. government can solve complex, urgent problems, and it challenges the narrative that public institutions have lost their ability to dream big and move fast.”

“Why the World Needs Its Own Immune System”

Atul Gawande, USAID’s Assistant Administrator for Global Health, recently published this opinion piece in The New York Times. He writes in part, “This is now the pattern: one emergency after another, often overlapping, diverting focus away from longer-term public health goals. And there’s no sign of this letting up. Displacement and activities like deforestation have increased contact between humans and wildlife — and thus the incidence of animal diseases leaping to humans. (The Ebola virus, for example, has been linked to bats as a possible source of spread.) The risk of outbreak-causing laboratory accidents is a significant concern as labs proliferate and safety measures lag. On average, between 1979 and 2015, more than 80 laboratory-acquired infections were reported per year, several involving transmission beyond those initially infected, and underreporting is rife. The growing field of synthetic virology has simultaneously generated lifesaving new treatments (mRNA vaccines, for example) and made it easier for bad actors to turn infectious diseases into weapons of mass destruction.”

“But we can break the pattern. Longer-range investment in local preparedness for such events — in building what I think of as a global immune system — could reduce the threat these crises pose and even reduce dependence on foreign aid to weather them. As dangers rise, so can our capacity to get ahead of them. With the right strategy, we could use the mishaps, malefactors and shocks we face to strengthen our capacity to adapt. This is not about developing resilience (the ability to recover from crisis) or robustness (the ability to resist crisis). It is about developing what the writer Nassim Nicholas Taleb has called antifragility — the ability to become stronger from crisis.”

“The OPCW and Civil Society: Considerations on Relevant Themes and Issues”

Alexander Ghionis recently published this working paper for CBWNet. He explains in its executive summary, “This paper explores some key elements of the relationship between the Organisation for the Prohibition of Chemical Weapons (OPCW) and civil society, with the specific and limited aim of supporting ongoing discussions being held within the OPCW regarding options and mechanisms to enhance that relationship. The paper is designed to be practical, providing readers from State Parties, the Technical Secretariat, civil society, and other stakeholders, with some initial perspectives, ideas, and considerations that could inform discussions.”

The paper addresses “The composition and focus of accredited civil society organisations (CSOs); How CSOs have engaged with the OPCW so far and what alternative modes of engagement may be beneficial; and, What foundational aspects can strengthen the relationship between the OPCW and civil society moving forward.”

“The Altered Nuclear Order in the Wake of the Russia-Ukraine War”

Rebecca Davis Gibbons, Stephen Herzog, Wilfred Wan, and Doreen Horschig recently published this research paper with the American Academy of Arts & Sciences. They explain in their executive summary: “On February 24, 2022, Russia invaded nonnuclear-armed Ukraine and leveraged threats with its nuclear arsenal as a “shield” to deter third-party intervention. The well-publicized horrors on the ground in Ukraine are, unfortunately, not the only consequences of Russia’s full-scale invasion of its neighbor. The war is having unmistakable effects on how governments, scholars, and the public think about nuclear arms. Not only has Moscow reintroduced the world to the often-unsavory realities of nuclear deterrence, but its suspension of the New Strategic Arms Reduction Treaty (START) and deratification of the Comprehensive Nuclear-Test-Ban Treaty (CTBT) have been setbacks for arms control and disarmament. Meanwhile, vulnerable states around the globe may be further incentivized to develop nuclear weapons or seek protection from nuclear-armed patrons to avoid being invaded like Ukraine.”

“Given these changing geopolitical circumstances, how might the Russian war on Ukraine affect the global nuclear order? The authors in this publication conclude that the United States and the broader international community must now more seriously engage with alternatives to traditional arms control, nonproliferation, and disarmament endeavors. Specifically, the authors discuss the increasing prominence of approaches such as the Treaty on the Prohibition of Nuclear Weapons (TPNW)—popularly known as the Nuclear Ban—and risk reduction measures. They assess whether these initiatives can have an impact in reducing nuclear dangers. Additionally, they examine temptations for states to pursue more forceful counterproliferation measures and describe the risks of doing so.”

NEW: “When Medicine Stops Saving Us: The Antimicrobial Resistance Crisis”

“Interim Dean Abel Valenzuela and the UCLA Division of Social Sciences present an exclusive screening of a new documentary from the team behind the award winning NETFLIX documentary, RESISTANCE. This genre-bending short film, HOLOBIOME, features the harrowing story of UCLA graduate Bradley Burnam’s personal encounter with a deadly superbug. Through a variety of creative elements, HOLOBIOME examines the need for innovation in AMR and questions the overall human relationship with infectious disease and the microbial world. The screening will be followed by an interdisciplinary panel discussing the looming AMR crisis through the lenses of sociology, public policy, industry, and public health.”

This event will be moderated by Biodefense PhD Program alumna Jomana Musmar. It will take place on January 22, at 5 pm PST. Learn more and register here.

NEW: AI Executive Order Report Card Reviewing the First 90 Days

This online event will begin at 12 pm EST. Learn more and register here.

International Conference, CBRNE Research & Innovation

“Worldwide, researchers, responders and industrial capacities have been commited to provide adapted response to these challenges.”

“Looking forward to your proposals for communication and to welcoming you at Strasbourg in March 2024!”

Learn more here.

cbrne-ri-conference-2024-_-flyer-ppt-v06.11.2023-1 Download

Registration for GHS 2024 Now Open

Vote: 2023 Arms Control Person(s) of the Year Nominees

“Since 2007, the independent, nongovernmental Arms Control Association has nominated individuals and institutions that have, in the previous 12 months, advanced effective arms control, nonproliferation, and disarmament solutions and raised awareness of the threats posed by mass casualty weapons.”

“In a field that is often focused on grave threats and negative developments, the Arms Control Person(s) of the Year contest aims to highlight several positive initiatives—some at the grassroots level, some on the international scale—designed to advance disarmament, nuclear security, and international peace, security, and justice.”

“Voting will take place between Dec. 8, 2023, and Jan. 11, 2024. The results will be announced on Jan. 12, 2024. Follow the discussion on social media using the hashtag #ACPOY2023.”

Learn about the nominees and vote here.

Pandora Report 12.22.2023

December 22, 2023December 22, 2023 by dkellogg97, posted in Pandora Report

Happy first day of winter! This week we are covering updates on Russia’s actions in Ukraine, anthrax outbreaks in parts of Africa, efforts to get the Pandemic and All-Hazards Preparedness Act reauthorized, and OpenAI’s plan to manage threats posed by its AI platforms. This is the last issue of the Pandora Report for 2023. We will see you next year but, until then, have a happy rest of the holiday season!

Russia Tear Gases Ukrainian Forces

Recent reporting from CNN explained that, in addition to using wave after wave of convicts-turned-recruits, Russia has increasingly begun to use CS gas on Ukrainian forces: “Those fighting in besieged Ukrainian trenches say they now face another threat: the use of gas as a weapon. Nine incidents have been recorded in recent weeks in this area, one Ukrainian combat medic told CNN, in which a caustic and flammable gas had been dropped by drones onto Ukrainian lines, causing one fatality. The gas is used to cause panic and followed by conventional shelling or drone attacks, soldiers impacted said…A Ukrainian intelligence official told CNN the substance deployed by the Russians was a form of CS gas.”

CS (chlorobenzylidenemalononitrile) gas, commonly referred to colloquially as tear gas, is used as a riot control agent. According to the CDC, these agents “…are chemical compounds that temporarily make people unable to function by causing irritation to the eyes, mouth, throat, lungs, and skin.” Use of these agents in war is prohibited under the Chemical Weapons Convention.

The same CNN report later explained that “Two soldiers who survived a gas attack showed CNN medical reports indicating they had been poisoned. “At first I saw smoke,” one told CNN. “We ran out from the trench and the gas suddenly caught fire. The trench was in flames. This gas burns, blinds you, you can’t breathe, shoots down your throat immediately. We didn’t even have a second.”‘

“The alleged use of chemical agents on the battlefield marks another sign of the brutality and mendacity of Russia’s renewed fight for the terrain it lost. Ukraine had hoped for greater advances during the summer toward the Azov Sea, yet now must defend its minor gains.”

Russian Troops Reportedly Dying from “Mouse Fever”

Russian troops in Ukraine’s Kharkiv region are reportedly suffering an outbreak of “mouse fever,” a hemorrhagic fever. Ukraine’s Main Directorate of Intelligence of the Ministry of Defence of Ukraine (HUR) recently reported that “dissatisfaction is growing in the units of the Russian occupation army due to inadequate provision of winter clothing and a complete lack of medical care,” likely contributing to the rapid spread of this disease.

The Kyiv Post also explained that HUR reports that complaints about the outbreak on the front lines fell on deaf ears, with Russian leadership viewing them as “…another manifestation of attempts to avoid combat operations.” HUR has also reported that the disease initially presents with flu-like symptoms, and that it is a viral disease transmitted to humans from rodents via contact with bodily fluids. As the same Kyiv Post article explains, “Symptoms of mouse fever include severe headache, fever up to 40 degrees, rashes and redness, low blood pressure, hemorrhages in the eyes, nausea, and vomiting several times a day. The disease also affects the kidneys, a person infected with mouse fever experiences intense low back pain and will have serious difficulty urinating.”

HUR’s reporting on the outbreak did not identify a specific pathogen, though it did suggest this could be hemorrhagic fever with renal syndrome (HFRS), driving online speculation that this outbreak was caused by a hantavirus despite some outlets reporting it was caused by the bacterial rat-bite fever. The WHO explains that HFRS is “…an acute interstitial nephropathy characterized by high fever and varying degrees of renal insufficiency and hemorrhage. HFRS is caused by viruses belonging to the old world lineage of the Hantavirus genus of the family Bunyaviridae.”

The WHO further explains that “Various haemorrhagic fevers with a very similar syndrome have been reported throughout Europe and Asia, notably HFRS in the former Soviet Union, Songo fever in China, epidemic nephritis or epidemic haemorrhagic fever in Eastern Europe and Japan, and Hantaan virus in Korea. Several rodents and other small mammals harbor hantaviruses, and in urban areas, where rodent control is feasible, efforts can be made to reduce contact between humans and rodent excreta.”

Regardless of what is causing this outbreak, this is a tale as old as time. War and disease go hand-in-hand, highlighting the importance of maintaining sanitary practices, particularly when turning to trench warfare. Russia’s military has historically struggled with maintaining sanitary conditions, as noted by Amnesty International in the late 1990s and Russia’s own inspectors in the early 2010s, all of which has conicided with persistent challenges in professionalizing the military and maintaining supply lines during the current conflict.

Five African Countries Report Anthrax Outbreaks

The WHO has confirmed that five countries in eastern and southern Africa are experiencing outbreaks of anthrax, with at least 20 related deaths reported since the start of 2023. There are currently over 1,160 presumed anthrax cases in Kenya, Malawi, Uganda, Zambia, and Zimbabwe, though only 35 have been confirmed by laboratory testing. Zambia is currently fighting its largest anthrax outbreak since 2011, with nine of its ten provinces impacted. Though experts say this all is not unusual nor unreasonable, it is notable that, in Uganda, many of the presumed cases have tested negative for anthrax, potentially indicating a different disease is circulating.

The WHO explained in its December 11 press release on the matter that, “The outbreaks are presenting varied patterns in the affected countries. In Kenya, three deaths have been reported this year compared with zero fatalities from over 200 suspected cases in 2022. While the disease is endemic in animals in Malawi, the country reported its first ever human case this year. Human anthrax cases have been reported in three districts in Uganda, with 13 deaths compared with two deaths in 2022. The high case fatality ratio is due to patients reporting late to health facilities. In Zimbabwe, human cases have been reported every year since 2019, underscoring the need for stronger preventive actions.”

“Joint multidisciplinary teams have deployed at country level to support assessments, identify gaps and take measures to strengthen the outbreak response. WHO is also working closely with the Food and Agriculture Organization of the United Nations (FAO), United Nations Environment Programme and World Organisation for Animal Health to coordinate response in the affected countries leveraging the One Health Platforms…The outbreaks are likely being driven by multiple factors, including climatic shocks, food insecurity, low risk perception and exposure to the disease through handling the meat of infected animals.”

115 Organizations Urge Congress to Reauthorize PAHPA

A list of 115 organizations is formally calling on Congress to reauthorize the bipartisan Pandemic and All-Hazards Preparedness Act (PAHPA), according to a press release from the Senate Health, Education, Labor and Pensions (HELP) Committee. PAHPA expired on September 30 and has yet to be reauthorized by Congress, though the HELP Committee did pass legislation to reauthorize it in a 17-3 vote this summer.

The HELP Committee explained in its statement “Congress first enacted PAHPA in 2006, largely to address the failures of the federal response following Hurricane Katrina. The legislation sought to support states, local governments, and hospitals so they would be better prepared for future emergencies. It established the Office of the Assistant Secretary for Preparedness and Response (ASPR) and the Biomedical Advanced Research and Development Authority (BARDA). It also made improvements to the National Disaster Medical System and other resources to improve medical surge capacity during an emergency. PAHPA was previously reauthorized on a bipartisan basis in 2013 and 2019.”

A list of the 115 organizations involved is available at the link above.

OpenAI Unveils Plan for Managing AI Dangers

OpenAI, the company perhaps most famous for its ChatGPT chatbot, recently announced how it plans to prepare for what it believes to be potential threats posed by the technology it develops. A recent article from The Washington Post explains the plan, reading “OpenAI’s “Preparedness” team, led by MIT AI professor Aleksander Madry, will hire AI researchers, computer scientists, national security experts and policy professionals to monitor the tech, continually test it and warn the company if it believes any of its AI capabilities are becoming dangerous. The team sits between OpenAI’s “Safety Systems” team, which works on such existing problems as infusing racist biases intoAI, and the company’s “Superalignment” team, which researches how to ensure AI doesn’t harm humans in an imagined future where the tech has outstripped human intelligence completely.”

“The preparedness team is hiring national security experts from outside the AI world who can help OpenAI understand how to deal with big risks. It is beginning discussions with organizations, including the National Nuclear Security Administration, which oversees nuclear technology in the United States, to ensure the company can appropriately study the risks of AI, Madry said.”

“The team will monitor how and when OpenAI’s tech can instruct people to hack computers or build dangerous chemical, biological and nuclear weapons, beyond what people can find online through regular research. Madry is looking for people who “really think, ‘How can I mess with this set of rules? How can I be most ingenious in my evilness?’”

“Dr. Jomana Musmar, MS, PhD – Designated Federal Officer and Executive Director – PACCARB”

Check out this conversation with Biodefense PhD Program alumna Jomana Musmar on the Progress, Potential, and Possibilities YouTube channel: “Dr. Jomana Musmar, MS, PhD, is the Designated Federal Officer and Executive Director of the Presidential Advisory Council on Combating Antibiotic Resistant Bacteria ( https://www.hhs.gov/ash/advisory-comm… ), and Senior Public Health Advisor within the Office of Infectious Diseases and HIV/AIDS Policy ( https://www.hhs.gov/oidp/index.html ), at the U.S. Department of Health and Human Services (HHS).”

“The Presidential Advisory Council on Combating Antibiotic-Resistant Bacteria ( PACCARB – https://www.hhs.gov/ash/advisory-comm… ) is a US federal advisory committee that provides advice, information, and recommendations to the U.S. Secretary of Health and Human Services (HHS Secretary). The council supports and evaluates U.S. government activities focused on fighting antimicrobial resistance (AMR) in human health, animal health, and environmental health. Using this One Health approach, members of the PACCARB have expertise from a range of backgrounds, including academia, industry, public health, advocacy, veterinary, and agricultural production.”

“Dr. Musmar has been managing the PACCARB since its establishment in 2015, during which time she has hosted 24 public meetings and overseen the development of seven reports providing recommendations on a range of issues related to antimicrobial-resistance (AMR) for both human and animal health.”

“Dr. Musmar has over 10 years of Federal Advisory Committee experience, with a focus on the areas of public health, biodefense, and AMR. Her graduate degrees include a Master’s in Biomedical Science Policy from Georgetown University School of Medicine and a Doctorate in Biodefense and Homeland Security from George Mason University.”

“The Health Security Outcomes of APEC and the Biden-Xi Dialogue”

Recent Biodefense MS grad Sophie Hirshfield just published this piece for CSIS, addressing key global health questions following the APEC summit and Biden-Xi meeting. She explains in her introduction, “From November 14 to 16, leaders from the 21-member Asia-Pacific Economic Cooperation (APEC) group met in San Francisco to discuss promoting trade and economic growth across the Pacific region. On the sidelines of the forum, Presidents Joe Biden and Xi Jinping convened for their first in-person meeting in a year. While the meetings provided an opportunity to keep public health priorities on the diplomatic agenda, they led to few meaningful new commitments on U.S.-China health security cooperation.”

“Public Health Agencies Are Using AI Chatbots to Ease Workloads. Is It a Good Idea?”

Biodefense PhD Student Kimberly Ma recently published this piece with The Bulletin of the Atomic Scientists. In it, she explains in part, “There’s a real risk that large-language models like ChatGPT contribute to online disinformation and misinformation. In a call earlier this year for the safe and ethical use of AI, the World Health Organization (WHO) worried that AI responses “can appear authoritative and plausible to an end user” but be “completely incorrect or contain serious errors, especially for health-related” matters. Similarly, the organization warned AI may be “misused to generate and disseminate highly convincing disinformation in the form of text, audio or video content that is difficult for the public to differentiate from reliable health content.” Just as media organizations have been caught publishing AI-generated content riddled with inaccuracies, public health workers need to ensure they are not accidentally producing well-intentioned deliverables with critical errors. And in an environment when adversarial countries, antivaxxers, and politicians operate individually or in networks to spread disinformation online, public health agencies will be up against bad actors with the same technology they have.”

“Preparing for the Next Pandemic Response Through Strengthened Collaboration”

Donnel Harvin, a member of the Schar School faculty, recently co-authored this white paper for NEMA: “This report synthesizes the insights from the National Emergency Management Association (NEMA) Pandemic Workshop hosted in June of 2023. The Centers for Disease Control and Prevention (CDC) funded the project. The workshop brought together emergency management directors and state public health officers from eight states to discuss their collaborative response to the COVID-19 pandemic in the very early phases of the response, January 2020 – January 2022. The particular focus was on the identification of friction points, successes, and opportunities for increased collaboration. Federal partners were invited to discuss issues with federal integration into state COVID-19 response efforts. The discussions highlighted a range of complex issues encompassing roles and authorities, data collection and sharing, equity concerns, and communication, with an emphasis on state and local levels as well as rural and urban experiences.”

10.01.2023-nema-white-paper-preparing-for-the-next-pandemic-response-through-strengthened-collaboration-2 Download

“Advancing Governance Models for Frontier for AIxBIO: Key Takeaways and Action Items from the Johns Hopkins Center for Health Security Metting with Industry, Government, and NGOs, 29 November 2023”

Johns Hopkins Center for Health Security recently published a “…summary of high-level findings that identify concrete next steps needed following its recent convening of leading AI labs, executive branch officials, and biosecurity experts…” that “was informed by discussions during a not-for-attribution meeting hosted by the Center. The meeting was attended by around 50 participants, including those from 6 different leading AI companies as well as government officials from the White House and several government agencies with responsibility for managing potential AIxBio risks.”

The report calls for “…the creation of an ongoing public-private forum to facilitate the sharing of important information related to biosecurity risks; a regulatory framework that defines mandatory practices, reporting, and oversight of highly capable AI models; and a legal accountability framework to incentivize developers and deployers of models to adequately address emergent risks.”

“Generative AI and Weapons of Mass Destruction: Will AI Lead to Proliferation?”

Ian Stewart unpacks potential proliferation threats posed by LLMs in this Medium post, writing in part “Large Language Models (LLMs) caught popular attention in 2023 through their ability to generate text based on prompts entered by the user. LLMs have also proven capable of generating code, summarizing text, and adding structure to unstructured text, among others. There remain questions around the real-world usefulness of LLMs in many domains, particularly given some of the difficulties in solving limitations of LLMs such as hallucination. Nonetheless, some have raised concerns about the ability of LLMs to contribute to nuclear, chemical and biological weapons proliferation (CBRN). Put simply, could a person learn enough through an interaction with an LLM to produce a weapon? And if so, would this differ from what the individual could learn by scouring the internet?”

“Poll: Voters Support Bringing EU-Style AI Regulations to the US, Prioritizing Safety Over Speed in Research”

New from the Artificial Intelligence Policy Institute: “A new poll conducted by the Artificial Intelligence Policy Institute (AIPI) shows that the American public supports the passage of the European Union’s AI Act by nearly a 4:1 margin, and 64% support similar regulation in the United States.”

“The survey showed strong public support for a slowdown of AI research and skepticism of tech companies; respondents decisively back federal regulation that curbs rapid AI research and development by private companies. By a 2:1 margin, respondents agree that it is the role of the government to make sure companies don’t go too fast when developing AI models. 75% say the government should restrict what private companies can do when training AI models.”

“AIPI also surveyed public opinion on risky research initiatives across AI development and dangerous virus research—particularly relevant as scientists and the federal government look to revise guidelines on potential pandemic pathogens. 83% of the public is in agreement that the federal government should implement renewed oversight protocols on research experiments using dangerous viruses. When prompted about AI being in such research, 68% say that we should be concerned that bad actors could use AI to create biological weapons.”

“Shaping the Future US Bioeconomy Through Safety, Security, Sustainability, and Social Responsibility”

Attal-Juncqua et al. recently published this article in Trends in Biotechnology: “Biomanufacturing practitioners and researchers describe the norms that should govern the growing, global field, to include safety, security, sustainability, and social responsibility. These ‘4S Principles’ should be broadly adopted so that the future of the field may provide the greatest benefits to society.”

“Stability of Pathogens on Banknotes and Coins: A Narrative Review”

Meister et al. recently published this article in the Journal of Medical Virology: “For the prevention of infectious diseases, knowledge about potential transmission routes is essential. Pathogens can be transmitted directly (i.e. respiratory droplets, hand-to-hand contact) or indirectly via contaminated surfaces (fomites). In particular, frequently touched objects/surfaces may serve as transmission vehicles for different clinically relevant bacterial, fungal, and viral pathogens. Banknotes and coins offer ample surface area and are frequently exchanged between individuals. Consequently, many concerns have been raised in the recent past, that banknotes and coins could serve as vectors for the transmission of disease-causing microorganisms. This review summarizes the latest research on the potential of paper currency and coins to serve as sources of pathogenic viral, bacterial, and fungal agents. In contrast to the current perception of banknotes and coins as important transmission vehicles, current evidence suggests, that banknotes and coins do not pose a particular risk of pathogen infection for the public.”

What We’re Watching 🍿

The Biological Weapons Convention and the Need for a Compliance and Verification Mechanism

New from the Geneva Center for Security Policy: “The GCSP’s Head of Arms Control and Disarmament speaks to three experts on biological security from King’s College London about the start of discussions by the States Parties to the Biological Weapons Convention (BWC) on compliance and verification. They discuss why a compliance and verification mechanism is needed, what can be learned from the previous verification efforts in other contexts, and what has changed in how verification is done since this was last discussed in the BWC framework over 20 years ago. The experts also discuss what the key elements of any mechanism will need to be, what are the most important bio security incidents, and how countries are working on their preparedness to respond to such incidents. The GCSP will be following the discussions in the BWC closely and stands ready to be a platform to bring together all stakeholders to generate new thinking to strengthen the BWC to respond to today’s bio security challenges.”

What We’re Listening To 🎧

PODCAST | Rethinking Our Defense Against Unknown Biothreats

“Dr. Harshini Mukundan, Program Manager and Scientist for Chemical and Biological Technologies at the Office of National and Homeland Security, Lawrence Berkeley National Laboratory, and visiting Scientist at Los Alamos National Laboratory sat down with host and AAAS STPF fellow Adejare (Jay) Atanda to discuss her research on pathogen agnostic disease detection and diagnostics, why this is important for biodefense against unknown biothreats, the role of technological innovations in pathogen agnostic detection and diagnostics, limitations of existing technological tools, and the vital importance of public-private partnerships in transforming this field. This conversation also covered the challenges women, people of color and immigrants face as scientists, the importance of mentorship in mitigating these challenges and her own mentorship and advocacy work to educate young girls about STEM careers as a AAAS IF/THEN STEM Ambassador and guest on CBS’s “Mission Unstoppable” among other efforts.”

Listen here.

Poisons and Pestilence: 20 Bonus Episode: No Fire No Thunder with Alastair Hay

Check out this episode with Alastair Hay, discussing his work as a toxicologist as it relates to the prohibition of chemical weapons.

61st ISODARCO Course: Nuclear Order and International Security after Ukraine

“The war in Ukraine has had an enormous impact on global security, reviving nuclear fears, undermining the prospects for arms control, and shattering many of the norms and constraints that were the foundation of European security. ISODARCO 2024 will examine the global nuclear order in light of the Ukraine war, focusing on the states, the policies and the technologies that will shape the future in a much more difficult environment. How will we cope with this more dangerous world?”

This course will take place January 7-14, 2024, at the University of Trento. Learn more and register here.

International Conference, CBRNE Research & Innovation

“Worldwide, researchers, responders and industrial capacities have been commited to provide adapted response to these challenges.”

“Looking forward to your proposals for communication and to welcoming you at Strasbourg in March 2024!”

Learn more here.

cbrne-ri-conference-2024-_-flyer-ppt-v06.11.2023-1 Download

Registration for GHS 2024 Now Open

Vote: 2023 Arms Control Person(s) of the Year Nominees

“Voting will take place between Dec. 8, 2023, and Jan. 11, 2024. The results will be announced on Jan. 12, 2024. Follow the discussion on social media using the hashtag #ACPOY2023.”

Learn about the nominees and vote here.

Pandora Report 12.15.2023

December 15, 2023 by dkellogg97, posted in Pandora Report

This week covers the FDA’s ongoing investigation into contaminated applesauce, the passing of Gao Yaojie-an activist responsible for bringing to light the extent of China’s AIDS epidemic-, and more.

*Biodefense MS Graduates Riley Flynn and Sophie Hirshfield at GMU’s 2023 Winter Commencement Ceremony*

FDA Leadership Says Tainted Applesauce Pouches May Have Been Intentionally Contaminated

Cinnamon applesauce pouches available Weis, WanaBanana, and Schnucks have been pulled from shelves after they were found to be contaminated with lead. Dozens of children in the United States have been sickened by the tainted products. Now, the FDA’s Deputy Commissioner for Human Foods, Jim Jones, says they may have been intentionally contaminated.

In an interview with Politico, Jones said “We’re still in the midst of our investigation. But so far all of the signals we’re getting lead to an intentional act on the part of someone in the supply chain and we’re trying to sort of figure that out.” All of the pouches in question were linked to a manufacturing facility in Ecuador that the FDA is currently inspecting.

‘“My instinct is they didn’t think this product was going to end up in a country with a robust regulatory process,” Jones said. “They thought it was going to end up in places that did not have the ability to detect something like this.”’

Politico further explained that “The FDA continues to investigate a number of theories for how the pouches became contaminated, and has not drawn any conclusions about the way the lead was added, why or by whom. The FDA says it currently believes the adulteration is “economically motivated.” That generally refers to ingredients being altered in order to make products appear higher in value, often so companies can produce a cheaper item and sell it at an elevated price.”

“The agency and the Centers for Disease Control and Prevention have collaborated with state and local health authorities as well as Ecuadorian authorities to trace the origin of the cinnamon in the applesauce pouches, which is believed to be the source of the lead contamination. More than 60 U.S. children under the age of 6 have tested positive for lead poisoning after consuming the pouches — some at levels more than 500 times the acceptable threshold for lead, according to The Washington Post.”

Gao Yaojie, Chinese Physician and Self-Exiled AIDS Activist, Dead at 95

Gao Yaojie, a gynecologist and well-known AIDS activist, died on December 10 in New York City. Gao, formerly based in China’s Henan province, was famous for her work to expose the outbreak of HIV/AIDS in the country in the 1990s and 2000s. The outbreak was large in scale and primarily driven by the country’s Plasma Economy, which arose because of restrictions on foreign imports of blood products in the 1990s. This resulted in blood plasma donation becoming a way for rural populations to make money in government-supported plasma donation centers. However, unsafe practices like repeated use of unsterilized needles and pooling multiple donors’ blood during the plasmapheresis allowed HIV to spread widely.

Because of the Chinese government’s efforts to suppress reporting on this epidemic, poor rural populations were left largely unaware of the dangers of plasma donation and the public in general was unaware of the severity of the crisis. Gao was one of the first to speak publicly about the outbreak, helping draw the attention of media outlets. She later told documentary filmmakers about her motivations for doing this, saying, “My driving thought is: how can I save more people from dying of this disease? We each only live one life.”

It is estimated that at least one million Chinese were infected with HIV during this epidemic, highlighting the importance of Gao’s and others’ bravery. For this, she garnered praise from the United Nations, several Western organizations, and even Hillary Clinton. This rising fame led to her being placed under house arrest in 2007, with about 50 police preventing her from traveling to the United States to accept an award recognizing her work. In response to this, she told NPR “I think they feel I got in the way of their political achievements and their official careers…Otherwise, why would they put me under house arrest? What law did I break to warrant mobilizing all these police?”

NPR further explained her activities later in life in their article on her passing, writing: “Despite pressure from Henan provincial authorities to stop publicizing the AIDS crisis, she continued her work, using all the proceeds from her books and pamphlets to support AIDS families, especially children orphaned by the disease or the many suicides that it caused.”

“Restrictions on her movement began hindering in work in China, however, and in 2009, she abruptly fled to the US, after fearing she would be put under house arrest again. Many admirers continued to visit her apartment in West Harlem, including a group of young Chinese students who kept her company in the loneliness of exile.”

‘”Many Chinese regarded her as a hero, and when they came to New York, if they didn’t know how to contact her , [sic] they would ask me. I would ask them for an email written in Chinese and would forward it to her. So far as I know, she always wrote back to those people and welcomed them to come visit,” remembers Andrew Nathan, a political science professor at Columbia University who handled much of Gao’s affairs in New York.”

“The Biological and Toxin Weapons Convention in 2023: Glimmers of Progress Set Against a Troubled Geopolitical Landscape”

Experts at CSR’s Nolan Center, including Biodefense PhD Program alumna and current faculty member Saskia Popescu, recently authored this blog post focused on the BWC’s potential for success in verification, universalization and effective implementation in Africa, and the creation of an International Agency for Biological Safety. They explain in their introduction: “For nearly two decades, efforts to strengthen the Biological and Toxin Weapons Convention (BWC) were in stasis, with opportunities missed and States Parties unable to agree to definite action. States Parties arrived at the Review Conference last year facing a growing biological weapons threat—augmented by rapidly converging complimentary technologies—coupled with a status quo in the BWC that was insufficient for the task. Yet nations drove a breakthrough: the consensus achieved at last year’s Review Conference proved that action is still possible despite the challenging international security environment.”

“In a world in which biological threats and vulnerabilities are exceedingly complex, there is a critical need to reinforce relationships among global experts, national governments, and civil society. Over the past two weeks, these stakeholders have met to identify, examine, and develop specific and effective measures to strengthen the Convention. An unwavering theme throughout the Meeting of States Parties underscored that preparedness and resilience are investments, rather than costs, reinforcing the deterrence by denial efforts CSR continues to promote. Although the challenging international security environment continues to hinder progress there are glimmers of genuine progress across several fronts…”

“Biosecurity in the Americas: Regional Threat Assessment”

A new from UMD’s START, co-authored by Biodefense MS Program alumna Alexandra Williams: “This publication, currently available in Spanish, provides a breadth and depth of focuses as a high-level assessment of the Central and South America regions and introduction to key topics as:

The needed expansion of understanding of the differences and areas of collaboration between the concepts of biosafety and biosecurity,
Existing international obligations to biosecurity through the BWC and UNSC Resolution 1540,
How biosecurity applies to and may differ in application across a variety of facility types that engage in biological research or production, whether private or public laboratories, agricultural or university-based facilities,
Biosecurity risks that include proliferation, bioterrorism, agroterrorism, and biocrime,
The five pillars and mechanisms of biosecurity,
Lastly, the application of biosecurity in the Central and South American regions.”

“NTI|Bio Convenes Workshop on Disincentivizing State Bioweapons Development and Use”

From NTI: “A week ahead of the Biological Weapons Convention (BWC) Working Group meetings in Geneva, Switzerland, NTI | bio convened a workshop on “Disincentivizing State Bioweapons Development and Use.” This two-day workshop on November 29 and 30 brought together academics, diplomats, biosecurity experts, and government policy makers to begin developing a cross-disciplinary thought and practice community to explore and develop potential disincentivizing solutions. Current thinking and policy on disincentivizing bioweapons acquisition and use is underdeveloped—especially by comparison with the nuclear security field.”

‘“We launched this effort because we see the need for more rigorous thinking on effective approaches to making bioweapons unattractive to nation-states,” said NTI | bio Vice President Jaime Yassif. “NTI’s goal is to bridge theory and practical policy-relevant approaches to develop new ideas that can invigorate international efforts to reduce biological threats.”’

Biodefense Graduate Program Director Gregory Koblentz and Associate Professor Sonia Ben Ouagrham-Gormley both participated in this workshop. Read more about it here.

“Great Powers and the Norms of the BW Prohibition Regime”

A new working paper from CBWNet: “The United States of America and the Soviet Union were instrumental in creating the biological weapons prohibition regime more than 50 years ago. This has left the regime with a big gap in its normative structure related to the verification of treaty compliance. The working paper by Alexander Kelle and Eva Siegmann analyses great power involvement in several areas of regime implementation and concludes that none of the great powers, including China, has supported the addition of declaration and inspection norms. While recent US and Chinese initiatives could still lead to a strengthening of the regime in different areas, Russian policies, most notably false accusations against the US and others, threaten to undermine the regime.”

“AI and Biorisk: An Explainer”

A new explainer from Georgetown’s CSET: “Recent government directives, international conferences, and media headlines reflect growing concern that artificial intelligence could exacerbate biological threats. When it comes to biorisk, AI tools are cited as enablers that lower information barriers, enhance novel biothreat design, or otherwise increase a malicious actor’s capabilities. In this explainer, CSET Biorisk Research Fellow Steph Batalis summarizes the state of the biorisk landscape with and without AI.”

“Bio X AI: Policy Recommendations For A New Frontier”

Jeffrey et al. discuss the work of the Federation of American Scientists’ Bio x AI Policy Development Sprint in this piece, explaining in their introduction: “Artificial intelligence (AI) is likely to yield tremendous advances in our basic understanding of biological systems, as well as significant benefits for health, agriculture, and the broader bioeconomy. However, AI tools, if misused or developed irresponsibly, can also pose risks to biosecurity. The landscape of biosecurity risks related to AI is complex and rapidly changing, and understanding the range of issues requires diverse perspectives and expertise. To better understand and address these challenges, FAS initiated the Bio x AI Policy Development Sprint to solicit creative recommendations from subject matter experts in the life sciences, biosecurity, and governance of emerging technologies. Through a competitive selection process, FAS identified six promising ideas and, over the course of seven weeks, worked closely with the authors to develop them into the recommendations included here. These recommendations cover a diverse range of topics to match the diversity of challenges that AI poses in the life sciences. We believe that these will help inform policy development on these topics, including the work of the National Security Commission on Emerging Biotechnologies.”

“Push to Improve Biosecurity in the Age of Genetic Engineering”

Wilmot James recently authored this opinion piece for Business Day, explaining in part “The possibility of using AI to develop bioweapons raises additional concerns, and remains uncharted territory. While the intersection of AI and biotechnology holds immense potential for positive applications in healthcare, research and diagnostics, it also poses risks if misused. AI algorithms could be employed to analyse vast genetic data sets and identify specific sequences for manipulation. This could accelerate the process of genetic engineering, allowing for the creation of more efficient and potentially harmful pathogens…To safeguard against such threats, multilateral and public-private sector agreements and regulations to govern the ethical use of AI in science, emphasising the prohibition of bioweapon development, should be established, with strong oversight committees responsible for assessing the ethical implications at the intersection of AI and biotechnology. These committees should include experts in AI, virology, bioethics and global health security.”

“Sounding the Alarm on Anti-Science”

Margaret Winchester provides background and overview of Peter Hotez’s latest book-The Deadly Rise of Anti-Science-in this piece for Health Affairs: “In his book, The Deadly Rise of Anti-Science, Hotez, professor and dean of the National School of Tropical Medicine at Baylor College of Medicine, and co-director of the Center for Vaccine Development at Texas Children’s Hospital, paints a bleak picture of public science denial during the pandemic, embedded in historic context. He tells the story of systematic anti-science efforts from his view in the trenches—and as a personal target for anti-science activists. This book, and his commentary in our December issue of Health Affairs on global lessons from COVID-19, highlight the very real effects of this movement, including lives lost, undermined public health efforts, foregone vaccinations, social schisms, and more, that will be felt for generations to come. As he writes, “anti-science now kills more Americans than global terrorism, or other deadly societal forces and social determinants.” Drawing from multiple sources, he estimates that approximately 200,000 people needlessly died in the US after COVID-19 vaccines became widely available.”

EU vs Disinfo Disinformation Review

The most recent edition of EU vs Disinfo’s Disinformation Review is now available and features multiple sections focused on Russia’s continued use of alleged US biological weapons laboratories as a bogeyman. Be sure to check it out for fantastic lines such as “If the only tool that you have is a hammer, everything looks like a biolab,” and “At a staged event, Putin mumbled out an announcement to veterans and the wider public that his regime would continue to rule over Russia after an orchestrated ritual not to be confused with an event known as an ‘election’ in the free world.”

2023 State of the Bioeconomy

From BIOISAC: “We have a lot to celebrate as we close 2023 and just over 12 months since the Executive Order calling for a safe, secure bioeconomy. Join us as we recap the activity, publications, outcomes, and – we will of course share a glimpse of the “behind the scenes” conversations from our 3 regional events and our one-day “Closing the Knowledge Gaps” event, our two-day table top training and the resulting “Going Viral: Bioeconomy Defense TTX” report, and, of course, the industry-demanded outputs from our hardware/software device security workgroup report and supplements, “Fortifying the Bioeconomy” as well as the Bioeconomy Security Questionnaire and Instrument Disposal Guide. We also have a lot left to do! We plan to share a few of our goals for 2024 and our upcoming regional events schedule.”

“Join us December 19th at 2pm Eastern-US for a live discussion.” Register here.

Presidential Advisory Council on Combating Antibiotic-Resistant Bacteria (PACCARB) Virtual Meeting

“The Presidential Advisory Council on Combating Antibiotic-Resistant Bacteria (PACCARB) provides advice, information, and recommendations to the U.S. Secretary of Health and Human Services (HHS Secretary). The council supports and evaluates U.S. government activities focused on fighting antimicrobial resistance (AMR) in human health, animal health, and environmental health. Using this One Health approach, members of the PACCARB have expertise from a range of backgrounds, including academia, industry, public health, advocacy, veterinary, and agricultural production.”

“The PACCARB was established under Executive Order 13676 and included in the Pandemic and All-Hazards Preparedness and Advancing Innovation Act of 2019 (PAHPAIA). Since 2019, the President has given authority to the HHS Secretary as the primary recipient of PACCARB recommendations. Additional information on the authority and activities of the PACCARB can be found on the About Us page in the charter.”

“As a federal advisory committee, the PACCARB looks to engage with the public and all AMR stakeholders. The council holds several public meetings every year both in-person and live streamed on the HHS.gov website. These meetings are open to anyone with an interest in combating AMR. See how to get involved!”

This virtual meeting will take place on December 20 from 9-4 EST. Learn more here.

61st ISODARCO Course: Nuclear Order and International Security after Ukraine

This course will take place January 7-14, 2024, at the University of Trento. Learn more and register here.

International Conference, CBRNE Research & Innovation

“Worldwide, researchers, responders and industrial capacities have been commited to provide adapted response to these challenges.”

“Looking forward to your proposals for communication and to welcoming you at Strasbourg in March 2024!”

Learn more here.

cbrne-ri-conference-2024-_-flyer-ppt-v06.11.2023-1 Download

Registration for GHS 2024 Now Open

WHO Announces Proposed Members of Technical Advisory Group on Response Use of the Life Sciences and Dual-Use Research

The WHO recently announced its proposed membership of its Technical Advisory Group on Responsible use of the life sciences and dual-use research (TAG-RULS DUR). According to WHO, “As per WHO processes, there will be now a two-week public consultation period for WHO to receive feedback on the proposed TAG-RULS DUR members and set in place the modalities for the TAG-RULS DUR’s first meeting, which is planned to take place following this consultation period…The final membership to the TAG-RULS DUR is subject to the above-mentioned public consultation period and relevant WHO practices and procedures.”

The proposed membership and instructions for providing commentary on the individuals included are both available here.

Vote: 2023 Arms Control Person(s) of the Year Nominees

“Voting will take place between Dec. 8, 2023, and Jan. 11, 2024. The results will be announced on Jan. 12, 2024. Follow the discussion on social media using the hashtag #ACPOY2023.”

Learn about the nominees and vote here.

Pandora Report 12.08.2023

December 8, 2023 by dkellogg97, posted in Pandora Report

This week includes coverage of updates to Japan’s End User List, the Taliban’s newly declared war on polio, Biomemory’s $1k DNA storage cards, new publications, upcoming events, and more.

Japan Revises End User List, Includes 101 Chinese Organizations and Institutions

Japan’s Ministry of Economy, Trade, and Industry has revised the country’s End User List, which provides “…exporters with information on foreign entities for which concern cannot be eliminated regarding involvement in activities such as the development of weapons of mass destruction (WMDs) and other items, for the purpose of enhancing the effectiveness of the catch-all control on cargos and other loads relating to WMDs and other items.”

The updated list, which takes effect on Monday, now includes 706 organizations in 15 countries and regions, according to Nikkei. This is an increase of 36 over last year’s list and, notably, it includes the China Academy of Engineering Physics (CAEP)-the main center for Chinese research on and manufacturing of nuclear weapons. Seven total Chinese entities were added to the list, about 90% of which are thought to be involved in missile development. Nikkei notes that “Many universities, academies and research institutes are also listed, which reveals the extent of Xi Jinping’s Military-Civilian Fusion policy. Machine tools produced by Japanese companies and others are suspected of being used by the CAEP, according to a Nikkei investigation.”

223 Iranian organizations and institutions are on the list, in addition to 153 North Korean ones, and 101 each from China and Pakistan. Nikkei further explains that “Japan aims to prevent the outflow of civilian technology that could be diverted to military use. Exporters are required to get approval from the Minister of Economy, Trade and Industry to export products to the listed organizations unless it is clear that the materials will not be used to develop WMDs such as nuclear weapons or missiles.”

“The economy ministry makes the list to enhance the effectiveness of its “catch-all” control system, which obliges exporters to apply for an export license for goods that may be used for the development of WMDs even if the goods are not subject to export restrictions under international agreements. The list has been issued since catch-all controls were introduced in April 2002 and is revised about once a year. It is not an embargo list.”

Taliban Announces Polio Eradication Campaign

Naturally acquired polio remains endemic in just two countries today- Afghanistan and Pakistan- in part because, as Radio Azadi explains, “Islamic militants often target polio-vaccination teams, falsely claiming the vaccination campaigns are a Western conspiracy to sterilize children.” During its 20-year struggle to regain power, the Taliban often banned door-to-door vaccination efforts. In 2021, nationwide door-to-door polio vaccinations were allowed to resume after the Taliban and the United Nations/World Health Organization reached an agreement.

Now, as explained by a recent article in The Washington Post, the Taliban is “declaring war” on polio in an apparent complete reversal of its previous stance. The article explains “Vaccinators in the country’s northeast, the center of the poliovirus outbreak, search cars for unvaccinated children at roadside checkpoints manned by Taliban soldiers. With no deadly attacks on public health campaigners reported in Afghanistan this year, they also feel increasingly comfortable venturing into remote virus hot spots that were previously far beyond their reach.”

The country’s health ministry announced the continuation of its annual polio vaccination campaign in March of this year, marking the second year the program has continued to operate under the Taliban’s rule. The ministry indicated it aimed to reach approximately 9 million children with the campaign, as Afghanistan and neighboring Pakistan continue to struggle with endemic polio due in large part to accessibility difficulties, displacement, regional instability, and concerns about external interference. Pakistan suspended its anti-polio drive in multiple districts this year after police escorting vaccination teams were repeatedly attacked.

French Start-Up Announces Sales of DNA Storage Cards, BIO-ISAC Joins DNA Data Storage Alliance Amid Growing Interest, Concerns

Multiple news outlets have covered the French start-up Biomemory‘s release of $1,000 pairs of DNA cards that promise a “minimum” 150-year lifespan of data storage. The Verge’s Emma Roth explains “DNA has emerged as a theoretical alternative to hard drives, SSDs, and other forms of digital data storage, namely because of its impressive lifespan. Science estimates the technology could potentially last hundreds of thousands of years if stored in a cool, dry environment. That’s a heck of a lot longer than the lifespan of your average hard drive, which typically tops out at around five years.”

However, Biomemory’s cards currently offer just one kilobyte of storage, or about one email according to Wired. The data stored on the card is retrieved by mailing the cards to Eurofins Genomics, who then return the stored information using strings of DNA’s nucleotide bases-adenine (A), cytosine (C), guanine (G) and thymine (T). Users can then use Biomemory’s DNA translation feature to decode the stored information. The card is not returned afterward. The company expects to begin shipping orders from its waitlist in January.

‘”The launch of our DNA Cards represents a significant milestone in the evolution of data storage technology,” Erfane Arwani, CEO of Biomemory, said about the pioneering development. “After years of talk about the potential of molecular computing, we are incredibly proud to bring the first DNA data storage product to market, that not only pushes the boundaries of innovation but also aligns with our commitment to environmental sustainability and efficiency.”‘

This news has coincided with the announcement that the Bioeconomy Information Sharing and Analysis Center, an international organization that aims to address threats unique to the bioeconomy, has joined the DNA Data Storage Alliance. The organization explained in a statement: “This year BIO-ISAC created the Genomic Data Workgroup, informing the National Cybersecurity Center of Excellence at National Institute of Standards and Technology efforts to launch the Cybersecurity Framework Profile for Genomic Data and the forthcoming text on the Privacy Framework Profile for Genomic Data. Prioritizing workgroup efforts to apply and implement this work, BIO-ISAC pursued membership and presentation opportunities with aligned organizations and audiences.”

“Today, BIO-ISAC joins more than 40 members of the DNA Data Storage Alliance, in hopes of creating a future with safe, secure data storage systems and processes for genetic data at all stages of its lifecycle.”

“Founded in 2020, the DNA Data Storage Alliance was built to create and promote an interoperable storage ecosystem based on DNA as a data storage medium. The organization seeks to educate the public and raise awareness about this emerging technology and its vast power to preserve our digital legacy. As the methods of commercially viable DNA storage become better understood, the Alliance will consider recommending the creation of specifications and standards (e.g., encoding, reliability, retention, file systems) which enable end-users to add interoperable DNA-based storage solutions to their existing storage hierarchies.”

On a more fun note, Biomemory’s homepage does include a DNA Translate feature at the bottom which shows users how lines of text may be converted to strings of As, Cs, Gs, and Ts, so we tested it out: AGAGAGACAGTCTCACAGTCAGAGACTCACACAGAGACACAGTCACAGAGTCTGTCAGTCAGACAGTCTGTGAGTGACTCAGTCACAGACTCACACAGAGACTCAGTCAGAGAGTGACACAGTCTGTGAGTGACTCAGTGAGACACTCACACAGTCTCAGAGTGACTGACTCACACAGTGAGACAGTCTCACAGTCAGAGACTCACACAGTCACTCAGTCAGAGAGTGACTGAGTGAGACACTCACACAGTCTGTCAGTCAGAGAGTGCCGAAGTGACTGAGTCTGACAGTCAGAGAGTGAGACAGTGAGACAGTCAGAGAGTGACTCCCGAACAG

The page lacks a feature allowing users to translate their string of nucleotide bases back to regular text, so take our word for it: The Pandora Report is the best newsletter!

WHO Weekly Epidemiological Record One Health-Focused Issue

“The Weekly Epidemiological Record (WER) serves as an essential instrument for the rapid and accurate dissemination of epidemiological information on cases and outbreaks of diseases under the International Health Regulations and on other communicable diseases of public health importance, including emerging or re-emerging infections.”

The most recent issue is focused on One Health and includes pieces on incorporating One Health into the international political agenda, the Collaboration on One Health between WHO, FAO, WOAH, and UNEP, and more.

“Henry Kissinger Supported Wars and Coups. He Also Played a Little-Known Role in Eliminating Bioweapons”

Matt Field recently authored this piece about the late Henry Kissinger in The Bulletin of the Atomic Scientists, writing in part: “By the late 1960s, incidents with chemical weapons—including an accident with VX nerve agent in Utah that killed some 6,000 sheep—had focused Congress’s attention on the US chemical and biological warfare operation. Internationally, there were efforts to begin arms control negotiations around these weapons of mass destruction. And Kissinger led internal government deliberations over what to do with the US program. At one point, according to Tucker and Mahan, Kissinger, unhappy with a policy paper that contained both arguments in favor and against retaining biological weapons, produced his own paper that cut the points in favor of the offensive program. He included his personal recommendation to restrict the US program to biological defense, which involves the development of countermeasures such as vaccines.”

“Insights from BARDA Industry Day 2023”

Tanima Sinha, Director of Life Science Product Development and Government Contracts at the Biomedical Advanced Research and Development Authority (BARDA), recently authored this post covering BARDA Industry Day 2023 and upcoming insights from the conference that will be made available. She explains in part, “Here we will take a quick glimpse at ASPR (Administration for Strategic Preparedness and Response) and BARDA’s programs to enhance the nation’s biomedical industrial base and supply chain capacity. The COVID-19 pandemic brought to light the inadequate availability of essential medical needs. In response to these deficiencies, the USG/ HHS (Health and Human Services) (Health and Human Services) is expanding the public health industrial base through innovative solutions.”

Fortifying the Bioeconomy

From BIO-ISAC: “Standardizing tools for assessing, remediating, and disposing of hardware and software instruments has been a recurring problem in our sector, reducing our ability to operate in a safe, secure way. Earlier this year, BIO-ISAC took action to address this need.”
“Fortifying the Bioeconomy, an in-depth resource about shared responsibility in hardware and software lifecycle management, is now available. This resource includes additional materials including a standardized vendor questionnaire and an instrument disposal guide.”

“We hope these materials guide industry and offer us a safe, secure path forward for our nation’s labs, biomanufacturers, growers, and innovators.”

Access here.

“Country Reports on Terrorism 2022”

“Country Reports on Terrorism 2022 is submitted in compliance with Title 22 of the United States Code, Section 2656f (the “Act”), which requires the Department of State to provide to Congress a full and complete annual report on terrorism for those countries and groups meeting the criteria of the Act.”

This report includes “Chapter 3 — The Global Challenge of Chemical, Biological, Radiological, or Nuclear Terrorism,” explaining the status of CBRN materials and expertise as terrorist threats and the United States’ efforts to counter them in 2022.

“New Information Tool on Nuclear Weapons Seeks to Identify the Next Arms Control Strategies”

Andrew Facini recently authored this piece for The Bulletin of the Atomic Scientists discussing the Council on Strategic Risks’ recently-launched Nuclear Weapons System Project. He explains, “For those of us seeking to cultivate nuclear policies geared toward enhancing strategic stability, the current trend reflects a worrying loss of perspective—a forgetting of the hard-earned lessons of the Cold War. To help put today’s trends in their historical context, a team of the Council on Strategic Risks (CSR) developed a new visualization tool and information system that maps every type of nuclear weapon fielded by the five nuclear weapons states (P5) under the Nuclear Non-Proliferation Treaty (NPT)—China, France, Russia, the United Kingdom, and the United States—from their inception to present day.”

What We’re Listening To 🎧

Technologically Speaking Podcast Ep. 6, Science is Messy

New from the Department of Homeland Security: “Host John Verrico sits down with Dr. Nick Bergman, director of S&T’s National Biodefense Analysis and Countermeasures Center (NBACC). Dr. Bergman is a bit of a germaphobe, but it’s hard not to be when you run a Biosecurity Level 4 lab that studies pathogens for which no vaccine or treatment exists. Hear an insider’s perspective of the COVID pandemic, find out how NBACC regularly helps the FBI, and meet a guy living a “pretty typical life” of helping save us all from superbugs.”

Listen here.

What We’re Watching🍿

Biosecurity

New from the Dutch Ministry of Health, Welfare and Sport: “This film provides an introduction into eight pillars of good practice for biosecurity, that are important when implementing biosecurity control measures.”

“These control measures are necessary to protect high-risk biological materials against theft or misuse by malicious parties.”

“The biosecurity aspects in these eight pillars of good practice are explained, which can help you to implement biosecurity within your organisation. This film is focussed on organisations that work with high risk biological materials.”

The short film is available in Dutch, English, and English with Russian subtitles.

Mitigating Arboviral Threats and Strengthening Public Health Preparedness

“Arboviruses are a broad group of viruses that are spread by arthropods, such as ticks and mosquitoes. Diseases caused by arboviruses, like dengue, chikungunya, Zika, and yellow fever, present a significant public health burden and threaten billions of people worldwide. Despite the global recognition of the devastating health and economic impacts of these diseases, the need persists for improved integration of mitigation efforts into public health systems and environmental and urban planning.”

“The National Academies Forum on Microbial Threats will conduct a two-day workshop that will identify lessons learned from previous outbreaks, outline current arbovirus surveillance capacities, and describe novel approaches to arbovirus mitigation. The workshop will include perspectives from researchers, public health practitioners, and environmental management experts from across the globe.”

This event will take place on December 12 and 13. Learn more here.

Presidential Advisory Council on Combating Antibiotic-Resistant Bacteria (PACCARB) Virtual Meeting

This virtual meeting will take place on December 20 from 9-4 EST. Learn more here.

61st ISODARCO Course: Nuclear Order and International Security after Ukraine

This course will take place January 7-14, 2024, at the University of Trento. Learn more and register here.

International Conference, CBRNE Research & Innovation

“Worldwide, researchers, responders and industrial capacities have been commited to provide adapted response to these challenges.”

“Looking forward to your proposals for communication and to welcoming you at Strasbourg in March 2024!”

Learn more here.

cbrne-ri-conference-2024-_-flyer-ppt-v06.11.2023-1 Download

Registration for GHS 2024 Now Open

“Biodefense Budget Breakdown: Data Visualization of U.S. Biodefense Investments”

New from Council on Strategic Risks: “In recent years, U.S. strategies and policies have advanced greatly in addressing biological risks from all sources. We at CSR have marked several areas of progress through writings and analysis: the beginning of a pivot toward pathogen-agnostic approaches, requiring annual exercises on biological risks, and the creation of the Biodefense Council within the Department of Defense, and more…In September, CSR launched a scorecard process to track signs of implementation of stronger U.S. biodefense and biosecurity policies. CSR’s Biodefense Budget Breakdown will accompany the scorecard, tracking trends in resources and investments.”

“Before the launch of this tool, no publicly-accessible resource provided a detailed analysis of the total budget across the federal biodefense enterprise. By creating the Biodefense Budget Breakdown, we hope to provide a robust and user-friendly resource for the government, key stakeholders, and the general public.”

“This tool is intended to provide focused analyses of the biodefense budget, with multiple interfaces to understand and analyze the federal biodefense portfolio. This tool starts with the cumulative U.S. biodefense totals for each fiscal year dating back to 2019, progresses to agency-specific drill-downs, and culminates with a detailed line item index for biodefense budgets across key agencies. This tool reports biodefense investments across three steps in the budget cycle: requested (R), enacted (E), and actual (A) levels of funding.”

Call for Applications: Ecological Security Fellowship

“The Council on Strategic Risks is pleased to announce a call for applications for its Ecological Security Fellowship, a key part of its broader Ecological Security Program.”

“Tackling complex, converging risks arising from ecological degradation requires the development of resilient leaders spanning international, national, state, and local levels. This program will familiarize participants with novel ways of conceptualizing the security risks posed by ecological disruption driven by human activities, climate change, and other stressors. Participants will acquire expertise and build professional development through networking with experts and practitioners in different areas of ecological security.”

Learn more and apply here.

Pandora Report 12.01.2023

December 1, 2023 by dkellogg97, posted in Pandora Report

This week covers a wide range of topics, including chemical weapons, indictments for those involved in running the illegal laboratory in Reedley, CA, and more. Several new publications follow, as well new upcoming events and newly-available resources in the announcement section.

George Mason University’s Biomedical Laboratory Receives $12 Million in Funding from NIH

From GMU: “Farhang Alem, Interim Director of the Biomedical Research Laboratory, Institute for Biohealth Innovation, and Aarthi Narayanan, Professor, Biology, will receive more than $12 million from the National Institute for Health to support development of Mason’s Biomedical Research Laboratory, advancing the university’s research capabilities for infectious diseases.”

“George Mason University’s Biomedical Laboratory (BRL) is one of 12 Regional Biocontainment Laboratories (RBLs) established through the National Institute of Allergy and Infectious Diseases. The BRL offers Biosafety Level 3 (BSL-3) facilities that conduct cutting edge pathogen research and serve as resources to rapidly address emerging infectious disease outbreaks.”

“Funding will support a number of facility improvements including the implementation of a comprehensive BSL-3 facilities preventative maintenance and upgrade plan to ensure continuity of operations, compliance with federal regulations, and a safe and secure facility. Funding will also enhance safety and quality of BSL-3 laboratory practices and create two new research cores in high containment.”

Read more here.

DOD Chemical and Biological Defense Program Celebrates 30th Anniversary

The Department of Defense recently reached the 30-year anniversary of the formation of its Chemical and Biological Defense Program. “Congress created the DOD wide chemical and biological defense program in November 1993, after a government report noted U.S. forces were not sufficiently prepared to address Iraq’s chemical and biological warfare capabilities…Prior to the creation of the program under the Office of the Secretary of Defense, the military services were each responsible for developing their own chemical and biological defense capabilities.”

Read more here.

Syrian Network for Human Rights Statement On the Day of Remembrance For All Victims of Chemical Warfare

The Syrian Network for Human Rights released its statement yesterday on the Day of Remembrance for all Victims of Chemical Warfare, highlighting CW attacks perpetrated by the Assad regime and the ongoing struggle for victims to hold the regime accountable. The statement is available below.

s231115e Download

2023 OPCW-The Hague Award Recipients Announced

OPCW Director-General Amb. Fernando Arias and the Mayor of the Municipality of The Hague, Mr. Jan van Zanen, announced last week the three recipients of the 2023 OPCW-The Hague Award. These recipients are the Spiez Laboratory in Switzerland, Dr. Syeda Sultana Razia at the Bangladesh University of Engineering and Technology, and Mr. Hubert K. Foy at the African Centre for Science and International Security in Ghana.

‘“All three of these recipients have demonstrated that everyone has a role to play in ridding the world of chemical weapons and preventing their re-emergence,” said OPCW Director-General, Ambassador Fernando Arias. “We must together strive to continue to ensure that toxic chemicals are never used as instruments of harm and that our populations are protected.”’

Read more about the recipients and their work here.

NTI, NextGen, iGEM, SynBio Africa, GHSN, and 80,000 Hours Announce Winners of 7th Annual Next Generation for Biosecurity Competition

The winners of the Seventh Annual Next Generation for Biosecurity Competition were recently announced. They are Gupreet Dhaliwal, Ph.D. candidate in Synthetic Biology and Immunology at the University of Cambridge, Askar Kleefeldt, Ph.D. candidate in Synthetic Biology at the MRC Laboratory of Molecular Biology and the University of Cambridge, and Alexandra Klein, Ph.D. candidate in Science, Technology, Engineering and Public Policy at the University College London and research assistant at the Centre for the Study of Existential Risk, University of Cambridge.

“In their winning paper, Biosecurity-By-Design to Safeguard Emerging Bioeconomies: Integrating Biosecurity Considerations into the Full Biotechnology Innovation and Development Pipeline, the team proposes a ‘biosecurity-by-design’ approach to ensure that biosecurity is integrated into every stage of the life science research and development pipeline, especially project conceptualization. The three authors outline a set of recommendations to achieve this goal, including fostering a culture of responsibility among scientific communities through the adoption of the Tianjin Biosecurity Guidelines for Codes of Conduct for Scientists as a global standard in emerging bioeconomies. The authors emphasize the importance of engaging with the private sector and encourage governments to incentivize biosecurity in product design by using levers such as market access regulations or reputational rewards through seals of approval. The authors also propose that States Parties at the Biological Weapons Convention adopt a systematic review mechanism for science and technology to raise awareness of emerging biotechnology risks. Overall, these recommendations aim to make biosecurity an integral part of biotechnology innovation while allowing the bioeconomy to flourish.”

Read more here.

No Cost COVID-19 Tests Available in United States Again

The US Government is once more offering four at-home viral tests delivered via the US Postal Service. Those who did not order any in September can order up to eight of them during this round. Order tests at COVIDtests.gov.

ICYMI: Select Committee on the CCP Releases Report on Reedley Lab, DOJ Announces Indictment of Operator

Last month “Chairman Mike Gallagher (R-WI) of the House Select Committee on the Chinese Communist Party unveiled a report on its investigation into the illegal People’s Republic of China-tied biolab discovered in Reedley, CA. The members were joined by Rep. Jim Costa (D-CA), whose district includes Reedley, CA, Former Speaker Kevin McCarthy (R-CA), Rep. Dan Newhouse (R-WA), and Rep. Neal Dunn (R-FL).”

According to the report, the Committee’s main findings were:

“The illegal biolab was run by a PRC citizen who is a wanted fugitive from Canada with a $330 million Canadian dollar judgment against him for stealing American intellectual property.
This PRC citizen was a top official at a PRC-state-controlled company and had links to military-civil fusion entities.
The illegal biolab received millions of dollars in unexplained payments from PRC banks while running the illegal biolab.
The illegal biolab contained thousands of samples of labeled, unlabeled, and encoded potential pathogens, including HIV, malaria, tuberculosis, and Covid.
The illegal biolab also contained a freezer labeled “Ebola,” which contained unlabeled, sealed silver bags consistent with how the lab stored high risk biological materials. Ebola is a Select Agent with a lethality rate between 25-90%.
The biolab contained nearly a thousand transgenic mice, genetically engineered to mimic the human immune system. Lab workers said that the mice were designed “to catch and carry the COVID-19 virus.”
After local officials who discovered the lab sought help from the CDC and others, the CDC refused to test any of the samples.”

Meanwhile, the Department of Justice announced a three-count indictment against operators of the lab, saying in a press statement “A federal grand jury returned a three-count indictment today against Jia Bei Zhu, aka Jesse Zhu, Qiang He, and David He, 62, a citizen of China who formerly resided in Clovis, charging him with distributing adulterated and misbranded medical devices in violation of the federal Food, Drug, and Cosmetic Act and for making false statements to the Food and Drug Administration (FDA), U.S. Attorney Phillip A. Talbert announced.”

“According to court documents, between January 2020 and March 2023, through the companies Universal Meditech Incorporated (UMI) and Prestige Biotech Incorporated (PBI), Zhu sold hundreds of thousands of COVID-19 test kits to companies throughout the United States. UMI and PBI were based in Fresno and Reedley and did not obtain pre-market approval, pre-market clearance, emergency use authorization, or other applicable exemption from the FDA as was required. UMI and PBI received millions of dollars for the sales of the test kits.”

“When questioned by FDA officials, Zhu made several false statements to them, including that (1) his name was Qiang “David” He, (2) he was hired by UMI as a COVID-19 consultant in 2021, (3) he was hired by PBI just a couple of weeks prior to meeting with the FDA to communicate with government agencies on PBI’s behalf, and (4) he did not know anything about the manufacturing or distribution histories for UMI or PBI.”

“This case is the product of an investigation by the FDA Office of Criminal Investigations with assistance from the Federal Bureau of Investigation and the California Department of Public Health – Food and Drug Branch. Assistant U.S. Attorneys Joseph D. Barton, Arelis M. Clemente, and Henry Z. Carbajal III are prosecuting this case.”

“Why AI-Assisted Bioterrorism Became a Top Concern for Open AI and Anthropic”

Louise Matsakis covers the now constant concern about the potential for AI to aid in bioterrorism, explaining in her introduction “In the spring of 1995, U.S. lawmakers were becoming concerned that material uploaded to the nascent internet might pose a threat to national security. The Oklahoma City bombing had happened several weeks earlier, drawing attention to publications circulating online like The Big Book of Mischief, which included instructions on how to build homemade explosives.”

“Worried the information could be used to orchestrate another attack, then-Senator Dianne Feinstein pushed to make publishing bomb recipes on the internet illegal. The effort sparked a national debate about “Open Access vs. Censorship,” as one newspaper headline put it at the time.”

“Nearly 30 years later, a similar debate is now unfolding about artificial intelligence. Rather than DIY explosives, some U.S. officials and leading AI companies say they are increasingly worried that large language models could be used to develop biological weapons. The possibility has been repeatedly cited as one reason to be cautious about making AI systems open source.”

Matsakis interviewed George Mason’s Sonia Ben Ouagrham-Gormley as well in writing this piece, writing ‘“With new technologies, we tend to project in the future as though their development was linear and straightforward, and we never take into consideration the challenges and the contingencies of the people using them,” said Sonia Ben Ouagrham-Gormley, an associate professor at George Mason University who has interviewed former scientists in both the U.S. and Soviet Union’s now-defunct biological weapons programs.”

And later: “Ben Ouagrham-Gormley said her research has shown that achieving each of these steps requires employing different, highly-trained experts, including people who specialize in the exact type of pathogen being used. An AI model might be able to replace some of their work in the future, but she argued it can’t replicate the hands-on wisdom that comes from working in a laboratory.”

‘“This kind of tacit knowledge exists everywhere, but in the bio field, it’s really important because of the fragility of the raw material,” Ben Ouagrham-Gormley said.”

“Artificial Intelligence and Synthetic Biology Are Not Harbingers of Doom”

David Bray provides an optimistic outlook on the potential of AI and synthetic biology in this policy memo for the Stimson Center. Bray writes, “Contrary to many people’s fears, artificial intelligence (AI) can be a positive force in advancing biological research and biotechnology. The assumption that AI will super-empower the risks that already exist for the misuse of biotech to develop and spread pathogens and fuel bioterrorism misses three key points. First, the data must be out there for either an AI or a human to use it. Second, governments stop bad actors from using bio for nefarious purposes by focusing on the actors’ precursor behaviors. Third, given how wrong large language models (LLMs) often are and their risk of hallucinations, any would-be AI intended to provide advice on biotech will have to be checked by a human expert. In contrast, AI can be a positive force in advancing biological research and biotechnology — and insights from biology can power the next wave of AI for the benefit of humankind. Private and public-sector leaders need to make near-term decisions and actions to lay the foundation for maximizing the benefits of AI and biotech. National and international attention should focus on both new, collective approaches to data curation and ensuring the right training approaches for AI models of biological systems.”

“Going Viral: Bioeconomy Defense”

This report from Johns Hopkins’ Applied Physics Lab summarizes the findings of a May tabletop exercise:

“The May tabletop exercise at APL revealed four key areas of action to ensure a safe and secure bioeconomy.

Trust in lab equipment performance and data is foundational to the bioeconomy. Recommendations include developing digital security standards for lab equipment, hardening waypoints at each step in the data life cycle, and introducing a system of tiered levels of compliance.

Awareness of vulnerabilities, cyber and physical, and the steps for prevention and intervention are needed. Recommendations include additional exercises to strengthen intra-agency coordination and training and extending this activity to private sector companies.

Responsibility for responding to threats in the bioeconomy, and the roles for each team member, need to be defined with a process workflow, using a shared responsibility model, and teams need regular training opportunities to practice.

Preparedness is lacking, and threat-mitigation strategies specific to the bioeconomy need to be identified, tested and distributed. The exercise pushed the limits of participants’ traditional threat-mitigation strategies and identified the need for assessments of critical infrastructure and functions, cross-domain training, and the establishment of policies and procedures for an inter-agency group to rapidly respond to threats.”

“Security Considerations At the Intersection of Engineering Biology and Artificial Intelligence”

New from the Engineering Biology Research Consortium: “This white paper describes three areas at the intersection of engineering biology and artificial intelligence that may yield significant security concerns: de novo biological design, closed-loop autonomous laboratories, and natural language Large Language Models. It describes each area, identifies potential security concerns, and offers ideas for the potential mitigation of those concerns, ultimately calling for an international forum to continually address this evolving issue.”

“Pascale Ferrier and the Threat of Bioterror”

Markus K. Binder recently published this piece in NCT’s CBNW: “Drawing upon the START CBRN Data Suite and other research, Markus Binder considers the five ricin bio-attacks directed at the U.S. President and other officials that have taken place since 2013 to assess what, if anything, they can tell us about bioterrorism.”

“Americans’ Trust in Scientists, Positive Views of Science Continue to Decline”

New work from the Pew Research Center has found that “…the share of Americans who say science has had a mostly positive effect on society has fallen and there’s been a continued decline in public trust in scientists.”

“Overall, 57% of Americans say science has had a mostly positive effect on society. This share is down 8 percentage points since November 2021 and down 16 points since before the start of the coronavirus outbreak.”

“About a third (34%) now say the impact of science on society has been equally positive as negative. A small share (8%) think science has had a mostly negative impact on society.”

Read the report here.

“A Systematic Review Of COVID-19 Misinformation Interventions: Lessons Learned”

Smith et al. recently published this article with Health Affairs: “Governments, public health authorities, and social media platforms have employed various measures to counter misinformation that emerged during the COVID-19 pandemic. The effectiveness of those misinformation interventions is poorly understood. We analyzed fifty papers published between January 1, 2020, and February 24, 2023, to understand which interventions, if any, were helpful in mitigating COVID-19 misinformation. We found evidence supporting accuracy prompts, debunks, media literacy tips, warning labels, and overlays in mitigating either the spread of or belief in COVID-19 misinformation. However, by mapping the different characteristics of each study, we found levels of variation that weaken the current evidence base. For example, only 18 percent of studies included public health–related measures, such as intent to vaccinate, and the misinformation that interventions were tested against ranged considerably from conspiracy theories (vaccines include microchips) to unproven claims (gargling with saltwater prevents COVID-19). To more clearly discern the impact of various interventions and make evidence actionable for public health, the field urgently needs to include more public health experts in intervention design and to develop a health misinformation typology; agreed-upon outcome measures; and more global, more longitudinal, more video-based, and more platform-diverse studies.”

“Coffee As a Dietary Strategy to Prevent SARS-CoV-2 Infection”

Wu et al.‘s recent article in Cell & Bioscience offers further validation for coffee drinkers (as if we needed it): “Background: To date, most countries lifted the restriction requirement and coexisted with SARS-CoV-2. Thus, dietary behavior for preventing SARS-CoV-2 infection becomes an interesting issue on a daily basis. Coffee consumption is connected with reduced COVID-19 risk and correlated to COVID-19 severity. However, the mechanisms of coffee for the reduction of COVID-19 risk are still unclear.”

“Results: Here, we identified that coffee can inhibit multiple variants of the SARS-CoV-2 infection by restraining the binding of the SARS-CoV-2 spike protein to human angiotensin-converting enzyme 2 (ACE2), and reducing transmembrane serine protease 2 (TMPRSS2) and cathepsin L (CTSL) activity. Then, we used the method of “Here” (HRMS-exploring-recombination-examining) and found that isochlorogenic acid A, B, and C of coffee ingredients showed their potential to inhibit SARS-CoV-2 infection (inhibitory efficiency 43–54%). In addition, decaffeinated coffee still preserves inhibitory activity against SARS-CoV-2. Finally, in a human trial of 64 subjects, we identified that coffee consumption (approximately 1–2 cups/day) is sufficient to inhibit infection of multiple variants of SARS-CoV-2 entry, suggesting coffee could be a dietary strategy to prevent SARS-CoV2 infection.”

“Conclusions: This study verified moderate coffee consumption, including decaffeination, can provide a new guideline for the prevention of SARS-CoV-2. Based on the results, we also suggest a coffee-drinking plan for people to prevent infection in the post-COVID-19 era.”

“WHO: ‘Collective Action’ Needed to Effectively Reduce Antimicrobial Resistance”

CIDRAP’s Chris Dall covers WHO officials’ answers to questions about AMR in this piece written in recognition of World AMR Awareness Week. Dall explains “Encouraging the medical community, world leaders, and other stakeholders to do their part in staving off that grim future is one of the goals of World AMR Awareness Week, a global campaign of the World Health Organization (WHO) this week aimed at raising public awareness and promoting practices that help mitigate the threat posed by drug-resistant infections…CIDRAP News recently submitted a series of questions to WHO officials about the themes of this year’s World AMR Awareness Week, their assessment of the progress that countries have made in addressing AMR, and the challenges that lay ahead. Responses were provided by Sarah Sheppard, the WHO’s communications lead for Medicines, Health Products & AMR.”

“The World’s Chemical-Weapons Stockpiles Are Gone – But a New Challenge Looms”

Peter J. Hotchkiss, science policy adviser to the OPCW’s Scientific Advisory Board, recently published this World View piece with Nature. He explains in part, “In 2019, the OPCW’s 193 member states decided unanimously, for the first time in history, to add compounds to the schedules, the lists of chemicals that are regulated under the convention. The four entries comprise toxic nerve agents with no known civilian use: three cover phosphorus-based agents (in the ‘novichok family’), and the fourth is a family of carbamates, another kind of nerve agent. The convention already prohibited using these (or any chemical) to intentionally kill or harm people through toxicity. Now, their production, transfer and storage are subject to stringent verification by the OPCW, through declarations and on-site inspections.”

“Yet some states have been reticent to share data on these chemicals with the OPCW. The lack of information on the newly scheduled chemicals is in jarring contrast to what we have on other weapons listed in the convention and on their precursors. To ensure the health and safety of staff members during inspections, the OPCW needs the best understanding of these chemicals’ properties, the types of personal protective equipment and medical countermeasures that are effective against them and the analytical methods for detecting them. These data would also help us to provide the best information and training to all member states, ensuring that they are prepared in the event that any of these chemicals are used as a weapon.”

“29 Morally Bankrupt Governments, Headed by Russia, Voted Against the OPCW’s Resolutions”

The Syrian Network for Human Rights recently released this report “…emphasizing that many states worldwide must bring cases against the Syrian regime before the International Criminal Court (ICC) over the regime’s repeated violations of the Chemical Weapons Convention (CWC).”

“In the 15-page report, SNHR notes that the Syrian regime has carried out 184 chemical attacks since ratifying the Convention in September 2013. The report outlines the decisions adopted by the Organization for the Prohibition of Chemical Weapons (OPCW), identifying the states that voted against those decisions, or in other words the states that support the continuation of the Syrian regime’s chemical weapons program. Through this action, it notes, these states are, in effect, encouraging the regime to use weapons of mass destruction – chemical weapons – and emboldening it to carry out more chemical weapons attacks against the Syrian people.”

“Scientific Experts Provide Key Recommendations on Biotoxin Analysis to the OPCW”

“The Scientific Advisory Board (SAB) of the Organisation for the Prohibition of Chemical Weapons (OPCW) endorsed a report outlining key recommendations on biotoxin analysis and investigations of their alleged use as weapons submitted by a SAB Temporary Working Group (TWG) earlier this year.”

“Biotoxins are toxic chemicals produced by living organisms, which vary widely in properties such as structure, size, and mechanisms of toxicity. Some biotoxins can be more toxic than traditional nerve agents. There are two biotoxins subject to stringent verification measures under the Chemical Weapons Convention – ricin and saxitoxin – with many others also posing safety and security concerns.”

“The risk of misuse of biotoxins as weapons requires the OPCW to be prepared to conduct various investigations and missions related to their alleged use. To ensure the Organisation’s readiness to do so, the TWG’s report makes critical recommendations to the OPCW…”

Read more here.

“2023 Catalogue of Civil Society Activities Supporting the Chemical Weapons Convention”

The Stimson Center recently released its 2023 Catalogue of Civil Society Activities Supporting the Chemical Weapons Convention, “a catalogue of civil society capacity-building, assistance, and/or research programs supporting the Chemical Weapons Convention (CWC). The catalogue highlights all interested parties, including the CWC States Parties, the Organisation for the Prohibition of Chemical Weapons (OPCW), the Global Partnership Against the Spread of Weapons and Materials of Mass Destruction, international organizations, and industry stakeholders, civil society’s contributions to strengthen reducing the threat of chemical weapons and promoting the peaceful use of chemistry. By providing a uniform product, interested parties will be able to easily identify programs, experts, and organizations that support the CWC and related chemical weapons nonproliferation instruments.”

“Emerging and Re-Emerging Chemical Threats (Part 2)”

MRIGlobal continues their discussion of CW threats with “Chemical Threats on the Battlefield and Home Front” in this blog post, explaining in part “Today’s conflicts around the world highlight the current and pressing need for continued research to help ensure the safety of anyone in danger. And though we touched on “Emerging and Re-emerging Chemical Threats” earlier in the year, because emerging and re-emerging chemical threats pose an ever-present challenge to both warfighters and civilians, we are revisiting the topic to share additional expertise. To learn more, we visited with Cristina Youngren and Evan Durnal, subject matter experts in MRIGlobal’s Integrated Defense Solutions division.”

“What Does a French Arrest Warrant Mean for Normalization With Assad?”

Julia Neumann discusses what France’s arrest warrants for Bashar al-Assad and several associates mean in practice and for regional normalization in this piece for Syria Direct.

“Why Cheap Drones Pose a Significant Chemical Terrorism Threat”

Zachary Kallenborn recently published this piece with The Bulletin of the Atomic Scientists, writing in part “Relatively cheap drones are becoming a mainstay of conflicts, from the war in Ukraine to the Israel-Hamas conflict in Gaza. Though drones were once the purview of rich and powerful militaries, it’s now possible to use cheap consumer drones in battle. With a few tweaks, they can whistle past even sophisticated air defenses. As Al-Bared’s case highlights, they may also present a significant chemical terrorism threat. Drones can be equipped with sprayers to deliver chemical weapons, or they could be used in an attack on a chemical plant. They could also provide critical attack support, helping with reconnaissance to plan out and conduct an attack, monitor law enforcement response, and create propaganda to highlight terrorist activities.”

“Stanford Emerging Technology Review: Reporting on Key Technology Areas and Their Policy Implications”

“Emerging technologies are transforming societies, economies, and geopolitics. This moment brings unparalleled promise and novel risks. In every era, technological advances buoy nations that develop and scale them—helping to save lives, win wars, foster greater prosperity, and advance the human condition. At the same time, history is filled with examples where slow-moving governments stifled innovation in ways policymakers never intended, and nefarious actors used technological advances in ways that inventors never imagined. Technology is a tool. It is not inherently good or bad. But its use can amplify human talent or degrade it, uplift societies or repress them, solve vexing challenges or exacerbate them. These effects are sometimes deliberate but often accidental.”

“The stakes of technological developments today are especially high. Artificial intelligence (AI) is already revolutionizing industries, from music to medicine to the military, and its impact has been likened to the invention of electricity. Yet AI is just one among many technologies that are ushering in profound change. Fields like synthetic biology, materials science, and neuroscience hold potential to vastly improve health care, environmental sustainability, economic growth, and more. We have experienced moments of major technological change before. But we have never experienced the convergence of so many technologies with the potential to change so much, so fast.”

“The Stanford Emerging Technology Review (SETR) is the first product of a major new Stanford technology education initiative for policymakers. Our goal is to help both the public and private sectors better understand the technologies poised to transform our world so that the United States can seize opportunities, mitigate risks, and ensure that the American innovation ecosystem continues to thrive.”

ICYMI: FBI Director Statement Before the House Committee on Homeland Security

FBI Director Christopher Wray delivered this statement to the House Committee on Homeland Security last month, highlighting the work of his agency across several mission areas, including emerging technologies and counter WMD. Wray explained in part of this statement that, “In addition to fighting terrorism, countering the proliferation of weapons-of-mass-destruction materials, technologies, and expertise, preventing their use by any actor, and securing nuclear and radioactive materials of concern are also top national security priority missions for the FBI. The FBI considers preventing, mitigating, investigating, and responding to weapons of mass destruction (“WMD”) terrorism a “no-fail” mission because a WMD attack could result in substantial injuries, illness, or loss of lives, while yielding significant social, economic, political, and other national security consequences. In collaboration with federal, state, local, tribal, territorial, and other partners, the FBI integrates complementary efforts to counter WMD terrorism. An example of this collaboration is the FBI-led Weapons of Mass Destruction Strategic Group. This interagency crisis action team spans more than 15 departments and agencies to coordinate the federal government’s response to WMD threats and incidents. Alongside the FBI, the Department of Homeland Security maintains the largest footprint on the strategic group.”

Read the full statement here.

NEW: Looking Ahead in Ukraine: What Could Increase the Risk of Escalation?

“As U.S. lawmakers debate the question of continued defense and humanitarian aid to Ukraine, the Ukrainian fight to expel Russian invaders continues with no end in sight. The stalemate on the front lines in Ukraine masks continued intense fighting and demands for resources on both sides that may drive longer-term changes—on the battlefield, inside Russia, and beyond. This could lead to further escalation, including the potential to turn the conflict into a wider war. Understanding which circumstances and policies may risk escalation in Ukraine is paramount: not only are decisions about supporting Ukraine critical to the long-term trajectory of the conflict but also the United States confronts a broad set of challenges across the globe.”

“Please join RAND’s National Security Research Division on Tuesday, December 5, 2023, 9:30 – 11:00 am ET, for a moderated panel discussion about which circumstances or policies may risk escalation in Ukraine—either deliberate or inadvertent—and the potential triggers and restraining factors likely to shape Russian escalation decisions in particular.”

“Missy Ryan, a national security reporter at the Washington Post, will moderate the discussion.”

Learn more and register here.

NEW: Threat Agnostic Biodefense Webinar: Assessing the Zoonotic Risk of Pre-Emergent Viruses

From PNNL: “Exploration of the “virosphere” is in its golden age. The sheer number of new viruses discovered daily, and the fact that most cannot be cultured, creates enormous uncertainty about where to allocate attention and resources. It is not an intractable problem, however, to distinguish those few viruses that are likely to emerge as zoonoses from the many others that are not. This talk describes two diametric approaches to addressing this problem. The first approach involves a field-to-lab investigative methodology that, when combine with biologically informed predictive computational models, can assess the zoonotic risk of viruses that have not yet been identified in humans. The second approach relies on the power of modern methods in anthropology and ethnography to identify zoonotic transmission pathways, even before the identification of any pathogens that might traverse those pathways. A unifying example is simian hemorrhagic fever virus and its relatives in the family Arteriviridae, which cause important animal diseases but have never been documented to infect humans. Both approaches identify these viruses as high-risk pre-emergent zoonoses.”

Learn more and register for this December 6 event here.

NEW: Bio & Beer

“As a rising global leader in the bioeconomy, investments in the future STEM workforce are critical in order to secure the U.S.’s position as a world resource for biohealth technology and innovations. Join us and our three guest speakers as we discuss the importance of a diverse, skilled STEM workforce to address rapidly increasing industry demand. We will also talk about training and other opportunities designed to prepare individuals for STEM careers. Enjoy an evening of networking, drinks, and fun!”

Learn more and RSVP here.

Meeting the Moment: Biodefense Policy, Procurement, and Public Health

From the Bipartisan Commission on Biodefense: “As the Nation continues to endure the consequences of recent pandemics, and with continued interest in biological weapons by nation states and other enemies, the federal government has an opportunity to address vulnerabilities in the biodefense enterprise. At this meeting, titled Meeting the Moment: Biodefense Policy, Procurement, and Public Health, the Commission intends to further explore : (1) biodefense policies and activities at the Department of Defense; (2) federal stockpile evaluation and decision-making for smallpox medical countermeasures; (3) needed authorities of the Department of Health and Human Services, including the Centers for Disease Control and Prevention; and (4) biodefense leadership.”

This meeting will take place on December 5, from 10:30 am until 4 pm ET. Register here.

2023 EPA International Decontamination Research and Development Conference-“Advancing Preparedness through Science and Collaboration”

“The clean-up of chemical, biological, or radiological (CBR) contamination incidents and natural disasters is a critical challenge for the United States. Understanding how to characterize and remediate affected areas of environmental contamination and waste is necessary for daily life to return.”

“The Decon Conference is designed to facilitate presentation, discussion, and further collaboration of research and development topics focused on an all-hazards approach to remediate contaminated indoor and outdoor areas, critical infrastructure, water distribution systems, and other environmental areas/materials.”

“This conference is free and open to the public. Content and presentations are geared towards the emergency response community, including local and state emergency managers, homeland security officials, first responder coordinators, private sector industry, risk managers, educators in the field of emergency management, and others.”

This event will take place December 5-7 in Charleston, SC. Learn more and register here.

Mitigating Arboviral Threats and Strengthening Public Health Preparedness

This event will take place on December 12 and 13. Learn more here.

Presidential Advisory Council on Combating Antibiotic-Resistant Bacteria (PACCARB) Virtual Meeting

This virtual meeting will take place on December 20 from 9-4 EST. Learn more here.

61st ISODARCO Course: Nuclear Order and International Security after Ukraine

This course will take place January 7-14, 2024, at the University of Trento. Learn more and register here.

International Conference, CBRNE Research & Innovation

“Worldwide, researchers, responders and industrial capacities have been commited to provide adapted response to these challenges.”

“Looking forward to your proposals for communication and to welcoming you at Strasbourg in March 2024!”

Learn more here.

cbrne-ri-conference-2024-_-flyer-ppt-v06.11.2023-1 Download

Registration for GHS 2024 Now Open

Council on Strategic Risks Launches the Nuclear Weapon Systems Project

“How states view the roles and relevance of nuclear weapons is changing. While these perspectives have been dynamic since the dawn of the atomic age, the changes occurring today and drivers of these changes are particularly worrisome—in particular given that they seem to be on the cusp of reversing a period heavily characterized by arms control agreements, reductions in global arsenals, and advances in international cooperation to reduce nuclear weapons risks.”

“CSR’s core nuclear policy work to address this challenging time has focused largely on qualitative approaches to reducing the risks of nuclear miscalculations, uses of these weapons, arms racing behavior, and other dangerous trends. Going beyond numbers of weapons—which has been a major policy focus given numerical limitations in past nuclear treaties—a qualitative view of the nuclear weapons landscape is done through the lens of the nuclear capabilities nations seek, and associated policies and postures. This can help to show where multiple nations might find areas for potential cooperation that would be mutually beneficial. It can also help to show where nations currently possess the capabilities they claim to need, and thereby in what ways cooperative or unilateral measures of restraint are the most appropriate.”

“In order to facilitate this work by CSR and by others, we are launching The Nuclear Weapon Systems Project to help visualize how the types of nuclear capabilities fielded in the world have evolved since the advent of these weapons.”

“This project seeks to document and characterize every deployed nuclear weapons system that NPT-recognized nuclear states have developed in history. More than just a list of bombs, missiles, and artillery shells, the resulting dataset illustrates a complex story of risks, strategies, and lessons learned—and lost. We consider this data to be a living resource, and encourage outside contributions and feedback.”

Read more here.

“Georgetown Global Health Center Launches First Open-Access Wildlife Disease Database”

Georgetown University Medical Center’s Center for Global Health Science and Security recently announced “the launch of a first-of-its-kind wildlife disease database — a system for collecting records of viruses, bacteria, fungi, parasites, etc. — designed to support an early warning system for potential viral emergence. The Pathogen Harmonized Observatory, or PHAROS, is open to the global community and free to access.”

“Scientists in GHSS’ Verena program, a collaborative institute comprising a global team of scientists, designed PHAROS to advance research and education around viral emergence — the process of viruses jumping from animals to humans. Verena co-founder and director Colin Carlson, PhD, says most platforms designed to track diseases in wild animals are very limited and are developed only in response to a major outbreak, such as birds dying off suddenly due to avian flu.”

‘“Our goal is to build a data sharing system that lets us eventually predict pandemics like the weather,” Carlson says. “When we collect data on wildlife viruses, it gets published in journals and then lost forever, because it isn’t ever standardized or compiled. After COVID, there’s no excuse to keep working that way.”’

Texas A&M Research Assistant Professor (Pandemic Preparedness/Biosecurity) Openings

Texas A&M University’s Scowcroft Institute of International Affairs is seeking up to two Research Assistant Professors with expertise in pandemic preparedness and/or biosecurity. The Research Assistant Professor will be in the Scowcroft Institute of International Affairs, Bush School of Government & Public Service, and will work with the Pandemic Preparedness & Biosecurity Policy Program. Responsibilities include teaching graduate courses, conducting research, and writing policy-relevant publications on biosecurity, global health security, bio and agro-defense, federal life sciences policy, one health, biotechnology, or related policy topics.

Learn more and apply here.

Pandora Report 4.21.2023

April 21, 2023April 21, 2023 by dkellogg97, posted in Pandora Report

This week is another mixed bag highlighting recent alumni achievements and program happenings, discussing the release of annual State Department reports on global compliance with the NPT, CWC, and BWC, and Senate Republicans’ latest report on the origins of SARS-CoV-2. Several new publications and upcoming events are included, as well as open calls for experts and fellowship opportunities.

Fairfax County Health Department Recognizes Mason for Pandemic Response

Recently, “George Mason University was recognized by the Fairfax County Health Department (FCHD) for being an outstanding system partner in managing and operationalizing the university’s pandemic planning, response, and recovery. The partnership, which began long before the COVID-19 pandemic, has been vital in enhancing the health and well-being of the shared communities.”

The same piece announcing this interviewed a Biodefense PhD alumna, Julie Zobel, who is currently associate vice president of Safety, Emergency, and Enterprise Risk Management and Mason’s COVID director-“Julie Zobel…expressed her gratitude for the partnership between Mason and FCHD. “We are honored to have worked alongside the Fairfax County Health Department to serve our community during these challenging times,” said Zobel. “The success of our pandemic response would not have been possible without this partnership. We look forward to continuing our collaboration and commitment to public health”’

Pathogens Project Convenes Meeting in Geneva

The initiative on “Creating the Framework for Tomorrow’s Pathogen Research” hosted a public meeting in Geneva, Switzerland this week. This conference included Pathogens Project taskforce members, policy leaders, journalists, scientists, and civic leaders, among others.

The conference featured both private and public (recorded) workshops. Furthermore, according to the Project’s site, “It will produce a final summary report with recommendations, along with individually prepared papers focused on risk assessment and mitigation of high-risk pathogen research. Conference papers will be published in a special edition of the Bulletin of the Atomic Scientists and made available on the Bulletin’s website.”

Biodefense Graduate Program Director Dr. Gregory Koblentz was on a panel at the event, “Empirical studies tracking risks”, alongside Dr. Rocco Casagrande (Founder and Chair of the Board, Gryphon Scientific), Dr. Weiwen Zhang (Distinguished Professor of Synthetic Biology and Biochemical Engineering, Tianjin University of China), and Dr. Sandra López-Vergès (Senior Health Researcher and Chief, Gorgas Memorial Institute of Health Sciences). Koblentz discussed ongoing work from the Global BioLabs project, which he co-leads with Dr. Filippa Lentzos of King’s College London. Global BioLabs offers an interactive map of BSL-4 and BSL-3+ facilities globally and recently released Global BioLabs Report 2023.

Biodfense Graduate Program Director Dr. Gregory Koblentz on the “Empirical studies tracking risks” panel

Visit https://www.globalbiolabs.org/ to access this interactive map feature

State Department Releases Arms Control, Nonproliferation, and Disarmament Compliance Reports

The State Department’s Bureau of Arms Control, Verification, and Compliance recently released the 2023 Annual Report on Compliance with the Chemical Weapons Convention (CWC) and the 2023 Adherence to and Compliance with Arms Control, Nonproliferation, and Disarmament Agreements and Commitments Report. The latter notes BWC compliance issues in the People’s Republic of China, Islamic Republic of Iran, Democratic People’s Republic of Korea, and the Russian Federation. This includes discussion of the lack of information needed to assess if China has eliminated its BW program, concerns about Iran’s ability to produce lethal BW agents, knowledge of North Korea’s BW program, and Russia’s violations of Articles I and II of the BWC.

The report also notes concerns about lack of transparency in Myanmar’s nuclear work (though evidence does not indicate that the country violated the NPT). The appended report on CWC compliance discusses further concerns with Myanmar and other countries’ compliance with the treaty. The report explains that “Four States Parties – Burma, Iran, Russia, and Syria – are certified in non-compliance with the CWC. Russia and Syria were first certified in non-compliance in April 2018. Iran was first certified in non-compliance in November 2018. Burma was first certified in non-compliance in 2019. Additional information is available in the 2023 classified Condition (10)(C) Reports. The United States also cannot certify the People’s Republic of China’s compliance, which was first reported in 2021.”

Dr. Gregory Koblentz and Madeline Roty (Biodefense MS ’21) authored a piece in the Bulletin of the Atomic Scientists in 2020 discussing Myanmar’s past with CW and US efforts to get the country to reconcile and come into compliance with the CWC. Following the 2021 coup d’état and the ouster of Aung San Suu Kyi, Myanmar is unlikely to meet the requirements needed to be in compliance, despite the progress outlined by Koblentz and Roty.

Senate Republicans Release COVID Origins Report

Senate Republicans have released their report exploring the origins of the COVID-19 pandemic, building on the short interim report released in October 2022. Two documents titled “Muddy Waters: The Origins of COVID-19” were released; one by the Muddy Waters Group and another prepared by Senator Roger Marshall alongside Dr. Bob Kadlec, Bob Foster, and members of the 117th GOP Health, Education, Labor & Pensions (HELP) Committee’s staff. The report was a product of the work of former Senator Richard Burr of North Carolina, who commissioned the report and oversaw the release of the October HELP committee interim report. Readers may recall the controversy that accompanied the release of that interim report, which coincided with the release of articles by Vanity Fair and ProPublica that were widely criticized for poor quality translations and other inaccuracies we discussed in November.

That troubled trend seems to continue in this new report, with admitted circumstantial evidence used to find that “The preponderance of information affirms the plausibility of a research-related incident that was likely unintentional resulting from failures of biosafety containment during vaccine-related research.”

Axios explains that the report “…argues that scientists haven’t found any naturally occurring viruses with the same composition of the coronavirus, and that there’s evidence the virus was circulating in Wuhan before the first known cases connected to the wet market were reported…It also argues that it appears Chinese researchers began development of at least two COVID vaccines in November 2019, including at the WIV, which “means SARS-CoV-2 would have been present at the WIV before the known outbreak of the pandemic,” and “It also documents numerous instances of lab safety concerns throughout 2019, including around the time when the virus may have first appeared.”

Much of this, however, relies on the same previously disputed points made in the interim report and the accompanying ProPublica and Vanity Fair pieces. Furthermore, as Caitlin Owens highlights in another piece for Axios, the reports rely on circumstantial evidence which means “The absence of evidence pointing, for example, to a precise transmission route from animals to humans will lead to very different interpretations of the same information.”

Dr. Angela Rasmussen, a virologist who has worked on high-profile studies supporting the idea of a natural origin of SARS-CoV-2 told Owens that the report “…demonstrates, in my view, a political agenda that’s meant to bolster the idea that the lab leak hypothesis is more supported than it is. But also it is so full of just factual errors.” Rasmussen also counters a number of key assertions made in the new report, including those such as the presence of a furin cleavage site on SARS-CoV-2’s spike protein is in itself suspicious and that the Wuhan Institute of Virology was dealing with substantial biosafety problems that Party leadership was concerned about.

All told, this report seems unlikely to change much or anything in this ongoing public debate.

Understanding Cyber-Warfare: Politics, Policy and Strategy

Chris Whyte and Brian Mazanec (a Biodefense PhD alumnus) are pleased to announce the publication of the second edition of their textbook Understanding Cyber-Warfare: Politics, Policy and Strategy (Routledge, 2023). This second edition of their popular textbook offers an accessible introduction to the historical, technical, and strategic context of global cyber conflict. The second edition has been revised and updated throughout, with three new chapters, to include coverage of the role of cyber in the war in Ukraine as well as a discussion of the role of emerging information technologies like artificial intelligence and quantum computing in shaping the dynamics of global cyber conflict. The second edition has recieved positive reviews. For example James R. Clapper, the former Director of National Intelligence, called it “an authoritative tutorial on the arcane complexities of cyber warfare” and said this edition “updates a previous version and makes the book more contemporary. It is a must-read for those who are serious about mastering this unique medium of combat, in all its dimensions.” More details can be found here.

“Artificial Intelligence and Machine Learning for Bioenergy Research: Opportunities and Challenge”

New from the US Department of Energy’s Genomic Science Program: “The integration of artificial intelligence and machine learning (AI/ML) with automated experimentation, genomics, biosystems design, and bioprocessing represents a new data-driven research paradigm poised to revolutionize scientific investigation and, particularly, bioenergy research. To identify the opportunities and challenges in this emerging research area, the U.S. Department of Energy’s (DOE) Biological and Environmental Research program (BER) and Bioenergy Technologies Office (BETO) held a joint virtual workshop on AI/ML for Bioenergy Research (AMBER) on August 23–25, 2022.”

“Approximately 50 scientists with various expertise from academia, industry, and DOE national laboratories met to assess the current and future potential for AI/ML and laboratory automation to advance biological understanding and engineering. They particularly examined how integrating AI/ML tools with laboratory automation could accelerate biosystems design and optimize biomanufacturing for a variety of DOE mission needs in energy and the environment.”

The report describing the workshop findings is now available here.

“The Making of a Biosafety Officer”

David Gillum discusses the roles of biosafety professionals in this piece for Issues in Science and Technology, writing in part “The question of how the biosafety community generates and transmits knowledge is interesting in itself, but it is also an urgent issue. The need for biosafety workers is growing just as current professionals are skewing older: an estimated 54% are over 50 and one of the few surveys of the field suggests there are six times as many biosafety officers over 70 as there are under 30. Preparing more of us—and keeping the public safe as the complexity of biological research, health, and manufacturing projects burgeons—is made more difficult by the importance of tacit knowledge in our education. Methods for understanding, communicating, and mitigating risk are difficult to transfer to others. To enhance public health and safety, people in my line of work should ease this transfer by considering how the profession might be standardized and formalized.”

“Viral Families and Disease X: A Framework for U.S. Pandemic Preparedness Policy”

In this policy brief for the Center for Security and Emerging Technology, Schuerger et al. explain that “Pandemic threats are increasing as globalization, urbanization, and encroachment on animal habitats cause infectious outbreaks to become more frequent and severe. It is imperative that the United States build a pipeline of medical countermeasure development, beginning with basic scientific research and culminating in approved therapies. This report assesses preparedness for families of viral pathogens of pandemic potential and offers recommendations for steps the U.S. government can take to prepare for future pandemics.”

“Integrating Public and Ecosystem Health to Foster Resilience: Proceedings of a Workshop”

“Ecosystems form the foundation upon which society can survive and thrive, providing food, water, air, materials, and recreation. The connections between people and their environments are under stress from human-driven climate change, pollution, resource exploitation, and other actions that may have implications for public health. Existing intellectual frameworks including One Health, Planetary Health, ecosystem services, and nature-based solutions help to connect different elements related to the resilience of public health and ecological health systems. However, because of the breadth of this issue, many implications regarding public health are not well characterized, leading to gaps in understanding the interconnections between public health and ecosystem health systems and how ecosystem resiliency may affect public health.”

“The National Academies of Sciences, Engineering, and Medicine held a workshop in September 2022 focused on the integration of public and ecosystem health to foster resilience. This workshop was designed to inform the development of a research agenda aimed at bridging the knowledge-to-action gap and spur a move from research to policy and practice. Participants included a broad range of interdisciplinary researchers and practitioners from the public health, natural resource management, and environmental protection communities. The workshop provided a forum for the exchange of knowledge, discussion of critical gaps in understanding and practice, and identification of promising research that could support the development of domestic and international policy and practice.”

“The proceedings summarizing the workshop is now available for free download, and a public webinar exploring the workshop topics will take place virtually in early May. Click below to download the proceedings, register for the webinar, and visit the project page to more about this publication.”

“The Right People and the Right Question: Getting Chemical Weapons Out of Syria”

In this recent video story for the Stanley Center for Peace and Security, Tom Countryman discusses his tenure as the Assistant Secretary of State for Non-Proliferation as the Department navigated concerns about Syria’s chemical weapons. He highlights key lessons learned in doing this, including the need to mind the political context one is operating in, the importance of knowing who the right people are and being able to motivate and mobilize them, appropriately identifying goals and what is needed to achieve them, and, finally, not allowing the difficulties of political relationships to overshadow common interests.

“Reducing the Problem: Eliminating Syria’s Chemical Weapons”

Andy Weber discusses elimination of the Syrian CW stockpile in this video story for the Stanley Center. He covers how he came to be the Assistant Secretary of Defense for Nuclear, Chemical, and Biological Defense Programs and more, saying in part “Sometimes, whether it’s Gaddafi in Libya, or Assad in Syria, it’s unsavory characters, who have these horrific weapons. And you have to work with them sometimes, and it’s hard, and it’s challenging, and you have to keep your eyes open. You need to make sure you’re not indirectly helping them in another area. But that’s where good oversight comes in, and you have to think about the objective of all these programs. The objective is to save lives, to prevent mass casualties in any country, anywhere in the world. These are global programs that improve global security.”

“Armed Conflict and Nuclear Security: Implications for Europe”
Muhammed Ali Alkiş discusses the efficacy of the traditional approach to nuclear security in this recent publication for SIPRI: “The traditional approach to nuclear security is unlikely to be effective against the full spectrum of current threats, including those posed by state actors. The lessons learned from the Russian occupation of Ukrainian nuclear power plants, the potential radiological consequences of armed attacks against nuclear facilities and the potential increase in the number of nuclear power states in the future underscore the need for a strong international framework to address nuclear security challenges.”

“The European Union (EU) is committed to implementing the highest international standards for nuclear security and may therefore be in a position to lead efforts to address threats of armed attacks against nuclear installations. This paper provides a range of potential policy recommendations and actionable steps that the EU and its member states could take at legal, institutional and operational levels to minimize the nuclear security threats posed by armed conflict in the future. While they may appear politically challenging or even unrealistic at present, the conflict in Ukraine highlights the very real need for the types of actions recommended by this paper.”

“Technology Primer: Artificial Intelligence & Machine Learning”

Checkout this new report from the Harvard Belfer Center: “Artificial Intelligence (AI), can be defined as the theory and application of machines—especially computer programs—to perform tasks that typically require human intelligence, such as image captioning and generation, speech recognition and synthesis, natural language understanding and production, tool assembly and utilization, as well as various other perception-action based engagements. AI, in its current technological state, is being applied in various industries and domains, such as online advertising, financial trading, healthcare, pharmaceutical, and robotics. The lucrative market opportunities offered by AI applications have attracted investments from tech giants like Alphabet, Apple, Meta, Amazon, and Microsoft, as well as research universities and startups.”

“Machine Learning (ML), commonly categorized as a subfield of AI, is a field of study concerning the automatic discovery of historical patterns in data using statistical algorithms. ML’s driving principle is that historical patterns are likely to reappear in the future. The discovered historical patterns can therefore be leveraged to make accurate predictions on data that has not been seen before. Once an algorithm is trained, it can be applied to new, larger streams of data. ML is already an integral component of many deployed commercial applications, such as content generation (e.g., text, image, audio, video generation), virtual assistants, social media feed ranking, content recommendation systems, financial market prediction, and healthcare screening and diagnostic tools, as well as administrative applications. In addition, ML is foundational in various other emerging technologies, such as autonomous vehicles and next-generation cybersecurity.”

“Currently, United States policy with regards to AI often derives from interpretations of various pre-existing legislations and legal precedents. However, with the increased awareness of AI-related risks (e.g., bias, accountability, misuse, etc.), and the potential size of their impact, over the last decade, the number of proposed bills containing AI provisions significantly increased at both the state and federal levels (i.e., from two bills in 2012 to 131 in 2021), with 2% of them becoming law at the federal level and 20% of them becoming law at the state level. Similarly, policies and regulatory frameworks are being crafted to guide the development and application of AI in other continents too, with Europe and Asia leading the process. Acknowledging the potential impact of this technology on human life and societal dynamics, there is a pressing need for U.S. legislators and policymakers to remain engaged in the ethical and practical development of artificial intelligence.”

Lessons From the COVID War: An Investigative Report

book-talk-save-the-date Download

The independent, nonpartisan Covid Crisis Group has spent two years investigating the causes and consequences of the COVID-19 pandemic. The Schar School of Policy and Government and Biodefense Graduate Program are proud to host two members of the group, Andrew Kilianski and Melissa Harvey, for an in-depth discussion of the group’s long-awaited report on what went wrong—and right—with America’s response to the pandemic: Lessons from the Covid War: An Investigative Report (Public Affairs, 2023).

The Covid Crisis Group is a remarkable group of 34 distinguished practitioners and scholars from a variety of backgrounds who came together determined to learn and share the most valuable lessons from the worst peacetime catastrophe of modern times. Lessons from the Covid War is plain-spoken and clear-sighted. It cuts through the jumble of information to make some sense of it all and answer: What just happened to us, and why? And crucially, how, next time, could we do better? Because there will be a next time.

Book Event: Open Source Investigations in the Age of Google

From the Center for Strategic and International Studies: “How did a journalist find out who was responsible for bombing hospitals in Syria without leaving his desk in New York? How can South Sudanese activists safely track and detail the weapons in their communities, and make sure that global audiences take notice? What are policy makers, lawyers, and intelligence agencies doing to keep up with and make use of these activities? A team of authors tackle these questions in their new book “Open Source Investigations in the Age of Google.”‘

“This new interdisciplinary book seeks to answer these questions and more, with contributions by prize-winning practitioners, experts, and rising stars from across the open source investigation community. Painting a comprehensive picture of the digital information space today, it explores the manner and methods in which current open source investigations are conducted, as well as examines the opportunities and challenges they present to salient issues to the information environment such as trust and transparency, accountability, justice, amongst others.”‘

“Please join CSIS virtually on April 24, 1-2 pm EDT for a panel discussion on open-source investigations moderated by Diane Cooke, visiting fellow with the International Security Program. The conversation will include Hans Kristensen, Director of the Nuclear Information Project, Federation of American Scientists; Christiaan Triebert, journalist on the New York Times Visual Investigation Team; and Henrietta Wilson, Senior Analyst for the Strategic Concept for the Removal of Arms and Proliferation, SOAS University of London & King’s College London.”

Online Event: Civil Society at the 5th CWC Review Conference

From the CWC Coalition: “The Fifth Five-Year Review Conference (RC-5) for the 1997 Chemical Weapons Convention will be held in the Hague from May 15-19, 2023.”

“At the CWC RevCon, member states and the broader chemical weapons disarmament community will gather to assess past achievements, treaty implementation and compliance, and discuss plans to strengthen the CWC in the years ahead.”

“You are invited to join a virtual discussion on the upcoming Fifth Five-Year CWC Review Conference (RC-5), major issues to be addressed, and the role of civil society and non-governmental organizations.”

“We will be joined by Elisabeth Waechter, Head of Public Affairs at the OPCW. Paul Walker, the Chair of the CWC Coalition, will moderate.”

This event will take place on April 26 at 10 am EST. Register here.

National Biodefense Science Board Public Meeting

The NBSB will meet virtually on May 4 at 2 pm EST to discuss lessons from COVID-19 and will present recommendations on several topics, including collection, analysis, and sharing of operational health data, uses of virtual healthcare during disaster response, and disaster response challenges specific to rural and underserved communities. Register here.

Virtual Workshop: Prioritizing Actions for Epidemic and Pandemic Preparedness

From the National Academies: “Please join us May 4 & 18, 2023 from 8 a.m. to 12 p.m. ET for a virtual symposium examining how to strengthen the evidence-based prioritization of epidemic and pandemic preparedness and response capabilities.

The symposium will convene global health planning stakeholders, including those in government and academia, and across health- and non-health sectors to:

Review assessment tools and how, independently and together, they relate to national action planning.
Gain insight into how countries and organizations currently select priorities in funding for epidemic prevention, detection, and response.
Assess evidence for effective prioritization approaches to building disease surveillance and risk communication capabilities.
Identify governance structures that can support robust and reliable systems for epidemic and pandemic preparedness and response investments.

This symposium is in collaboration with the Division on Earth and Life Studies. Learn more about this workshop by visiting the event webpage.”

Nobel Prize Summit-Truth, Trust and Hope

Taking place May 24-26 this year in DC and virtually, this Nobel Prize Summit asks “How can we build trust in truth, facts and scientific evidence so that we can create a hopeful future for all?”

“Misinformation is eroding our trust in science and runs the risk of becoming one of the greatest threats to our society today.”

“Join us at this years’ Nobel Prize Summit which brings together laureates, leading experts and you in a conversation on how we can combat misinformation, restore trust in science and create a hopeful future.”

Learn more and register here.

CSWMD 2023 Annual Symposium: WMD in the Decisive Decade

“The National Defense University’s Center for the Study of Weapons of Mass Destruction (CSWMD) invites you to join us on 14 June 2023 for the virtual Annual CSWMD Symposium, titled WMD in the Decisive Decade.”

“This year’s symposium will explore the cognitive impacts WMD has on strategic decision making and the challenges associated with operating in an environment where WMD has been employed. It will be an opportunity for the WMD community to engage with officials and thought leaders on current WMD challenges at the unclassified level, including keynote addresses by Richard Johnson, Deputy Assistant Secretary of Defense for Nuclear and CWMD Policy and Rebecca Hersman, Director of the Defense Threat Reduction Agency.”

“For more information and to register for this event click here. Please RSVP by 9 JUNE 2023.”

“We look forward to hosting you for the event. For more information about the WMD Center and reference our research, please visit our website at https://wmdcenter.ndu.edu/ and follow us on Twitter and on LinkedIn.”

Gordon Research Conference: Cross-Cutting Science Facilitating Collaboration Across the Threat-Science Research Community

“The Nonproliferation, Counterproliferation and Disarmament Science GRC is a premier, international scientific conference focused on advancing the frontiers of science through the presentation of cutting-edge and unpublished research, prioritizing time for discussion after each talk and fostering informal interactions among scientists of all career stages. The conference program includes a diverse range of speakers and discussion leaders from institutions and organizations worldwide, concentrating on the latest developments in the field. The conference is five days long and held in a remote location to increase the sense of camaraderie and create scientific communities, with lasting collaborations and friendships. In addition to premier talks, the conference has designated time for poster sessions from individuals of all career stages, and afternoon free time and communal meals allow for informal networking opportunities with leaders in the field.”

This conference will take place July 9-14 in Ventura, CA. Learn more and register here.

Call for Applications: Early-Career Fellowship for Reducing Nuclear Weapons Risks

The Council on Strategic Risks “is announcing a continuation of its Early-Career Fellowship for Reducing Nuclear Weapons Risks. Through this six-month program, early-career professionals will work with leading experts from CSR’s team and network to develop a better understanding of practical risk reduction concepts and to generate new ideas regarding:

Nuclear strategic stability
Strengthening norms against nuclear weapons threats and use
Avoiding miscalculations and preventing accidents/incidents
Preventing and addressing nuclear proliferation
Responsibilities of nuclear weapons-capable states”

Learn more and apply here.

Seeking Subject Matter Expert(s) (SMEs) with Experience Educating Global Audiences on the Importance of Securing Emerging Technologies

“CRDF Global is seeking subject matter expert(s) (SMEs) to engage and educate global audiences. The expert(s) will work on deliverables relating to building a culture of security in the private sector. These deliverables will include the development of an online asynchronous course and four hybrid hackathons, which will take place at local incubator hubs in several countries.”

“The expert(s) will design and develop an asynchronous course to counter misuse and raise awareness of emerging technologies with potential weapons of mass destruction (WMD)-related applications by state and non-state actors. The audience for this course will be individuals in the private sector (particularly in start-ups, innovation hubs, and incubator spaces) in various countries globally. This asynchronous course should train key stakeholders on how to develop and foster a culture of security.”

Learn more here.

Weekly Trivia Question

You read the Pandora Report every week and now it’s time for you to show off what you know! The first person to send the correct answer to biodefense@gmu.edu will get a shout out in the following issue (first name last initial). Our question this week is: “In 1984, what group spread Salmonella enterica at restaurants and shops in Dulles, Oregon in an attempt to influence local elections?”

Last week, our question was: “In the 2011 film Contagion, Dr. Erin Mears (played by Kate Winslet) is an officer in which CDC program?” The answer is the Epidemic Intelligence Service.

Pandora Report: 11.4.2022

November 4, 2022November 30, 2022 by dkellogg97, posted in Pandora Report

Happy Friday! This week focuses heavily on China and Russia, covering the recent ProPublica piece on the Wuhan Institute of Virology, Shanghai’s lockdown, Russia’s failed attempt at creating a UN Security Council committee to investigate its false claims about supposed US biological weapons facilities in Ukraine, and more. We also cover new publications, a new podcast release from the University of Bath’s Dr. Brett Edwards, upcoming events, and an exciting fellowship opportunity from the WHO.

About That ProPublica Piece

Late last week, ProPublica and Vanity Fair released a piece in conjunction with the Senate HELP Committee minority’s interim report, claiming to have unveiled new information from the Wuhan Institute of Virology (WIV) supporting the lab leak theory of COVID-19’s origin. In it, Katherine Eban and Jeff Kao rely heavily on the work of a single self-proclaimed polyglottal State Department political officer to translate Chinese Communist Party (CCP) “party speak,” which he claims native speakers “can’t really follow…” Now, the piece some have described as a train wreck is being heavily criticized for having faulty translations, mis-matched dates, misrepresenting the sources of the documents discussed in it, not understanding how common VPN usage is in China-related research, and more. ProPublica is reportedly scrambling to review critical details of their piece, but is it too late? Let’s talk about some core issues with the article and what they might mean long term.

‘Party Speak’ or Just Lost in Translation?

The first half of the ProPublica piece is dominated by glowing discussion of Toy Reid, a former RAND Corporation employee and East Asia political officer at the US Department of State, covering his blue collar origins and attendance at Harvard. The authors then discuss how Reid spent over a year working for the Senate HELP Committee, using a VPN to search “dispatches” on the WIV’s website from Hart Senate Office Building and his Florida home. They write, “These dispatches remain on the internet, but their meaning can’t be unlocked by just anyone. Using his hard-earned expertise, Reid believes he unearthed secrets that were hiding in plain sight.”

Plain sight is right! These “dispatches” were updates posted to the Wuhan Institute of Virology’s (WIV) homepage on the general news tab. In fact, you can go look through this whole tab here to see mundane entries ranging from a recent day reflecting on the 20th National Congress to a July post about WIV celebrating the 101st anniversary of the Party, to general updates about different trainings and publications related to the institute. Therein lies one of the fundamental problems with this piece-these were not secretive dispatches internal to the Party. These are essentially press releases meant to face outward. Yes, they are laden with mentions of comrades, references to struggles and frontlines, and key Chinese leaders, including Xi Jinping and the recently ousted Li Keqiang. They are, after all, written by Party members in a major facility of the Chinese Academy of Sciences. They are going to have this kind of language by default, especially around times like national congresses and major anniversaries.

To be clear, the CCP does use euphemisms and round-about language at times to describe high-level concepts and goals. In fact, some scholars spend the bulk of their careers conducting political discourse analysis and understanding leaders’ officialease or government-speak. Some do focus on CCP party speak, which has become especially interesting in the Xi years. However, this is definitely not unique to the CCP as one can find scholars dissecting and analyzing any number of world leaders’ speeches and government lexicons. It is also important to recognize that this concept is not some niche or extremely esoteric concept known only to a few in China watching circles. Students studying Chinese politics overwhelmingly have to learn things like “crossing the river by touching the stones” or “socialism with Chinese characteristics” as a Chinese-specific form of Marxism-Leninism throughout the periods of Dengism, Three Represents, Scientific Outlook on Development, and now Xi Jinping Thought. It it core to understanding national agendas throughout different leadership periods.

However, with this comes the understanding that Party documents are laden with this kind of jargon and narrative furthering. This also is not unique to the CCP. In fact, Harry Hodgkinson wrote an entire guide in 1955 on Soviet jargon and unique meanings Communist parties give to particularly terms. While this jargon and overarching nationalistic narratives offer important context for the WIV posts, they do not represent some in-between-the-lines version of Chinese that “even native Mandarin speakers can’t really follow…” Rather, they help explain why the language in the posts seems so dramatic and nationalistic.

What’s in a Narrative?

In October 1949, Mao Zedong declared the official founding of the People’s Republic of China. With Chiang Kai-shek and the remainder of the KMT exiled to the island of Taiwan and the decades long civil war over, Mao was left to figure out how to actually lead the new PRC. Central to this were narratives of overcoming the century of humiliation, protecting the sovereignty and integrity of Chinese territory, bringing justice for China against those who subjugated it, and building a strong, advanced country. These ideas were central to nationalism at the time and drove pushes to modernize like the infamous Great Leap Forward. As Dr. Kerry Brown of King’s College London writes, “That self-designated task of bringing about justice for China was the main justification for the Party’s many mistakes under Mao when the second resolution on its own history was produced a few years after his death in 1981.” Themes of struggle against western imperial powers and self-determination were critical political tools wielded by the Party, even in the face of wildly unpopular, destructive policies.

Though it looks different today, narratives of national struggle and rejuvenation are still important features of CCP rhetoric, even for Party members at a CAS laboratory. Brown discusses the power of narrative in modern China, writing, “For the current dominant leader Xi Jinping, the notion that the Party is a kind of epistemic community, one uniquely placed to carry China forwards to the fulfilment of its great quest for a just outcome to history, is becoming more powerful by the day. Seen in these terms, the Party is not so much about power per se – but power to deliver this historic outcome. That perhaps explains why, despite the many challenges and problems with its practice and its own history, it still remains so dominant in China.” Today, concepts like the Chinese dream, national rejuvenation, and the goal of becoming fully modernized by 2049 are central themes Party rhetoric uses, even in discussing day-to-day work at different lower-level organizations.

In the context of the Wuhan Institute of Virology posts, this is seen in the framing of work at the lab as some kind of grand struggle. In one of the first WIV posts referenced by ProPublica and Vanity Fair (available here in its original format), the authors claim to have found a dispatch that “…referenced inhumane working conditions and “hidden safety dangers.” On Nov. 12 of that year, a dispatch by party branch members at the BSL-4 laboratory appeared to reference a biosecurity breach: “These viruses come without a shadow and leave without a trace.”

However, as a number of Mandarin speakers and China watchers have pointed out online, this was actually a very general post about how the facility went from humble beginnings at its founding to now being a training hub and “fighting fortress” of China’s research and public health. It is written not unlike other fictional and non-fictional works describing BSL-4 facilities in other countries (The Hot Zone, anyone?)-hours are long in these space suit-like positive pressure suits, the pathogens are unimaginably dangerous, and those doing the work are brave, hardworking, brilliant scientists.

Much of Toy Reid’s interpretation of this post depends on a misinterpretation of “每当这时” (Měi dāng zhè shí, “whenever”) in the context of a description of Party members leading by example whenever handling BSL-4 pathogens. Reid instead took this as “whenever there are biosafety breaches,” and not some inspirational statement about Party members. Other portions of the article focus on visits from Chinese Academy of Sciences officials and seminars on the importance of biosafety and commonly noted issues during safety inspections. However, these were updates about high-level visitors and general efforts to ensure the facility maintained safety standards, much like those any organization anywhere might make.

a lot of it is like reading a corporate newsletter that says 'This year, we all remembered that there's no I in Team!' and then concluding that this mysterious 'I' was removed from the team. What happened to him? What are they concealing? https://t.co/OG6AV9Z5Es
— James Palmer (@BeijingPalmer) October 31, 2022

James Palmer, deputy editor at Foreign Policy and author of Foreign Policy’s China Brief, discussing the normal workplace nature of the WIV posts

The Wuhan Institute of Virology boasts the PRC’s first BSL-4 (P4) facility, which opened in 2018, marking a major milestone for the country. A boastful post about how it came from humble beginnings but, through the work of very dedicated personnel, is now doing important, taxing work and striving to always be better is very par for the course. There is even a corny word play in the post about how Party members “infect” (Gǎnrǎn, “感染”) others with their practical actions and safety-conscious attitudes. As many have now pointed out, this is just the Party bragging about how dedicated their members are, how far the facility has come, and how personnel are constantly working to better themselves and their organization. In other words, it is furthering the Party narrative, not hinting at secret internal problems.

References throughout the posts cited by ProPublica to General Secretary Xi Jinping and his discussion of technology as a weapon make sense in the context of Party-authored news posts. Xi Jinping has achieved power unlike any previous leader, capturing himself a historic third term after the country removed presidential term limits in 2018. Xi Jinping Thought (“Xi Jinping Thought on Socialism with Chinese Characteristics for a New Era”) was also formally enshrined in the Party’s constitution that year, further cementing Xi’s unique power over the Party with the CCP describing it as “Marxism of contemporary China and of the 21 century.” With this context in mind, it makes sense for Party members at WIV to frequently reference Xi and his national goals and speeches. However, Reid instead took this as literal input directly from Xi to the lab following the biosafety incident he claims a previous post references.

Issues with the senate minority report on covid origins and the latest vanity fair/prorepublica piece that covers it.

Two issues.

1) Bad translation of a sentence in a Nov 12 WIV news release.

2) Bad interpretation of events leading to the Nov 17 safety training at WIV. 1/n
— Zhihua Chen (@zhihuachen) October 29, 2022

Zhihua Chen’s thread on translation and dating issues in the ProPublica article

Finally, even if this was all true-the WIV had a 2019 biosafety incident and Xi Jinping was personally concerned enough to send an urgent message about it to WIV himself-why would any of that be posted on the institute’s website? As was just discussed, the narrative matters a lot in Chinese politics; image is everything and the Party is very secretive as a result. As the country continues to compete internationally in all areas, including the bioeconomy, it does not make sense for the Party to air dirty laundry about a supposed biosafety incident and workers’ concerns in a public space. If the core argument is that China is covering up a lab leak, the question of “Why would the Party allow the facility in question to publicly hint at mismanagement and safety issues on its own website?” must be answered.

Implications

Ultimately, bad faith takes on China, COVID-19, and biosafety hurt us all. There is a fundamental difference between calling for an in-depth investigation, holding the PRC accountable for its failures, working towards making sure we are better prepared for the next time something like this happens, and inappropriately equating mischaracterized and poorly translated press releases to some kind of damning evidence of a lab leak origin of SARS-CoV-2. The US-PRC relationship is in a very dangerous place and, while criticism of the CCP’s handling of COVID-19 is absolutely warranted, this article is likely to become political fodder for the Party. In fact, the Chinese government has already condemned the piece, claiming that it was driven by US politics.

While ProPublica claimed to have corroborated Reid’s work with unnamed “experts” on CCP communications, the swift backlash and ProPublica’s moves to reach out to other translators cast further doubt on the caliber and motivations of those consulted initially. This is in addition to concerns about the experts they claim to have consulted on the WIV’s claims about biosafety and time researchers spend in BSL-4. In the end, one can be both critical of the CCP and its practices while not resorting to an overly hawkish view that leads to finding suspicion in the mundane.

Finally, this points to a need for interdisciplinary collaboration and competent understanding of the political realities of the PRC in assessing issues like biosafety. What may look to someone with little knowledge of Chinese political discourse as alarming messages are actually pretty par for the course in terms of statements and news updates on an official website. Outside of debates on SARS-CoV-2’s origin in the scientific community, scholars in the social sciences and humanities and experts working in all sorts of fields can offer important context that, in this case, marks the difference between recognizing standard Party rhetoric and sounding alarm bells over normal updates on the WIV’s website.

For more on this, including discussions of the scientific debate about COVID-19’s origin as discussed in the Senate report and ProPublica article, check out Michael Hiltzik’s opinion piece on this article in the LA Times and Max Tani’s work in Semafor.

It’s the Happiest Place on Earth, Until You’re Stuck There-Welcome to Shanghai Disney

As China continues to cling to its zero-COVID policy, tourists at Shanghai Disney Resort now find themselves trapped in the park until they can test negative for COVID-19 amid yet another snap lockdown. South China Morning Post explains “…new variants have tested local officials’ ability to snuff out flare-ups faster than they can spread, causing much of the country to live under an ever-changing mosaic of Covid curbs.” The city announced Monday that it was going into lockdown and that visitors to the park would not be allowed to leave “until on-site testing returns a negative result.” SCMP writes, “It added that those who had visited the park since Thursday must obtain three negative Covid tests over three successive days and “avoid participating in group activities.’ The announcement came after Disney said it was “temporarily closing with immediate effect … in accordance with disease control requirements”.”

Turns Out the PRC Is Not the Only Place with Biosafety Issues

The d iscovery of vials labeled “smallpox” in a Merck & Co. facility near Philadelphia last year, last month’s controversy over Boston University’s NEIDL’s COVID-19 work using chimeric viruses, that time the Department of Defense accidentally mailed live anthrax spores to a US base in South Korea…the US is no stranger to biosafety issues and scares. This is the subject of a three part series of The Intercept, “Experimenting with Disaster,” focused on undisclosed biosafety incidents in the US. The first part focuses on a university lab accident, the second on work with the 1918 flu pandemic’s H1N1 virus, and the third on risky work with avian influenza. The Schar School’s Dr. Gregory Koblentz is quoted throughout the series as he provides context to the political and oversight issues surrounding these and other incidents.

Russia Fails (Again) to Garner International Sympathy for Bogus BW Claims

On Wednesday, the UN Security Council (UNSC) squashed Russia’s attempt to create a formal inquiry into its claims that the US and Ukraine are running a biological weapons program in Ukraine. Of the five permanent UNSC members, only China voted in support of Russia’s draft resolution on the measure. The US, UK, and France all voted against it while the other 10 UNSC members abstained from voting. According to the UN “Through the draft resolution, the 15-member Council would have decided to set up a commission to investigate the complaint of the Russian Federation in the context of the activities of biological laboratories in the territory of Ukraine, as well as present to the 15-member organ a report on the issue containing recommendations by 30 November 2022 and inform the States parties to the Convention at its Ninth Review Conference to be held in Geneva on 28 November–16 December 2022 of the results of the investigation.”

“The draft would also have the Council request the Secretary-General and the Biological Weapons Convention Implementation Support Unit provide, within their respective mandates, all necessary assistance to the commission.”

Cholera Outbreaks on the rise Globally

In case more COVID-19 variants, monkeypox, polio, and Ebola weren’t enough for you this year, the New York Times reports that a “…record number of [cholera] outbreaks have been reported after droughts, floods and wars have forced large numbers of people to live in unsanitary conditions.” So far, outbreaks have been reported in the Caribbean, Africa, the Middle East, and South Asia. NYT also explains “Cholera is typically fatal in about 3 percent of cases, but the World Health Organization says it is killing at an accelerated rate in recent outbreaks, even though it is relatively cheap and easy to treat. It is most often fatal in children, who progress swiftly to severe illness and organ failure.”

However, as case counts grow, vaccine supplies are coming up short. The WHO has already suspended its two-dose recommendation in favor of a single dose regimen that can help stretch supplies. “We have never had to make a decision like this about vaccination before, that’s the severity of this crisis,” Dr. Philippe Barboza, head of the WHO’s cholera team, said.

NYT explains part of why this is an issue, writing “The bulk of the world’s cholera vaccine is made by a South Korean company called EuBiologics. Some 15 percent of the global stockpile was produced by Shantha Biotechnics, a wholly owned Indian subsidiary of the French drugmaker Sanofi, but the company decided two years ago to stop production of its cholera vaccine by the end of this year and end supply by the end of 2023. That planned exit from the market coincides with the spike in demand…Dr. Barboza said that EuBiologics was producing at capacity and working to expand its production, and that another drugmaker would soon begin to produce the vaccine.”

“A Multinational Delphi Consensus to End the COVID-19 Public Health Threat”

Lazarus et al.’s new Nature article discusses findings of a Delphi study focused on the COVID-19 pandemic response: “Despite notable scientific and medical advances, broader political, socioeconomic and behavioural factors continue to undercut the response to the COVID-19 pandemic^1,2. Here we convened, as part of this Delphi study, a diverse, multidisciplinary panel of 386 academic, health, non-governmental organization, government and other experts in COVID-19 response from 112 countries and territories to recommend specific actions to end this persistent global threat to public health. The panel developed a set of 41 consensus statements and 57 recommendations to governments, health systems, industry and other key stakeholders across six domains: communication; health systems; vaccination; prevention; treatment and care; and inequities. In the wake of nearly three years of fragmented global and national responses, it is instructive to note that three of the highest-ranked recommendations call for the adoption of whole-of-society and whole-of-government approaches¹, while maintaining proven prevention measures using a vaccines-plus approach² that employs a range of public health and financial support measures to complement vaccination. Other recommendations with at least 99% combined agreement advise governments and other stakeholders to improve communication, rebuild public trust and engage communities³ in the management of pandemic responses. The findings of the study, which have been further endorsed by 184 organizations globally, include points of unanimous agreement, as well as six recommendations with >5% disagreement, that provide health and social policy actions to address inadequacies in the pandemic response and help to bring this public health threat to an end.”

“Lessons Learned from the COVID-19 Outbreak”

New from the RAND Corporation, a volume on COVID-19 that includes chapters on the need to prioritize biosafety and biosecurity, and GOF research: “The coronavirus disease 2019 pandemic that began in late 2019 and continues as of the writing of this Perspective in summer 2022 has been the cause of both tremendous tragedy—in lives lost and economic hardship—and great triumph in the rapid development of effective vaccines. Many nations around the world have scrambled to respond to a once-in-a-century event that has exposed many weaknesses in response planning and capabilities, including those of the United States. Even as the pandemic continues, it is not too early to reflect on the missteps that have been made and lessons that can be learned so that the United States and nations worldwide can be better prepared for the future.”

“This volume contains a collection of essays that explores topics of critical importance toward that aim and identifies actions that can be taken to not only improve pandemic preparedness but also help prevent the occurrence of future pandemics. The essays center on U.S. challenges and experiences, but the solutions, in many cases, require collaborative efforts that reach across national boundaries.”

“The Global Inequality in COVID-19 Vaccination Coverage Among Health and Care Workers”

Nabaggala et al. discuss COVID-19 vaccinations in HCWs in their new article in the International Journal for Equity in Health. Using WHO data, they found that “Despite being considered a priority group, more than a third of countries did not achieve 70% vaccination coverage of their HCWs at the end of 2021. Large inequities were observed with low income countries lagging behind. Additional efforts should be dedicated to ensure full protection of HCWs through vaccination.”

“Bolstering Arms Control in a Contested Geopolitical Environment”

Michael Moodie and Jerry Zhang’s recent issue brief published by the Stimson Center: “For decades, arms control has constituted one of the cornerstone frameworks for global governance and served as a critical tool for bolstering international security and stability. The global arms control regime is now under unprecedented pressure, due to heightened competition between major powers, rapidly deteriorating security environment, and emerging technologies. Nevertheless, cooperation on arms control is important in today’s contested geopolitical environment as it can encourage responsible competition broadly between great powers, avoid the proliferation of advanced weaponry, and reduce the risk of unintended military escalation. This paper recommends three measures to reinvigorate arms control: sustaining long-term engagement between major powers; adopting a multi-stakeholder approach by including smaller states and non-government entities in the process; and reconceptualizing the fundamentals of arms control.”

“Addressing the Global Shortage of Biosafety and Biosecurity Professionals through Education”

The International Federation of Biosafety Associations recently published this white paper discussing their efforts to build undergraduate degree programs designed to create competent biosafety professionals. They write: “Biosafety and biosecurity professionals provide an essential role in safeguarding infectious disease agents in clinical and research laboratories and other settings where biological materials are handled. The COVID-19 pandemic has brought into focus the significant demand on the profession and many countries face an overall shortage of these specialized individuals. Given that biosafety and biosecurity professionals work in laboratories behind the scenes of the frontline response, the profession remains largely unknown to students interested in pursuing a career in the sciences. As such, students tend to be steered towards more visible education paths in the biological and health sciences.”

“To address this gap, the IFBA is leading a multisectoral effort towards a future sustainable workforce by formalizing a biosafety & biosecurity career path within the higher education system. Now is the right time since the recent lived COVID-19 experiences of youth have motivated them to become involved. Over the past 6 months, and with funding support from Global Affairs Canada, the IFBA has been collaborating with Kenya’s Masinde Muliro University of Science and Technology (MMUST) to develop and pilot a new undergraduate BSc degree program specifically in Biosafety and Biosecurity. This new BSc program leverages MMUST’s existing programs in the Department of Medical Laboratory Sciences. All students undertake related core courses in microbiology and related disciplines in the first two years followed by specialized biosafety & biosecurity courses, practical laboratory and field experience and a capstone project in their later academic years.”

“The lessons learned from this pilot program will be used for future program roll out to additional universities across Africa and globally. This project presents a recommended solution towards a sustainable future global workforce of biosafety and biosecurity professionals. Supporting this approach are multisectoral partnerships committed to biosafety and biosecurity education and our common vision of more graduates and young scientists entering the profession.”

“A Plea for Making Virus Research Safer”

Dr. Jesse Bloom’s guest essay in the New York Times offers an overview of notable pathogen research, efforts over the years to make it more secure, and current concerns. In it she writes “The French statesman Georges Clemenceau said, “War is too important to be left to the generals.” When it comes to regulating high-risk research on potential pandemic viruses, we similarly need a transparent and independent approach that involves virologists and the broader public that both funds and is affected by their work.”

“How to Detect a Man-Made Biothreat”

This Wired piece discusses US government funding to develop test that would detect engineered pathogens: “To guard against these potential threats, the US government is funding the development of tests to detect dangerous bioengineered organisms before they have a chance to cause significant harm. The effort was announced in 2017 by the Intelligence Advanced Research Projects Activity, or Iarpa, within the Office of the Director of National Intelligence. In a livestreamed update in October, Iarpa program manager David Markowitz announced that two platforms developed under the program were both 70 percent accurate at identifying the presence of bioengineering. “We simply never know what sample is going to come through the door in a government lab, and we need to be prepared for anything,” Markowitz said during the news briefing.”

“Why Climate Change Matters for Pandemic Preparedness”

Check out this Nature Outlook piece with computational ecologist Xavier Rodó on climate change’s role in pandemic planning: “Numerous studies over more than two decades have demonstrated a robust relationship between climate and the dynamics of human diseases, such as cholera, malaria and dengue. Changes in climate, including both long-term warming trends and short-term climate variability, might affect patterns of disease. Xavier Rodó, a computational ecologist and climate dynamics specialist at the Barcelona Institute for Global Health and the Catalan Institution for Research and Advanced Studies in Spain, spoke to Nature about how climate modelling could be used to help prepare for future disease outbreaks — and the obstacles he has faced in implementing such systems.”

“Chemical Security Experts Call for Multisector Cooperation Against Terrorism”

From INTERPOL: “The devastating impact of chemical weapons and explosives used in acts of terrorism continues to affect civilian populations and is well known for its destructive and long-term harm.”

“Last year over 1,000 improvised explosive device (IED) attacks were conducted by non-state actors, injuring over 7,150 people in more than 40 countries. Many attacks come from chemicals that criminals acquired through weak points in the supply chain – from manufacturing to storage and retail– and made into weapons.”

“To counter this threat, some 220 chemical security practitioners from more than 70 countries met at INTERPOL’s 3rd Global Congress on Chemical Security and Emerging Threats (25-27 October) to find ways of reducing vulnerabilities by enhancing multisector cooperation and collaboration.” Read more here.

What We’re Listening To 🎧

THE RETORT: EPISODE 4 Gain of Function Experiments

The latest episode of Dr. Brett Edwards’ podcast, The Retort, offers “A straightforward introduction to the past decade of discussion of international oversight of gain of function pandemic research,” with Dr. Nariyoshi Shinomiya of Japan’s National Defense Medical College. This episode and previous ones are available on Dr. Edwards’ YouTube channel. His other podcast project, Poisons and Pestilence, also recently reached 7,000 listens. In celebration, he is hosting a t-shirt give away, so be sure to check that out here.

Happy Monday! My biological and chemical warfare podcast has now reached 7,000 listens. In celebration I will randomly select one person who retweets this to receive a nerdy T-shirt. https://t.co/lkJNRAEa3q
— Dr. Brett Edwards (@bwiedwards) October 31, 2022

Conversations Before Midnight

The Bulletin of the Atomic Scientists is hosting its Bulletin Annual Gathering on November 9, 2022, at 5 pm CDT virtually. This is the Bulletin’s “signature event” and it aims to allow guests to engage in high-level conversations with influential voices tracking man-made threats. At the event, “Each virtual table has an expert, established and up-and-coming specialists in the fields of nuclear risk, climate change, disruptive technologies, and biosecurity. These discussion leaders include members of the Bulletin’s Science and Security Board, Board of Sponsors, and invited experts from around the world. Below are a few samples for this year’s gathering.”‘ Table experts include our own Dr. Greg Koblentz, so be sure to check out this event’s info page here.

Briefings in Preparation for the Ninth BWC Review Conference

From UNIDR: “The 1972 Biological Weapons Convention (BWC) is a cornerstone in the regime to prevent the hostile use of biology. The Ninth BWC Review Conference will take place in late November 2022 and presents an important opportunity to take stock of the past and chart a course for the future of this increasingly important agreement. In support of preparations for the Ninth BWC Review Conference and beyond, UNIDIR has recently published several reports intended to stimulate thinking on substantive issues related to the BWC.”

“This virtual event will bring together the authors of the latest UNIDIR publications on BWC topics to provide short outlines of the key insights and ideas in their respective reports for State Parties to consider ahead of the Review Conference. These include verification, advances in science and technology, international cooperation, and potential outcomes of the Review Conference. The presentations will be followed by a moderated interactive discussion with the participants.” This event will take place on November 7 at 2 pm CET, online. Learn more and register here.

Infection Prevention and Control: Incorporating Lessons Learned in Managing Special Pathogens

“After nearly three years responding to the COVID-19 pandemic, hospitals and other healthcare facilities have learned many lessons about the management of special pathogens and essential infection prevention and control practices. The U.S. Department of Health and Human Services (HHS) Administration for Strategic Preparedness and Response’s Technical Resources, Assistance Center, and Information Exchange (ASPR TRACIE) and the National Emerging Special Pathogens Training and Education Center (NETEC) invite you to learn more about some of those lessons. Speakers will share their perspectives on how our approach to outbreaks has changed since the pandemic began. They will address issues such as infection prevention for healthcare workers and patients and mitigating disease spread. Speakers will also highlight newly developed tools and resources. This webinar will take place November 7 at 2:00 pm ET. Register today!”

WHO/AFRO Fellowship Programme on Public Health Emergencies in Africa

“The World Health Organization Regional Office for Africa (WHO AFRO) invites interested and eligible candidates to submit applications for a fellowship programme on improving the management of public health emergencies in Africa under the COVID-19 Incident Management Support Team (IMST).” Learn more and apply here.

Pandora Report: 10.28.2022

October 28, 2022 by dkellogg97, posted in Pandora Report

Happy Halloween! This week we haves lots of scares for you, including even more misuse of international organizations to further disinformation narratives! This week, we focus on Russia’s request for a UNSC investigation of its bogus BW claims and complaint lodged in accordance with Article VI of the BWC, the Senate Health, Education, Labor and Pensions minority report on SARS-CoV-2 origins, and ongoing debates about the SARS-CoV-2 experiments conducted at Boston University. We also cover new publications, upcoming events, and new announcements ahead of One Health Day.

Russia Criticized Heavily After Calling for UNSC Resolution on “Secret Biolabs in Ukraine”

In yet another massive waste of everyone’s time, Russia has continued to press its false claims that the US runs “secret military biological programs” in Ukraine with the UN Security Council, this time drafting a resolution that would establish a commission (comprised of all 15 UNSC members) to investigate the claims. This comes amid a new wave of “transparently false allegations” on the part of Moscow, most recently regarding alleged Ukrainian plans to use a dirty bomb in its own territory. In response to this latest effort at the Security Council, the UK’s Ambassador to the UN, Dame Barbara Woodward, asked the question on everyone’s mind-“How much more of this nonsense do we have to endure?”

This newest attempt includes an official complaint to the UNSC, filed in accordance with article VI of the BWC, in addition to the request for the formation of a formal commission to investigate the October 24 complaint. The complaints continue to center on efforts between the US and Ukraine, largely under the Cooperative Threat Reduction program, to support public health research and diagnostic facilities, though Russia insists these facilities are not for peaceful purposes.

In a Thursday briefing before the Security Council, the UN Office for Disarmament Affairs (UNODA) reiterated again that it is not aware of any biological weapons programs in Ukraine, echoing its previous statements on the matter made in March and May. In response, Russia’s Ambassador Vassily Nebenzia said, “Do you really think that we’re that naïve?…Do you really think that we think that the Pentagon is going to inform the high representative of the Office of Disarmament Affairs within the UN about their secret biological programs in Ukraine?”

US Ambassador to the UN, Linda Thomas-Greenfield, summarized the absurdity of Russia’s claims, explaining “We hear Russia raise alarms that biological weapons will be delivered by birds and bats and now even mosquitoes. Birds and bats. Russia knows public health laboratories routinely study migratory animal species to assess and counter animal-borne pathogens. Bear in mind, much like Russia, birds and bats don’t tend to observe or respect sovereign borders. Russia’s assertions are absurd for many reasons, including because such species, even if they could be weaponized, would pose as much a threat to the European continent and to Ukraine itself as they would to any other country.”

Thomas-Greenfield also described the meeting as a “…colossal waste of time… an attempt to distract from the atrocities Russian forces are carrying out in Ukraine and a desperate tactic to justify an unjustifiable war.” She later added, “It doesn’t matter how many meetings Russia tries to call on this subject. And it doesn’t matter how hard it ratchets up its propaganda machine. We must not divert UN resources toward a baseless investigation. And we must not allow Russia’s tactics to distract us from its brutal war of aggression.”

Senate HELP Committee Minority Interim Report Released on SARS-CoV-2 Origins

This week, the Senate Health, Education, Labor and Pensions (HELP) Committee Minority oversight staff released their interim report-“An Analysis of the Origins of the COVID-19 Pandemic”. The report makes a number of claims, including “While it remains possible that SARS-CoV-2 emerged as a result of a natural zoonotic spillover, facts and evidence found in previous documented zoonotic spillover events have not, to date, been identified in relation to this pandemic,” “Substantial evidence suggests that the COVID-19 pandemic was the result of a research-related incident associated with a laboratory in Wuhan, China,” and “This investigation’s interim report concludes that SARS-CoV-2 and the resulting COVID-19 global pandemic was, more likely than not, the result of a research-related incident associated with coronavirus research in Wuhan, China.”

The 35-page report does not completely rule out a market origin and, importantly, it does not claim that SARS-CoV-2 was engineered as a bioweapon-a popular conspiracy theory. One interesting element it does focus on is that Chinese scientists began testing their COVID-19 vaccines in humans about a month before the United States did. The report implies this means the Chinese had some sort of advanced (pre-January 11, 2020) access to genomic sequencing, though it does still ask “What additional steps, processes, or novel techniques did AMMS [PLA Academy of Military Medical Sciences] researchers take that advanced the development of their vaccine faster than the Operation Warp Speed timeline?” The report states, “While mRNA vaccine candidates were able to design their vaccine construct in two days, because mRNA vaccines only need the coronavirus’ genetic sequence to make a vaccine and no virus has to be cultivated in labs, traditional vaccine platforms take longer.” It continues, highlighting that the first Operation Warp Speed (OWS) vaccine candidates to enter human clinical trials were non-mRNA vaccines-AstraZeneca-Oxford’s offering and Johnson & Johnson’s, both viral vector vaccines.

It then contrasts the 8 months it took for OWS viral vector candidates to human clinical trials with the 67 days it took one AMMS team to do the same, writing “Given Operation Warp Speed’s success, it is unusual that the two AMMS COVID-19 vaccine development teams were able to reach early milestones in vaccine development even more quickly. The Chen AMMS team beat AstraZeneca-Oxford to phase I clinical trials by 38 days. The Zhou AMMS team built and validated the effectiveness of its COVID-19 candidate vaccine 44 days after the sequence of SARS-CoV-2 was released. The extremely accelerated vaccines development timelines achieved by the AMMS teams pose the following two outstanding questions:”

“What additional steps, processes, or novel techniques did AMMS researchers take that advanced the development of their vaccine faster than the Operation Warp Speed timeline?”
“If no additional steps were taken to speed up the development timeline, when did researchers in China have access to the genomic sequence? Was it before January 11, 2020? If so, how far in advance of January 11, 2020?”

This argument does not address differences in the regulatory environments of the US and PRC. Rather, it seems to imply that this is evidence the Chinese had advance knowledge of this outbreak with no discussion of drug and therapeutic approval reforms in recent years that aim to improve the country’s ability to compete in pharmaceutical manufacturing globally and incentivizes development of vaccines and drugs for rare diseases. The CCP has identified competition in global biopharmaceutical manufacturing as a top priority, so the implication that the faster timeline to clinical trials supports the lab leak theory is unsatisfactory as presented.

It also does not appear to have even won over prominent supporters of the lab leak theory, including Dr. Richard Ebright, a molecular biologist at Rutgers University. The New York Times explains, “Dr. Ebright, who was interviewed by the report’s authors, said he supported the argument that evidence pointed to a laboratory origin. But the only new element, he said, appeared to be questions raised about how China could have developed a vaccine so quickly, which he did not find persuasive. Otherwise, he said, “there was no information in the report that has not been publicly presented in the media and discussed in the media previously.”

“This image depicted a test tube with viral transport media that contained a patient’s sample to be tested for the presence of SARS-CoV-2, the virus that causes COVID-19.” Source: CDC PHIL

Naturally, this interim report has been heavily criticized. The conclusion reached in this report obviously differs from the two peer-reviewed Science articles published earlier this year that found 1) the Huanan Seafood Wholesale Market was the epicenter of the initial outbreak and 2) that there were at least two distinct spillovers from animals sold at the market. Scientists supporting the market origin still have not identified which animals were infected or where they came from, as no animals were tested before the market was shut down early in 2020. Of this, the report states “Critical corroborating evidence of a natural zoonotic spillover is missing. While the absence of evidence is not itself evidence, the lack of corroborating evidence of a zoonotic spillover or spillovers, three years into the pandemic, is highly problematic.”

Dr. Michael Worobey, Department Head of Ecology and Evolutionary Biology at the University of Arizona and a co-author of both the Science articles, addressed the report with Science news, with the news team writing “Michael Worobey, an evolutionary biologist at the University of Arizona who has co-authored scientific reports examining data from the early days of the pandemic that provide some of the strongest support for a jump from animals to humans, speculates that the timing of the report’s release could be “a cynical effort to try to win Republican votes” in the upcoming midterm congressional and state elections. Or, Worobey says, “it could just be a bunch of staffers with no ability to understand the science who stumbled across a bunch of misinformation and disinformation-filled tweets.” (“Senator Burr felt enough compelling, open-source information had been gathered during staff’s comprehensive review of the facts that an interim report was appropriate,” a senior aide to the minority staff told Science.)”

After the minority interim report was released, Senator Patty Murray, Chair of the Senate HELP Committee, issued a statement on “continuing bipartisan oversight efforts into the origins of the virus that causes COVID-19” that did not address the minority report. Sen. Murray stated “COVID-19 has caused so much pain, hardship, and loss for people in Washington state, across our country, and all across the globe. As I’ve said time and again, it is absolutely critical we learn the lessons from this pandemic so that we never find ourselves in a similar situation again—and that, of course, includes undertaking a full examination of how COVID-19 first emerged.”

“That’s why I made it a top priority as Chair to craft bipartisan legislation to strengthen our public health and pandemic preparedness systems with the PREVENT Pandemics Act—which, among so many other vital steps, would establish an independent task force to conduct a comprehensive review of COVID’s origins and the federal response to the pandemic. And it’s why, in 2021, I announced a bipartisan oversight effort with Senator Burr into the origins of this virus. The HELP Committee is continuing bipartisan work on this oversight report, and I remain committed to passing the PREVENT Pandemics Act, which advanced out of Committee with overwhelming bipartisan support.”

More on the Boston University Controversy

While the controversy surrounding experiments conducted on SARS-CoV-2 at Boston University has subsided some, attention has shifted to how such research is regulated. The New York Times explains the concerns, writing “But the uproar highlighted shortcomings in how the U.S. government regulates research on pathogens that pose a risk, however small, of setting off a pandemic. It revealed loopholes that allow experiments to go unnoticed, a lack of transparency about how the risk of experiments is judged and a seemingly haphazard pattern in the federal government’s oversight policy, known as the P3CO framework.” It also notes “Even as the government publicly reprimanded Boston University, it raised no red flags publicly about several other experiments it funded in which researchers manipulated coronaviruses in similar ways. One of them was carried out by the government’s own scientists.”

“Colorized scanning electron micrograph of a cell infected with a variant strain of SARS-CoV-2 virus particles (green), isolated from a patient sample.” Source: NIH Image Library

Nature explains the issue further, writing “At issue is whether — and when — researchers modifying SARS-CoV-2 or other deadly pathogens need to keep regulators and funding agencies such as the US National Institutes of Health (NIH) informed about their work, even if the agencies didn’t fund the experiments in question. Studies that make pathogens more transmissible or virulent are sometimes called ‘gain of function’ research.”

The issue now being discussed is if federal guidance is too vague in explaining what disclosures are required after a proposal is approved and research is progressing. Dr. Greg Koblentz told The New York Times “The government should be providing the guidance to help people figure this out,” and explained to Grid that “Pandemic prevention and lab safety rules “only move in fits and starts,” said biodefense professor Gregory Koblentz of George Mason University, pointing to the long list of past controversies. “And we only make progress where there is some crisis, or perceived crisis, that grabs people’s attention.”

Koblentz also commented on the confusion surrounding “gain of function”, telling Grid “‘Gain of function’ — we should retire that term, it really doesn’t help us in that debate,” said Koblentz. “It has become shorthand for a class of research that people are worried about because of the risks it poses, but it is a term that really has outlived its usefulness.” The term garnered attention during a number of political debates, including back-and-forths between Senator Rand Paul and Dr. Anthony Fauci.

Grid also noted that, though many experts disagree on the utility of the term “gain of function, “There’s one point all of the experts who spoke to Grid agreed on — the Boston University chimera experiments do point to a need for stronger federal government oversight of potentially dangerous bugs. The fact that we are still debating whether to review genetically altering known pandemic pathogens, not even potential ones, said Koblentz, “is an indictment of both the self-governance model that the virology community largely supports and the current policy.”

NCT Magazine

In this issue focused on 4th generation chemical weapons, several experts offer their perspective on existing and emerging issues. Drs. Stefano Costanzi and Gregory Koblentz authored a piece for this issue, “Controlling Novichok Nerve Agents After the Skripal and Navalny Incidents”. They cover the history of this family of nerve agents and international disarmament and nonproliferation attempts before discussing the Skripal and Navalny incidents as evidence that both the Chemical Weapons Convention and Australia Group Chemical Weapons Precursors list need to be revised to better address Novichok agents. They conclude “The ability of the CWC and AG to adapt to the new challenge posed by these fourth-generation nerve agents demonstrates the resilience of the chemical weapon nonproliferation regime. However, further measures need to be implemented to reduce the opportunities for proliferators to develop and use Novichok nerve agents. Embracing a family-based approach to listing chemicals of proliferation concern would strengthen the nonproliferation regime and the adoption of technologies such as cheminformatics can facilitate the transition to this new approach to containing the threat posed by chemical weapons.”

“Designation of Three Syrian Military Officials Due to Involvement in Gross Violations of Human Rights”

On the topic of chemical weapons, the US State Department recently designated multiple military officials from the Syrian regime, it declared in a press release this week. The statement reads in part, “Of the atrocities committed by the Assad regime, some of which rise to the level of war crimes and crimes against humanity, few are as inhumane and abhorrent as the repeated use of chemical weapons against civilians. In August 2013, the Syrian Artillery and Missile Directorate of the Syrian Armed Forces launched rockets carrying the nerve agent sarin, a deadly chemical, on Ghouta, a suburb of Damascus, killing at least 1,400 people, many of them children. Today, we are taking additional action to promote accountability.”

“The Department of State is designating three Syrian regime military officials involved in these airstrikes, pursuant to Section 7031(c) of the Department of State, Foreign Operations, and Related Programs Appropriations Act, 2022. Brigadier General Adnan Aboud Hilweh, Major General Ghassan Ahmed Ghannam, and Major General Jawdat Saleebi Mawas were involved in gross violations of human rights, namely the flagrant denial of the right to life of at least 1,400 people in Ghouta. As a result of today’s action, Hilweh, Ghannam, and Mawas as well as their immediate family members are ineligible for entry into the United States.”

“To Fix American’s Biodefense Strategy, Think Smaller”

From Breaking Defense: “It’s a natural reflex for the US government to try to develop strategies to deal with issues as broadly as possible, to handle a wide array of contingencies. But in the op-ed below, Al Mauroni of Air University’s Center for Strategic Deterrent Studies argues that the Biden administration’s biodefense strategy, expanding on past strategies, has grown too cumbersome and is in need of a cure of its own.”

ASPR TRACIE on Major Radiological or Nuclear Incidents

ASPR’s Healthcare Emergency Preparedness Information Gateway (TRACIE) recently released this updated document providing an “overview of health and medical response and recovery needs following a radiological or nuclear incident…” It also outlines resources for planners. Other relevant resources can also be found on the TRACIE CBRN page.

“Preventing and Preparing for Pandemics with Zoonotic Origins”

This piece from the Council on Foreign Relations discusses how factors that drive pathogen emergence and spread should influence decisions on investments in pandemic preparedness and response. It discusses priority pathogens, primary pandemic prevention, and secondary pandemic prevention and pandemic preparedness, concluding that “There is unprecedented support at the highest levels of government to enhance global pandemic prevention and preparedness. The recent decision to create a new fund for pandemics out of the World Bank and the ongoing negotiation for a pandemic agreement within the World Health Organization are potentially transformational. It is critical that comprehensive action be taken quickly through these efforts before the world’s collective attention moves on to the next crisis. Failure to do so means future generations will live less healthy and productive lives than we have today.”

“COVID-19 Genomic UK (COG-UK) Consortium: Final Report”

In this article from RAND Health Quarterly, Marjanovic et al. write in their abstract “The ability to sequence and understand different variants of the SARS-CoV-2 virus and their impact is crucial to inform policy and public health decisions. Soon after the UK went into its first lockdown in March 2020, the CCOVID-19 Genomics UK (COG-UK) Consortium was launched. COG-UK is a collaboration of experts in pathogen genomics including academic institutions, public health agencies, the Wellcome Sanger Institute, NHS Trusts and Lighthouse Labs. RAND Europe evaluated how COG-UK delivered against its objectives, for example how it contributed to advancing scientific knowledge about SARS-CoV-2, informing public health decisions, and providing information that can be used to evaluate the effectiveness of vaccines and treatments. The evaluation also examined the diverse factors that influenced COG-UK progress and impact, including enablers and challenges, and considered implications for the future.”

Coronavirus Vaccines R&D Roadmap

From CIDRAP: “CIDRAP, with support from the Bill & Melinda Gates Foundation and The Rockefeller Foundation, has led an international collaborative effort to develop a coronavirus vaccines research and development (R&D) roadmap (CVR). The CVR aims to serve a strategic planning tool to facilitate R&D, coordinate funding, and promote stakeholder engagement aimed at generating broadly protective coronavirus vaccines.”

“A key component of roadmap development is gathering feedback via a public comment period. The draft CVR is now available for a 4-week public comment period from October 24 – November 18, 2022. Feedback gathered during the public comment period will be used to refine the roadmap, resulting in a final roadmap made available in early 2023.”

“The draft CVR may be downloaded in PDF format. Comments should be submitted via this survey, which will be available through November 18, 2022. The survey offers the opportunity to share general and specific comments on the roadmap; the team welcomes as little or much feedback as you would like to provide.”

“The Future of Infodemic Surveillance as Public Health Surveillance”

In this recent piece from a supplement issue of Emerging Infectious Diseases, Chiou et al. write “Public health systems need to be able to detect and respond to infodemics (outbreaks of misinformation, disinformation, information overload, or information voids). Drawing from our experience at the US Centers for Disease Control and Prevention, the COVID-19 State of Vaccine Confidence Insight Reporting System has been created as one of the first public health infodemic surveillance systems. Key functions of infodemic surveillance systems include monitoring the information environment by person, place, and time; identifying infodemic events with digital analytics; conducting offline community-based assessments; and generating timely routine reports. Although specific considerations of several system attributes of infodemic surveillance system must be considered, infodemic surveillance systems share several similarities with traditional public health surveillance systems. Because both information and pathogens are spread more readily in an increasingly hyperconnected world, sustainable and routine systems must be created to ensure that timely interventions can be deployed for both epidemic and infodemic response.”

COVID Taking the Fun Out of Fungi?

The WHO recently released its first fungal priority pathogens list (FPPL)- “the first global effort to systematically prioritize fungal pathogens, considering their unmet research and development (R&D) needs and perceived public health importance.” The WHO explains that “The WHO FPPL aims to focus and drive further research and policy interventions to strengthen the global response to fungal infections and antifungal resistance. The WHO FPPL list is divided into three categories: critical, high and medium priority. The report presents these categories and proposes actions and strategies for policymakers, public health professionals and other stakeholders; targeted at improving the overall response to these priority fungal pathogens including preventing the development of antimicrobial resistance. Three primary areas for action are proposed, focusing on: (1) strengthening laboratory capacity and surveillance; (2) sustainable investments in research, development, and innovation; and (3) public health interventions.”

This comes amid a spike in certain fungal diseases during the COVID-19 pandemic. Additionally, the report found that “Currently, fungal infections receive less than 1.5% of all infectious disease research funding,” and that “most treatment guidelines are informed by limited evidence and expert opinion.”

Opinion: “To Fight Misinformation, We Need to Teach That Science Is Dynamic”

In this piece for Scientific American, Dr. Carl Bergstrom, Daniel Pimentel, and Dr. Jonathan Osborne discuss public ignorance of the scientific community, identifying ways this can be rectified. They write, “It’s easy to see why so many of us struggle to distinguish trustworthy science from what is flawed, speculative or fundamentally wrong. When we don’t learn the nature of consensus, how science tends to be self-correcting and how community as well as individual incentives bring to light discrepancies in theory and data, we are vulnerable to false beliefs and antiscience propaganda. Indeed, misinformation is now a pervasive threat to national and international security and well-being.”

They discuss the need to develop a population of competent outsiders, explaining “Giving people more facts is insufficient. Instead, we need a populace that can tell which sources of information are likely to be reliable, even if the science itself is beyond what they learned in school, so that they can identify when they need scientific information to make decisions in their own lives. Just as critically, people must understand enough about how science attempts to minimize error. In other words, every member of our society needs to be what science education researcher Noah Feinstein calls a “competent outsider.”

What We’re Listening To 🎧

This Week in Virology 948: Breathless with David Quammen

“David Quammen returns to TWiV to discuss how he wrote his new book ‘Breathless’, a story about the science and the scientists behind the race to understand the pandemic coronavirus SARS-CoV-2.” Listen here.

Conversations Before Midnight

Briefings in Preparation for the Ninth BWC Review Conference

Infection Prevention and Control: Incorporating Lessons Learned in Managing Special Pathogens

From One Health Commission-World Bank Open Call

“Open Call for Experts to serve on the Technical Advisory Panel to the Governing Board of the Pandemic Prevention, Preparedness and Response Financial Intermediary Fund (“PPR FIF”)”- November 3 Deadline

“World Bank has posted a call for experts to serve on the Technical Advisory Panel (TAP) to the Governing Board of the Pandemic Prevention, Preparedness and Response Financial Intermediary Fund (“PPR FIF”).”

“The TAP will comprise a multidisciplinary pool of up to 20 experts, bringing a diverse range of independent technical and financial expertise relevant to PPR FIF-supported projects and activities. To register your interest in being considered for the PPR FIF TAP, please submit documents to ppr_fif_secretariat@worldbank.org using the subject line “Expression of interest for the PPR FIF TAP”

Speaking of One Health…November 3 is One Health Day

Mark your calendars for this year’s One Health Day on November 3. One Health Day is an international campaign that was launched in 2016. The One Health Commission explains that “The goal of One Health Day is to bring attention around the world to the need for One Health interactions and for the world to ‘see them in action’. The One Health Day campaign is designed to engage as many individuals as possible from as many arenas as possible in One Health education and awareness events, and to generate an inspiring array of projects worldwide.” If you are hosting an event on this day, you can register your event here with the Commission. A list of registered One Health Day events for 2022 is also available here.

Share this:

Share this:

Share this:

Share this:

Share this:

Share this:

Share this:

Share this:

Share this:

Share this: