This week covers the FDA’s ongoing investigation into contaminated applesauce, the passing of Gao Yaojie-an activist responsible for bringing to light the extent of China’s AIDS epidemic-, and more.
Biodefense MS Graduates Riley Flynn and Sophie Hirshfield at GMU’s 2023 Winter Commencement Ceremony
FDA Leadership Says Tainted Applesauce Pouches May Have Been Intentionally Contaminated
Cinnamon applesauce pouches available Weis, WanaBanana, and Schnucks have been pulled from shelves after they were found to be contaminated with lead. Dozens of children in the United States have been sickened by the tainted products. Now, the FDA’s Deputy Commissioner for Human Foods, Jim Jones, says they may have been intentionally contaminated.
In an interview with Politico, Jones said “We’re still in the midst of our investigation. But so far all of the signals we’re getting lead to an intentional act on the part of someone in the supply chain and we’re trying to sort of figure that out.” All of the pouches in question were linked to a manufacturing facility in Ecuador that the FDA is currently inspecting.
‘“My instinct is they didn’t think this product was going to end up in a country with a robust regulatory process,” Jones said. “They thought it was going to end up in places that did not have the ability to detect something like this.”’
Politico further explained that “The FDA continues to investigate a number of theories for how the pouches became contaminated, and has not drawn any conclusions about the way the lead was added, why or by whom. The FDA says it currently believes the adulteration is “economically motivated.” That generally refers to ingredients being altered in order to make products appear higher in value, often so companies can produce a cheaper item and sell it at an elevated price.”
“The agency and the Centers for Disease Control and Prevention have collaborated with state and local health authorities as well as Ecuadorian authorities to trace the origin of the cinnamon in the applesauce pouches, which is believed to be the source of the lead contamination. More than 60 U.S. children under the age of 6 have tested positive for lead poisoning after consuming the pouches — some at levels more than 500 times the acceptable threshold for lead, according to The Washington Post.”
Gao Yaojie, Chinese Physician and Self-Exiled AIDS Activist, Dead at 95
Gao Yaojie, a gynecologist and well-known AIDS activist, died on December 10 in New York City. Gao, formerly based in China’s Henan province, was famous for her work to expose the outbreak of HIV/AIDS in the country in the 1990s and 2000s. The outbreak was large in scale and primarily driven by the country’s Plasma Economy, which arose because of restrictions on foreign imports of blood products in the 1990s. This resulted in blood plasma donation becoming a way for rural populations to make money in government-supported plasma donation centers. However, unsafe practices like repeated use of unsterilized needles and pooling multiple donors’ blood during the plasmapheresis allowed HIV to spread widely.
Because of the Chinese government’s efforts to suppress reporting on this epidemic, poor rural populations were left largely unaware of the dangers of plasma donation and the public in general was unaware of the severity of the crisis. Gao was one of the first to speak publicly about the outbreak, helping draw the attention of media outlets. She later told documentary filmmakers about her motivations for doing this, saying, “My driving thought is: how can I save more people from dying of this disease? We each only live one life.”
It is estimated that at least one million Chinese were infected with HIV during this epidemic, highlighting the importance of Gao’s and others’ bravery. For this, she garnered praise from the United Nations, several Western organizations, and even Hillary Clinton. This rising fame led to her being placed under house arrest in 2007, with about 50 police preventing her from traveling to the United States to accept an award recognizing her work. In response to this, she told NPR “I think they feel I got in the way of their political achievements and their official careers…Otherwise, why would they put me under house arrest? What law did I break to warrant mobilizing all these police?”
NPR further explained her activities later in life in their article on her passing, writing: “Despite pressure from Henan provincial authorities to stop publicizing the AIDS crisis, she continued her work, using all the proceeds from her books and pamphlets to support AIDS families, especially children orphaned by the disease or the many suicides that it caused.”
“Restrictions on her movement began hindering in work in China, however, and in 2009, she abruptly fled to the US, after fearing she would be put under house arrest again. Many admirers continued to visit her apartment in West Harlem, including a group of young Chinese students who kept her company in the loneliness of exile.”
‘”Many Chinese regarded her as a hero, and when they came to New York, if they didn’t know how to contact her , [sic] they would ask me. I would ask them for an email written in Chinese and would forward it to her. So far as I know, she always wrote back to those people and welcomed them to come visit,” remembers Andrew Nathan, a political science professor at Columbia University who handled much of Gao’s affairs in New York.”
“The Biological and Toxin Weapons Convention in 2023: Glimmers of Progress Set Against a Troubled Geopolitical Landscape”
Experts at CSR’s Nolan Center, including Biodefense PhD Program alumna and current faculty member Saskia Popescu, recently authored this blog post focused on the BWC’s potential for success in verification, universalization and effective implementation in Africa, and the creation of an International Agency for Biological Safety. They explain in their introduction: “For nearly two decades, efforts to strengthen the Biological and Toxin Weapons Convention (BWC) were in stasis, with opportunities missed and States Parties unable to agree to definite action. States Parties arrived at the Review Conference last year facing a growing biological weapons threat—augmented by rapidly converging complimentary technologies—coupled with a status quo in the BWC that was insufficient for the task. Yet nations drove a breakthrough: the consensus achieved at last year’s Review Conference proved that action is still possible despite the challenging international security environment.”
“In a world in which biological threats and vulnerabilities are exceedingly complex, there is a critical need to reinforce relationships among global experts, national governments, and civil society. Over the past two weeks, these stakeholders have met to identify, examine, and develop specific and effective measures to strengthen the Convention. An unwavering theme throughout the Meeting of States Parties underscored that preparedness and resilience are investments, rather than costs, reinforcing the deterrence by denial efforts CSR continues to promote. Although the challenging international security environment continues to hinder progress there are glimmers of genuine progress across several fronts…”
“Biosecurity in the Americas: Regional Threat Assessment”
A new from UMD’s START, co-authored by Biodefense MS Program alumna Alexandra Williams: “This publication, currently available in Spanish, provides a breadth and depth of focuses as a high-level assessment of the Central and South America regions and introduction to key topics as:
The needed expansion of understanding of the differences and areas of collaboration between the concepts of biosafety and biosecurity,
Existing international obligations to biosecurity through the BWC and UNSC Resolution 1540,
How biosecurity applies to and may differ in application across a variety of facility types that engage in biological research or production, whether private or public laboratories, agricultural or university-based facilities,
Biosecurity risks that include proliferation, bioterrorism, agroterrorism, and biocrime,
The five pillars and mechanisms of biosecurity,
Lastly, the application of biosecurity in the Central and South American regions.”
“NTI|Bio Convenes Workshop on Disincentivizing State Bioweapons Development and Use”
From NTI: “A week ahead of the Biological Weapons Convention (BWC) Working Group meetings in Geneva, Switzerland, NTI | bio convened a workshop on “Disincentivizing State Bioweapons Development and Use.” This two-day workshop on November 29 and 30 brought together academics, diplomats, biosecurity experts, and government policy makers to begin developing a cross-disciplinary thought and practice community to explore and develop potential disincentivizing solutions. Current thinking and policy on disincentivizing bioweapons acquisition and use is underdeveloped—especially by comparison with the nuclear security field.”
‘“We launched this effort because we see the need for more rigorous thinking on effective approaches to making bioweapons unattractive to nation-states,” said NTI | bio Vice President Jaime Yassif. “NTI’s goal is to bridge theory and practical policy-relevant approaches to develop new ideas that can invigorate international efforts to reduce biological threats.”’
Biodefense Graduate Program Director Gregory Koblentz and Associate Professor Sonia Ben Ouagrham-Gormley both participated in this workshop. Read more about it here.
“Great Powers and the Norms of the BW Prohibition Regime”
A new working paper from CBWNet: “The United States of America and the Soviet Union were instrumental in creating the biological weapons prohibition regime more than 50 years ago. This has left the regime with a big gap in its normative structure related to the verification of treaty compliance. The working paper by Alexander Kelle and Eva Siegmann analyses great power involvement in several areas of regime implementation and concludes that none of the great powers, including China, has supported the addition of declaration and inspection norms. While recent US and Chinese initiatives could still lead to a strengthening of the regime in different areas, Russian policies, most notably false accusations against the US and others, threaten to undermine the regime.”
“AI and Biorisk: An Explainer”
A new explainer from Georgetown’s CSET: “Recent government directives, international conferences, and media headlines reflect growing concern that artificial intelligence could exacerbate biological threats. When it comes to biorisk, AI tools are cited as enablers that lower information barriers, enhance novel biothreat design, or otherwise increase a malicious actor’s capabilities. In this explainer, CSET Biorisk Research Fellow Steph Batalis summarizes the state of the biorisk landscape with and without AI.”
“Bio X AI: Policy Recommendations For A New Frontier”
Jeffrey et al. discuss the work of the Federation of American Scientists’ Bio x AI Policy Development Sprint in this piece, explaining in their introduction: “Artificial intelligence (AI) is likely to yield tremendous advances in our basic understanding of biological systems, as well as significant benefits for health, agriculture, and the broader bioeconomy. However, AI tools, if misused or developed irresponsibly, can also pose risks to biosecurity. The landscape of biosecurity risks related to AI is complex and rapidly changing, and understanding the range of issues requires diverse perspectives and expertise. To better understand and address these challenges, FAS initiated the Bio x AI Policy Development Sprint to solicit creative recommendations from subject matter experts in the life sciences, biosecurity, and governance of emerging technologies. Through a competitive selection process, FAS identified six promising ideas and, over the course of seven weeks, worked closely with the authors to develop them into the recommendations included here. These recommendations cover a diverse range of topics to match the diversity of challenges that AI poses in the life sciences. We believe that these will help inform policy development on these topics, including the work of the National Security Commission on Emerging Biotechnologies.”
“Push to Improve Biosecurity in the Age of Genetic Engineering”
Wilmot James recently authored this opinion piece for Business Day, explaining in part “The possibility of using AI to develop bioweapons raises additional concerns, and remains uncharted territory. While the intersection of AI and biotechnology holds immense potential for positive applications in healthcare, research and diagnostics, it also poses risks if misused. AI algorithms could be employed to analyse vast genetic data sets and identify specific sequences for manipulation. This could accelerate the process of genetic engineering, allowing for the creation of more efficient and potentially harmful pathogens…To safeguard against such threats, multilateral and public-private sector agreements and regulations to govern the ethical use of AI in science, emphasising the prohibition of bioweapon development, should be established, with strong oversight committees responsible for assessing the ethical implications at the intersection of AI and biotechnology. These committees should include experts in AI, virology, bioethics and global health security.”
“Sounding the Alarm on Anti-Science”
Margaret Winchester provides background and overview of Peter Hotez’s latest book-The Deadly Rise of Anti-Science-in this piece for Health Affairs: “In his book, The Deadly Rise of Anti-Science, Hotez, professor and dean of the National School of Tropical Medicine at Baylor College of Medicine, and co-director of the Center for Vaccine Development at Texas Children’s Hospital, paints a bleak picture of public science denial during the pandemic, embedded in historic context. He tells the story of systematic anti-science efforts from his view in the trenches—and as a personal target for anti-science activists. This book, and his commentary in our December issue of Health Affairs on global lessons from COVID-19, highlight the very real effects of this movement, including lives lost, undermined public health efforts, foregone vaccinations, social schisms, and more, that will be felt for generations to come. As he writes, “anti-science now kills more Americans than global terrorism, or other deadly societal forces and social determinants.” Drawing from multiple sources, he estimates that approximately 200,000 people needlessly died in the US after COVID-19 vaccines became widely available.”
EU vs Disinfo Disinformation Review
The most recent edition of EU vs Disinfo’s Disinformation Review is now available and features multiple sections focused on Russia’s continued use of alleged US biological weapons laboratories as a bogeyman. Be sure to check it out for fantastic lines such as “If the only tool that you have is a hammer, everything looks like a biolab,” and “At a staged event, Putin mumbled out an announcement to veterans and the wider public that his regime would continue to rule over Russia after an orchestrated ritual not to be confused with an event known as an ‘election’ in the free world.”
2023 State of the Bioeconomy
From BIOISAC: “We have a lot to celebrate as we close 2023 and just over 12 months since the Executive Order calling for a safe, secure bioeconomy. Join us as we recap the activity, publications, outcomes, and – we will of course share a glimpse of the “behind the scenes” conversations from our 3 regional events and our one-day “Closing the Knowledge Gaps” event, our two-day table top training and the resulting “Going Viral: Bioeconomy Defense TTX” report, and, of course, the industry-demanded outputs from our hardware/software device security workgroup report and supplements, “Fortifying the Bioeconomy” as well as the Bioeconomy Security Questionnaire and Instrument Disposal Guide. We also have a lot left to do! We plan to share a few of our goals for 2024 and our upcoming regional events schedule.”
“Join us December 19th at 2pm Eastern-US for a live discussion.” Register here.
Presidential Advisory Council on Combating Antibiotic-Resistant Bacteria (PACCARB) Virtual Meeting
“The Presidential Advisory Council on Combating Antibiotic-Resistant Bacteria (PACCARB) provides advice, information, and recommendations to the U.S. Secretary of Health and Human Services (HHS Secretary). The council supports and evaluates U.S. government activities focused on fighting antimicrobial resistance (AMR) in human health, animal health, and environmental health. Using this One Health approach, members of the PACCARB have expertise from a range of backgrounds, including academia, industry, public health, advocacy, veterinary, and agricultural production.”
“As a federal advisory committee, the PACCARB looks to engage with the public and all AMR stakeholders. The council holds several public meetings every year both in-person and live streamed on the HHS.gov website. These meetings are open to anyone with an interest in combating AMR. See how to get involved!”
This virtual meeting will take place on December 20 from 9-4 EST. Learn more here.
61st ISODARCO Course: Nuclear Order and International Security after Ukraine
“The war in Ukraine has had an enormous impact on global security, reviving nuclear fears, undermining the prospects for arms control, and shattering many of the norms and constraints that were the foundation of European security. ISODARCO 2024 will examine the global nuclear order in light of the Ukraine war, focusing on the states, the policies and the technologies that will shape the future in a much more difficult environment. How will we cope with this more dangerous world?”
This course will take place January 7-14, 2024, at the University of Trento. Learn more and register here.
International Conference, CBRNE Research & Innovation
“The last 40 years have demonstrated that both military and civilian populations could be exposed to highly hazardous CBRNE agents following conflicts, natural outbreaks and disasters, industrial incidents or terrorist attacks.”
“Worldwide, researchers, responders and industrial capacities have been commited to provide adapted response to these challenges.”
“Building on the success of the first 5 International Conferences « CBRNE Research and Innovation » which took place in Antibes (2015), Lyon (2017), Nantes (2019), on line (2021) and Lille (2022), we want to give you a new opportunity to build up or strengthen collaborative networks in Strabourg (March 19th – 21rst 2024).”
“The CBRNE R&I Conference is specifically devoted to scientific updates, responders’ feedbacks and expression of needs. It also includes workshops and demonstrations of innovative materials, technologies and procedures, according to the following themes: DETECTION – IDENTIFICATION, PROTECTION – DECONTAMINATION, MEDICAL COUNTERMEASURES, RISKS & CRISIS MANAGEMENT.”
“Looking forward to your proposals for communication and to welcoming you at Strasbourg in March 2024!”
Registration is now open for the Global Health Security 2024 conference in Sydney, Australia. This iteration will take place 18-21 June, 2024. The call for abstracts is also still open. “The mission of the Global Health Security conference is to provide a forum where leaders, researchers, policy-makers, and representatives from government, international organisations, civil society, and private industry from around the world can engage with each other, review the latest research and policy innovations, and agree solutions for making the world safer and healthier. To that end, our mission is to help foster a genuinely multidisciplinary community of practice that is committed to working collaboratively to enhance global health security and eliminate disease, irrespective of its origin or source.”
WHO Announces Proposed Members of Technical Advisory Group on Response Use of the Life Sciences and Dual-Use Research
The WHO recently announced its proposed membership of its Technical Advisory Group on Responsible use of the life sciences and dual-use research (TAG-RULS DUR). According to WHO, “As per WHO processes, there will be now a two-week public consultation period for WHO to receive feedback on the proposed TAG-RULS DUR members and set in place the modalities for the TAG-RULS DUR’s first meeting, which is planned to take place following this consultation period…The final membership to the TAG-RULS DUR is subject to the above-mentioned public consultation period and relevant WHO practices and procedures.”
The proposed membership and instructions for providing commentary on the individuals included are both available here.
Vote: 2023 Arms Control Person(s) of the Year Nominees
“Since 2007, the independent, nongovernmental Arms Control Association has nominated individuals and institutions that have, in the previous 12 months, advanced effective arms control, nonproliferation, and disarmament solutions and raised awareness of the threats posed by mass casualty weapons.”
“In a field that is often focused on grave threats and negative developments, the Arms Control Person(s) of the Year contest aims to highlight several positive initiatives—some at the grassroots level, some on the international scale—designed to advance disarmament, nuclear security, and international peace, security, and justice.”
“Voting will take place between Dec. 8, 2023, and Jan. 11, 2024. The results will be announced on Jan. 12, 2024. Follow the discussion on social media using the hashtag #ACPOY2023.”
This week includes coverage of updates to Japan’s End User List, the Taliban’s newly declared war on polio, Biomemory’s $1k DNA storage cards, new publications, upcoming events, and more.
Japan Revises End User List, Includes 101 Chinese Organizations and Institutions
Japan’s Ministry of Economy, Trade, and Industry has revised the country’s End User List, which provides “…exporters with information on foreign entities for which concern cannot be eliminated regarding involvement in activities such as the development of weapons of mass destruction (WMDs) and other items, for the purpose of enhancing the effectiveness of the catch-all control on cargos and other loads relating to WMDs and other items.”
The updated list, which takes effect on Monday, now includes 706 organizations in 15 countries and regions, according to Nikkei. This is an increase of 36 over last year’s list and, notably, it includes the China Academy of Engineering Physics (CAEP)-the main center for Chinese research on and manufacturing of nuclear weapons. Seven total Chinese entities were added to the list, about 90% of which are thought to be involved in missile development. Nikkei notes that “Many universities, academies and research institutes are also listed, which reveals the extent of Xi Jinping’s Military-Civilian Fusion policy. Machine tools produced by Japanese companies and others are suspected of being used by the CAEP, according to a Nikkei investigation.”
223 Iranian organizations and institutions are on the list, in addition to 153 North Korean ones, and 101 each from China and Pakistan. Nikkei further explains that “Japan aims to prevent the outflow of civilian technology that could be diverted to military use. Exporters are required to get approval from the Minister of Economy, Trade and Industry to export products to the listed organizations unless it is clear that the materials will not be used to develop WMDs such as nuclear weapons or missiles.”
“The economy ministry makes the list to enhance the effectiveness of its “catch-all” control system, which obliges exporters to apply for an export license for goods that may be used for the development of WMDs even if the goods are not subject to export restrictions under international agreements. The list has been issued since catch-all controls were introduced in April 2002 and is revised about once a year. It is not an embargo list.”
Taliban Announces Polio Eradication Campaign
Naturally acquired polio remains endemic in just two countries today- Afghanistan and Pakistan- in part because, as Radio Azadi explains, “Islamic militants often target polio-vaccination teams, falsely claiming the vaccination campaigns are a Western conspiracy to sterilize children.” During its 20-year struggle to regain power, the Taliban often banned door-to-door vaccination efforts. In 2021, nationwide door-to-door polio vaccinations were allowed to resume after the Taliban and the United Nations/World Health Organization reached an agreement.
Now, as explained by a recent article in The Washington Post, the Taliban is “declaring war” on polio in an apparent complete reversal of its previous stance. The article explains “Vaccinators in the country’s northeast, the center of the poliovirus outbreak, search cars for unvaccinated children at roadside checkpoints manned by Taliban soldiers. With no deadly attacks on public health campaigners reported in Afghanistan this year, they also feel increasingly comfortable venturing into remote virus hot spots that were previously far beyond their reach.”
The country’s health ministry announced the continuation of its annual polio vaccination campaign in March of this year, marking the second year the program has continued to operate under the Taliban’s rule. The ministry indicated it aimed to reach approximately 9 million children with the campaign, as Afghanistan and neighboring Pakistan continue to struggle with endemic polio due in large part to accessibility difficulties, displacement, regional instability, and concerns about external interference. Pakistan suspended its anti-polio drive in multiple districts this year after police escorting vaccination teams were repeatedly attacked.
French Start-Up Announces Sales of DNA Storage Cards,BIO-ISAC Joins DNA Data Storage Alliance Amid Growing Interest, Concerns
Multiple news outlets have covered the French start-up Biomemory‘s release of $1,000 pairs of DNA cards that promise a “minimum” 150-year lifespan of data storage. The Verge’s Emma Roth explains “DNA has emerged as a theoretical alternative to hard drives, SSDs, and other forms of digital data storage, namely because of its impressive lifespan. Science estimates the technology could potentially last hundreds of thousands of years if stored in a cool, dry environment. That’s a heck of a lot longer than the lifespan of your average hard drive, which typically tops out at around five years.”
However, Biomemory’s cards currently offer just one kilobyte of storage, or about one email according to Wired. The data stored on the card is retrieved by mailing the cards to Eurofins Genomics, who then return the stored information using strings of DNA’s nucleotide bases-adenine (A), cytosine (C), guanine (G) and thymine (T). Users can then use Biomemory’s DNA translation feature to decode the stored information. The card is not returned afterward. The company expects to begin shipping orders from its waitlist in January.
‘”The launch of our DNA Cards represents a significant milestone in the evolution of data storage technology,” Erfane Arwani, CEO of Biomemory, said about the pioneering development. “After years of talk about the potential of molecular computing, we are incredibly proud to bring the first DNA data storage product to market, that not only pushes the boundaries of innovation but also aligns with our commitment to environmental sustainability and efficiency.”‘
This news has coincided with the announcement that the Bioeconomy Information Sharing and Analysis Center, an international organization that aims to address threats unique to the bioeconomy, has joined the DNA Data Storage Alliance. The organization explained in a statement: “This year BIO-ISAC created the Genomic Data Workgroup, informing the National Cybersecurity Center of Excellence at National Institute of Standards and Technology efforts to launch the Cybersecurity Framework Profile for Genomic Data and the forthcoming text on the Privacy Framework Profile for Genomic Data. Prioritizing workgroup efforts to apply and implement this work, BIO-ISAC pursued membership and presentation opportunities with aligned organizations and audiences.”
“Founded in 2020, the DNA Data Storage Alliance was built to create and promote an interoperable storage ecosystem based on DNA as a data storage medium. The organization seeks to educate the public and raise awareness about this emerging technology and its vast power to preserve our digital legacy. As the methods of commercially viable DNA storage become better understood, the Alliance will consider recommending the creation of specifications and standards (e.g., encoding, reliability, retention, file systems) which enable end-users to add interoperable DNA-based storage solutions to their existing storage hierarchies.”
On a more fun note, Biomemory’s homepage does include a DNA Translate feature at the bottom which shows users how lines of text may be converted to strings of As, Cs, Gs, and Ts, so we tested it out: AGAGAGACAGTCTCACAGTCAGAGACTCACACAGAGACACAGTCACAGAGTCTGTCAGTCAGACAGTCTGTGAGTGACTCAGTCACAGACTCACACAGAGACTCAGTCAGAGAGTGACACAGTCTGTGAGTGACTCAGTGAGACACTCACACAGTCTCAGAGTGACTGACTCACACAGTGAGACAGTCTCACAGTCAGAGACTCACACAGTCACTCAGTCAGAGAGTGACTGAGTGAGACACTCACACAGTCTGTCAGTCAGAGAGTGCCGAAGTGACTGAGTCTGACAGTCAGAGAGTGAGACAGTGAGACAGTCAGAGAGTGACTCCCGAACAG
The page lacks a feature allowing users to translate their string of nucleotide bases back to regular text, so take our word for it: The Pandora Report is the best newsletter!
WHO Weekly Epidemiological Record One Health-Focused Issue
“The Weekly Epidemiological Record (WER) serves as an essential instrument for the rapid and accurate dissemination of epidemiological information on cases and outbreaks of diseases under the International Health Regulations and on other communicable diseases of public health importance, including emerging or re-emerging infections.”
“Henry Kissinger Supported Wars and Coups. He Also Played a Little-Known Role in Eliminating Bioweapons”
Matt Field recently authored this piece about the late Henry Kissinger in The Bulletin of the Atomic Scientists, writing in part: “By the late 1960s, incidents with chemical weapons—including an accident with VX nerve agent in Utah that killed some 6,000 sheep—had focused Congress’s attention on the US chemical and biological warfare operation. Internationally, there were efforts to begin arms control negotiations around these weapons of mass destruction. And Kissinger led internal government deliberations over what to do with the US program. At one point, according to Tucker and Mahan, Kissinger, unhappy with a policy paper that contained both arguments in favor and against retaining biological weapons, produced his own paper that cut the points in favor of the offensive program. He included his personal recommendation to restrict the US program to biological defense, which involves the development of countermeasures such as vaccines.”
“Insights from BARDA Industry Day 2023”
Tanima Sinha, Director of Life Science Product Development and Government Contracts at the Biomedical Advanced Research and Development Authority (BARDA), recently authored this post covering BARDA Industry Day 2023 and upcoming insights from the conference that will be made available. She explains in part, “Here we will take a quick glimpse at ASPR (Administration for Strategic Preparedness and Response) and BARDA’s programs to enhance the nation’s biomedical industrial base and supply chain capacity. The COVID-19 pandemic brought to light the inadequate availability of essential medical needs. In response to these deficiencies, the USG/ HHS (Health and Human Services) (Health and Human Services) is expanding the public health industrial base through innovative solutions.”
Fortifying the Bioeconomy
From BIO-ISAC: “Standardizing tools for assessing, remediating, and disposing of hardware and software instruments has been a recurring problem in our sector, reducing our ability to operate in a safe, secure way. Earlier this year, BIO-ISAC took action to address this need.” “Fortifying the Bioeconomy, an in-depth resource about shared responsibility in hardware and software lifecycle management, is now available. This resource includes additional materials including a standardized vendor questionnaire and an instrument disposal guide.”
“We hope these materials guide industry and offer us a safe, secure path forward for our nation’s labs, biomanufacturers, growers, and innovators.”
“Country Reports on Terrorism 2022 is submitted in compliance with Title 22 of the United States Code, Section 2656f (the “Act”), which requires the Department of State to provide to Congress a full and complete annual report on terrorism for those countries and groups meeting the criteria of the Act.”
This report includes “Chapter 3 — The Global Challenge of Chemical, Biological, Radiological, or Nuclear Terrorism,” explaining the status of CBRN materials and expertise as terrorist threats and the United States’ efforts to counter them in 2022.
“New Information Tool on Nuclear Weapons Seeks to Identify the Next Arms Control Strategies”
Andrew Facini recently authored this piece for The Bulletin of the Atomic Scientists discussing the Council on Strategic Risks’ recently-launched Nuclear Weapons System Project. He explains, “For those of us seeking to cultivate nuclear policies geared toward enhancing strategic stability, the current trend reflects a worrying loss of perspective—a forgetting of the hard-earned lessons of the Cold War. To help put today’s trends in their historical context, a team of the Council on Strategic Risks (CSR) developed a new visualization tool and information system that maps every type of nuclear weapon fielded by the five nuclear weapons states (P5) under the Nuclear Non-Proliferation Treaty (NPT)—China, France, Russia, the United Kingdom, and the United States—from their inception to present day.”
What We’re Listening To 🎧
Technologically Speaking Podcast Ep. 6, Science is Messy
New from the Department of Homeland Security: “Host John Verrico sits down with Dr. Nick Bergman, director of S&T’s National Biodefense Analysis and Countermeasures Center (NBACC). Dr. Bergman is a bit of a germaphobe, but it’s hard not to be when you run a Biosecurity Level 4 lab that studies pathogens for which no vaccine or treatment exists. Hear an insider’s perspective of the COVID pandemic, find out how NBACC regularly helps the FBI, and meet a guy living a “pretty typical life” of helping save us all from superbugs.”
New from the Dutch Ministry of Health, Welfare and Sport: “This film provides an introduction into eight pillars of good practice for biosecurity, that are important when implementing biosecurity control measures.”
“These control measures are necessary to protect high-risk biological materials against theft or misuse by malicious parties.”
“The biosecurity aspects in these eight pillars of good practice are explained, which can help you to implement biosecurity within your organisation. This film is focussed on organisations that work with high risk biological materials.”
Mitigating Arboviral Threats and Strengthening Public Health Preparedness
“Arboviruses are a broad group of viruses that are spread by arthropods, such as ticks and mosquitoes. Diseases caused by arboviruses, like dengue, chikungunya, Zika, and yellow fever, present a significant public health burden and threaten billions of people worldwide. Despite the global recognition of the devastating health and economic impacts of these diseases, the need persists for improved integration of mitigation efforts into public health systems and environmental and urban planning.”
“The National Academies Forum on Microbial Threats will conduct a two-day workshop that will identify lessons learned from previous outbreaks, outline current arbovirus surveillance capacities, and describe novel approaches to arbovirus mitigation. The workshop will include perspectives from researchers, public health practitioners, and environmental management experts from across the globe.”
This event will take place on December 12 and 13. Learn more here.
Presidential Advisory Council on Combating Antibiotic-Resistant Bacteria (PACCARB) Virtual Meeting
“The Presidential Advisory Council on Combating Antibiotic-Resistant Bacteria (PACCARB) provides advice, information, and recommendations to the U.S. Secretary of Health and Human Services (HHS Secretary). The council supports and evaluates U.S. government activities focused on fighting antimicrobial resistance (AMR) in human health, animal health, and environmental health. Using this One Health approach, members of the PACCARB have expertise from a range of backgrounds, including academia, industry, public health, advocacy, veterinary, and agricultural production.”
“As a federal advisory committee, the PACCARB looks to engage with the public and all AMR stakeholders. The council holds several public meetings every year both in-person and live streamed on the HHS.gov website. These meetings are open to anyone with an interest in combating AMR. See how to get involved!”
This virtual meeting will take place on December 20 from 9-4 EST. Learn more here.
61st ISODARCO Course: Nuclear Order and International Security after Ukraine
“The war in Ukraine has had an enormous impact on global security, reviving nuclear fears, undermining the prospects for arms control, and shattering many of the norms and constraints that were the foundation of European security. ISODARCO 2024 will examine the global nuclear order in light of the Ukraine war, focusing on the states, the policies and the technologies that will shape the future in a much more difficult environment. How will we cope with this more dangerous world?”
This course will take place January 7-14, 2024, at the University of Trento. Learn more and register here.
International Conference, CBRNE Research & Innovation
“The last 40 years have demonstrated that both military and civilian populations could be exposed to highly hazardous CBRNE agents following conflicts, natural outbreaks and disasters, industrial incidents or terrorist attacks.”
“Worldwide, researchers, responders and industrial capacities have been commited to provide adapted response to these challenges.”
“Building on the success of the first 5 International Conferences « CBRNE Research and Innovation » which took place in Antibes (2015), Lyon (2017), Nantes (2019), on line (2021) and Lille (2022), we want to give you a new opportunity to build up or strengthen collaborative networks in Strabourg (March 19th – 21rst 2024).”
“The CBRNE R&I Conference is specifically devoted to scientific updates, responders’ feedbacks and expression of needs. It also includes workshops and demonstrations of innovative materials, technologies and procedures, according to the following themes: DETECTION – IDENTIFICATION, PROTECTION – DECONTAMINATION, MEDICAL COUNTERMEASURES, RISKS & CRISIS MANAGEMENT.”
“Looking forward to your proposals for communication and to welcoming you at Strasbourg in March 2024!”
Registration is now open for the Global Health Security 2024 conference in Sydney, Australia. This iteration will take place 18-21 June, 2024. The call for abstracts is also still open. “The mission of the Global Health Security conference is to provide a forum where leaders, researchers, policy-makers, and representatives from government, international organisations, civil society, and private industry from around the world can engage with each other, review the latest research and policy innovations, and agree solutions for making the world safer and healthier. To that end, our mission is to help foster a genuinely multidisciplinary community of practice that is committed to working collaboratively to enhance global health security and eliminate disease, irrespective of its origin or source.”
“Biodefense Budget Breakdown: Data Visualization of U.S. Biodefense Investments”
New from Council on Strategic Risks: “In recent years, U.S. strategies and policies have advanced greatly in addressing biological risks from all sources. We at CSR have marked several areas of progress through writings and analysis: the beginning of a pivot toward pathogen-agnostic approaches, requiring annual exercises on biological risks, and the creation of the Biodefense Council within the Department of Defense, and more…In September, CSR launched a scorecardprocess to track signs of implementation of stronger U.S. biodefense and biosecurity policies. CSR’s Biodefense Budget Breakdown will accompany the scorecard, tracking trends in resources and investments.”
“Before the launch of this tool, no publicly-accessible resource provided a detailed analysis of the total budget across the federal biodefense enterprise. By creating the Biodefense Budget Breakdown, we hope to provide a robust and user-friendly resource for the government, key stakeholders, and the general public.”
“This tool is intended to provide focused analyses of the biodefense budget, with multiple interfaces to understand and analyze the federal biodefense portfolio. This tool starts with the cumulative U.S. biodefense totals for each fiscal year dating back to 2019, progresses to agency-specific drill-downs, and culminates with a detailed line item index for biodefense budgets across key agencies. This tool reports biodefense investments across three steps in the budget cycle: requested (R), enacted (E), and actual (A) levels of funding.”
Call for Applications: Ecological Security Fellowship
“The Council on Strategic Risks is pleased to announce a call for applications for its Ecological Security Fellowship, a key part of its broader Ecological Security Program.”
“Tackling complex, converging risks arising from ecological degradation requires the development of resilient leaders spanning international, national, state, and local levels. This program will familiarize participants with novel ways of conceptualizing the security risks posed by ecological disruption driven by human activities, climate change, and other stressors. Participants will acquire expertise and build professional development through networking with experts and practitioners in different areas of ecological security.”
This week covers a wide range of topics, including chemical weapons, indictments for those involved in running the illegal laboratory in Reedley, CA, and more. Several new publications follow, as well new upcoming events and newly-available resources in the announcement section.
George Mason University’s Biomedical Laboratory Receives $12 Million in Funding from NIH
From GMU: “Farhang Alem, Interim Director of the Biomedical Research Laboratory, Institute for Biohealth Innovation, and Aarthi Narayanan, Professor, Biology, will receive more than $12 million from the National Institute for Health to support development of Mason’s Biomedical Research Laboratory, advancing the university’s research capabilities for infectious diseases.”
“George Mason University’s Biomedical Laboratory (BRL) is one of 12 Regional Biocontainment Laboratories (RBLs) established through the National Institute of Allergy and Infectious Diseases. The BRL offers Biosafety Level 3 (BSL-3) facilities that conduct cutting edge pathogen research and serve as resources to rapidly address emerging infectious disease outbreaks.”
“Funding will support a number of facility improvements including the implementation of a comprehensive BSL-3 facilities preventative maintenance and upgrade plan to ensure continuity of operations, compliance with federal regulations, and a safe and secure facility. Funding will also enhance safety and quality of BSL-3 laboratory practices and create two new research cores in high containment.”
DOD Chemical and Biological Defense Program Celebrates 30th Anniversary
The Department of Defense recently reached the 30-year anniversary of the formation of its Chemical and Biological Defense Program. “Congress created the DOD wide chemical and biological defense program in November 1993, after a government report noted U.S. forces were not sufficiently prepared to address Iraq’s chemical and biological warfare capabilities…Prior to the creation of the program under the Office of the Secretary of Defense, the military services were each responsible for developing their own chemical and biological defense capabilities.”
“The Conference decided that the continued possession and use of chemical weapons by the Syrian Arab Republic, and its failures to submit an accurate and complete declaration and to destroy all its undeclared chemical weapons and production facilities, have caused serious damage to the object and purpose of the Chemical Weapons Convention.”
“In adopting the decision, States Parties condemned “in the strongest possible terms the use of chemical weapons by anyone, under any circumstances, emphasising that any use of chemical weapons anywhere, at any time, by anyone, and under any circumstances is unacceptable and contravenes international norms and standards”. States Parties reaffirmed their determination to continue to take action to address threats related to chemical weapons in Syria and elsewhere.”
“Today’s decision seeks to implement for the first time Paragraph 3 of Article XII of the Convention, which refers to measures States Parties can take in order to ensure compliance.”
Syrian Network for Human Rights Statement On the Day of Remembrance For All Victims of Chemical Warfare
The Syrian Network for Human Rights released its statement yesterday on the Day of Remembrance for all Victims of Chemical Warfare, highlighting CW attacks perpetrated by the Assad regime and the ongoing struggle for victims to hold the regime accountable. The statement is available below.
OPCW Director-General Amb. Fernando Arias and the Mayor of the Municipality of The Hague, Mr. Jan van Zanen, announced last week the three recipients of the 2023 OPCW-The Hague Award. These recipients are the Spiez Laboratory in Switzerland, Dr. Syeda Sultana Razia at the Bangladesh University of Engineering and Technology, and Mr. Hubert K. Foy at the African Centre for Science and International Security in Ghana.
‘“All three of these recipients have demonstrated that everyone has a role to play in ridding the world of chemical weapons and preventing their re-emergence,” said OPCW Director-General, Ambassador Fernando Arias. “We must together strive to continue to ensure that toxic chemicals are never used as instruments of harm and that our populations are protected.”’
Read more about the recipients and their work here.
NTI, NextGen, iGEM, SynBio Africa, GHSN, and 80,000 Hours Announce Winners of 7th Annual Next Generation for Biosecurity Competition
The winners of the Seventh Annual Next Generation for Biosecurity Competition were recently announced. They are Gupreet Dhaliwal, Ph.D. candidate in Synthetic Biology and Immunology at the University of Cambridge, Askar Kleefeldt, Ph.D. candidate in Synthetic Biology at the MRC Laboratory of Molecular Biology and the University of Cambridge, and Alexandra Klein, Ph.D. candidate in Science, Technology, Engineering and Public Policy at the University College London and research assistant at the Centre for the Study of Existential Risk, University of Cambridge.
“In their winning paper, Biosecurity-By-Design to Safeguard Emerging Bioeconomies: Integrating Biosecurity Considerations into the Full Biotechnology Innovation and Development Pipeline, the team proposes a ‘biosecurity-by-design’ approach to ensure that biosecurity is integrated into every stage of the life science research and development pipeline, especially project conceptualization. The three authors outline a set of recommendations to achieve this goal, including fostering a culture of responsibility among scientific communities through the adoption of the Tianjin Biosecurity Guidelines for Codes of Conduct for Scientists as a global standard in emerging bioeconomies. The authors emphasize the importance of engaging with the private sector and encourage governments to incentivize biosecurity in product design by using levers such as market access regulations or reputational rewards through seals of approval. The authors also propose that States Parties at the Biological Weapons Convention adopt a systematic review mechanism for science and technology to raise awareness of emerging biotechnology risks. Overall, these recommendations aim to make biosecurity an integral part of biotechnology innovation while allowing the bioeconomy to flourish.”
No Cost COVID-19 Tests Available in United States Again
The US Government is once more offering four at-home viral tests delivered via the US Postal Service. Those who did not order any in September can order up to eight of them during this round. Order tests at COVIDtests.gov.
ICYMI: Select Committee on the CCP Releases Report on Reedley Lab, DOJ Announces Indictment of Operator
Last month “Chairman Mike Gallagher (R-WI) of the House Select Committee on the Chinese Communist Party unveiled a report on its investigation into the illegal People’s Republic of China-tied biolab discovered in Reedley, CA. The members were joined by Rep. Jim Costa (D-CA), whose district includes Reedley, CA, Former Speaker Kevin McCarthy (R-CA), Rep. Dan Newhouse (R-WA), and Rep. Neal Dunn (R-FL).”
According to the report, the Committee’s main findings were:
“The illegal biolab was run by a PRC citizen who is a wanted fugitive from Canada with a $330 million Canadian dollar judgment against him for stealing American intellectual property.
This PRC citizen was a top official at a PRC-state-controlled company and had links to military-civil fusion entities.
The illegal biolab received millions of dollars in unexplained payments from PRC banks while running the illegal biolab.
The illegal biolab contained thousands of samples of labeled, unlabeled, and encoded potential pathogens, including HIV, malaria, tuberculosis, and Covid.
The illegal biolab also contained a freezer labeled “Ebola,” which contained unlabeled, sealed silver bags consistent with how the lab stored high risk biological materials. Ebola is a Select Agent with a lethality rate between 25-90%.
The biolab contained nearly a thousand transgenic mice, genetically engineered to mimic the human immune system. Lab workers said that the mice were designed “to catch and carry the COVID-19 virus.”
After local officials who discovered the lab sought help from the CDC and others, the CDC refused to test any of the samples.”
Meanwhile, the Department of Justice announced a three-count indictment against operators of the lab, saying in a press statement “A federal grand jury returned a three-count indictment today against Jia Bei Zhu, aka Jesse Zhu, Qiang He, and David He, 62, a citizen of China who formerly resided in Clovis, charging him with distributing adulterated and misbranded medical devices in violation of the federal Food, Drug, and Cosmetic Act and for making false statements to the Food and Drug Administration (FDA), U.S. Attorney Phillip A. Talbert announced.”
“According to court documents, between January 2020 and March 2023, through the companies Universal Meditech Incorporated (UMI) and Prestige Biotech Incorporated (PBI), Zhu sold hundreds of thousands of COVID-19 test kits to companies throughout the United States. UMI and PBI were based in Fresno and Reedley and did not obtain pre-market approval, pre-market clearance, emergency use authorization, or other applicable exemption from the FDA as was required. UMI and PBI received millions of dollars for the sales of the test kits.”
“When questioned by FDA officials, Zhu made several false statements to them, including that (1) his name was Qiang “David” He, (2) he was hired by UMI as a COVID-19 consultant in 2021, (3) he was hired by PBI just a couple of weeks prior to meeting with the FDA to communicate with government agencies on PBI’s behalf, and (4) he did not know anything about the manufacturing or distribution histories for UMI or PBI.”
“This case is the product of an investigation by the FDA Office of Criminal Investigations with assistance from the Federal Bureau of Investigation and the California Department of Public Health – Food and Drug Branch. Assistant U.S. Attorneys Joseph D. Barton, Arelis M. Clemente, and Henry Z. Carbajal III are prosecuting this case.”
“Why AI-Assisted Bioterrorism Became a Top Concern for Open AI and Anthropic”
Louise Matsakis covers the now constant concern about the potential for AI to aid in bioterrorism, explaining in her introduction “In the spring of 1995, U.S. lawmakers were becoming concerned that material uploaded to the nascent internet might pose a threat to national security. The Oklahoma City bombing had happened several weeks earlier, drawing attention to publications circulating online like The Big Book of Mischief, which included instructions on how to build homemade explosives.”
“Worried the information could be used to orchestrate another attack, then-Senator Dianne Feinstein pushed to make publishing bomb recipes on the internet illegal. The effort sparked a national debate about “Open Access vs. Censorship,” as one newspaper headline put it at the time.”
“Nearly 30 years later, a similar debate is now unfolding about artificial intelligence. Rather than DIY explosives, some U.S. officials and leading AI companies say they are increasingly worried that large language models could be used to develop biological weapons. The possibility has been repeatedly cited as one reason to be cautious about making AI systems open source.”
Matsakis interviewed George Mason’s Sonia Ben Ouagrham-Gormley as well in writing this piece, writing ‘“With new technologies, we tend to project in the future as though their development was linear and straightforward, and we never take into consideration the challenges and the contingencies of the people using them,” said Sonia Ben Ouagrham-Gormley, an associate professor at George Mason University who has interviewed former scientists in both the U.S. and Soviet Union’s now-defunct biological weapons programs.”
And later: “Ben Ouagrham-Gormley said her research has shown that achieving each of these steps requires employing different, highly-trained experts, including people who specialize in the exact type of pathogen being used. An AI model might be able to replace some of their work in the future, but she argued it can’t replicate the hands-on wisdom that comes from working in a laboratory.”
‘“This kind of tacit knowledge exists everywhere, but in the bio field, it’s really important because of the fragility of the raw material,” Ben Ouagrham-Gormley said.”
“Artificial Intelligence and Synthetic Biology Are Not Harbingers of Doom”
David Bray provides an optimistic outlook on the potential of AI and synthetic biology in this policy memo for the Stimson Center. Bray writes, “Contrary to many people’s fears, artificial intelligence (AI) can be a positive force in advancing biological research and biotechnology. The assumption that AI will super-empower the risks that already exist for the misuse of biotech to develop and spread pathogens and fuel bioterrorism misses three key points. First, the data must be out there for either an AI or a human to use it. Second, governments stop bad actors from using bio for nefarious purposes by focusing on the actors’ precursor behaviors. Third, given how wrong large language models (LLMs) often are and their risk of hallucinations, any would-be AI intended to provide advice on biotech will have to be checked by a human expert. In contrast, AI can be a positive force in advancing biological research and biotechnology — and insights from biology can power the next wave of AI for the benefit of humankind. Private and public-sector leaders need to make near-term decisions and actions to lay the foundation for maximizing the benefits of AI and biotech. National and international attention should focus on both new, collective approaches to data curation and ensuring the right training approaches for AI models of biological systems.”
“Going Viral: Bioeconomy Defense”
This report from Johns Hopkins’ Applied Physics Lab summarizes the findings of a May tabletop exercise:
“The May tabletop exercise at APL revealed four key areas of action to ensure a safe and secure bioeconomy.
Trust in lab equipment performance and data is foundational to the bioeconomy. Recommendations include developing digital security standards for lab equipment, hardening waypoints at each step in the data life cycle, and introducing a system of tiered levels of compliance.
Awareness of vulnerabilities, cyber and physical, and the steps for prevention and intervention are needed. Recommendations include additional exercises to strengthen intra-agency coordination and training and extending this activity to private sector companies.
Responsibility for responding to threats in the bioeconomy, and the roles for each team member, need to be defined with a process workflow, using a shared responsibility model, and teams need regular training opportunities to practice.
Preparedness is lacking, and threat-mitigation strategies specific to the bioeconomy need to be identified, tested and distributed. The exercise pushed the limits of participants’ traditional threat-mitigation strategies and identified the need for assessments of critical infrastructure and functions, cross-domain training, and the establishment of policies and procedures for an inter-agency group to rapidly respond to threats.”
“Security Considerations At the Intersection of Engineering Biology and Artificial Intelligence”
New from the Engineering Biology Research Consortium: “This white paper describes three areas at the intersection of engineering biology and artificial intelligence that may yield significant security concerns: de novo biological design, closed-loop autonomous laboratories, and natural language Large Language Models. It describes each area, identifies potential security concerns, and offers ideas for the potential mitigation of those concerns, ultimately calling for an international forum to continually address this evolving issue.”
“Pascale Ferrier and the Threat of Bioterror”
Markus K. Binder recently published this piece in NCT’s CBNW: “Drawing upon the START CBRN Data Suite and other research, Markus Binder considers the five ricin bio-attacks directed at the U.S. President and other officials that have taken place since 2013 to assess what, if anything, they can tell us about bioterrorism.”
“Americans’ Trust in Scientists, Positive Views of Science Continue to Decline”
New work from the Pew Research Center has found that “…the share of Americans who say science has had a mostly positive effect on society has fallen and there’s been a continued decline in public trust in scientists.”
“Overall, 57% of Americans say science has had a mostly positive effect on society. This share is down 8 percentage points since November 2021 and down 16 points since before the start of the coronavirus outbreak.”
“About a third (34%) now say the impact of science on society has been equally positive as negative. A small share (8%) think science has had a mostly negative impact on society.”
“A Systematic Review Of COVID-19 Misinformation Interventions: Lessons Learned”
Smith et al. recently published this article with Health Affairs: “Governments, public health authorities, and social media platforms have employed various measures to counter misinformation that emerged during the COVID-19 pandemic. The effectiveness of those misinformation interventions is poorly understood. We analyzed fifty papers published between January 1, 2020, and February 24, 2023, to understand which interventions, if any, were helpful in mitigating COVID-19 misinformation. We found evidence supporting accuracy prompts, debunks, media literacy tips, warning labels, and overlays in mitigating either the spread of or belief in COVID-19 misinformation. However, by mapping the different characteristics of each study, we found levels of variation that weaken the current evidence base. For example, only 18 percent of studies included public health–related measures, such as intent to vaccinate, and the misinformation that interventions were tested against ranged considerably from conspiracy theories (vaccines include microchips) to unproven claims (gargling with saltwater prevents COVID-19). To more clearly discern the impact of various interventions and make evidence actionable for public health, the field urgently needs to include more public health experts in intervention design and to develop a health misinformation typology; agreed-upon outcome measures; and more global, more longitudinal, more video-based, and more platform-diverse studies.”
“Coffee As a Dietary Strategy to Prevent SARS-CoV-2 Infection”
Wu et al.‘s recent article in Cell & Bioscience offers further validation for coffee drinkers (as if we needed it): “Background: To date, most countries lifted the restriction requirement and coexisted with SARS-CoV-2. Thus, dietary behavior for preventing SARS-CoV-2 infection becomes an interesting issue on a daily basis. Coffee consumption is connected with reduced COVID-19 risk and correlated to COVID-19 severity. However, the mechanisms of coffee for the reduction of COVID-19 risk are still unclear.”
“Results: Here, we identified that coffee can inhibit multiple variants of the SARS-CoV-2 infection by restraining the binding of the SARS-CoV-2 spike protein to human angiotensin-converting enzyme 2 (ACE2), and reducing transmembrane serine protease 2 (TMPRSS2) and cathepsin L (CTSL) activity. Then, we used the method of “Here” (HRMS-exploring-recombination-examining) and found that isochlorogenic acid A, B, and C of coffee ingredients showed their potential to inhibit SARS-CoV-2 infection (inhibitory efficiency 43–54%). In addition, decaffeinated coffee still preserves inhibitory activity against SARS-CoV-2. Finally, in a human trial of 64 subjects, we identified that coffee consumption (approximately 1–2 cups/day) is sufficient to inhibit infection of multiple variants of SARS-CoV-2 entry, suggesting coffee could be a dietary strategy to prevent SARS-CoV2 infection.”
“Conclusions: This study verified moderate coffee consumption, including decaffeination, can provide a new guideline for the prevention of SARS-CoV-2. Based on the results, we also suggest a coffee-drinking plan for people to prevent infection in the post-COVID-19 era.”
“WHO: ‘Collective Action’ Needed to Effectively Reduce Antimicrobial Resistance”
CIDRAP’s Chris Dall covers WHO officials’ answers to questions about AMR in this piece written in recognition of World AMR Awareness Week. Dall explains “Encouraging the medical community, world leaders, and other stakeholders to do their part in staving off that grim future is one of the goals of World AMR Awareness Week, a global campaign of the World Health Organization (WHO) this week aimed at raising public awareness and promoting practices that help mitigate the threat posed by drug-resistant infections…CIDRAP News recently submitted a series of questions to WHO officials about the themes of this year’s World AMR Awareness Week, their assessment of the progress that countries have made in addressing AMR, and the challenges that lay ahead. Responses were provided by Sarah Sheppard, the WHO’s communications lead for Medicines, Health Products & AMR.”
“The World’s Chemical-Weapons Stockpiles Are Gone – But a New Challenge Looms”
Peter J. Hotchkiss, science policy adviser to the OPCW’s Scientific Advisory Board, recently published this World View piece with Nature. He explains in part, “In 2019, the OPCW’s 193 member states decided unanimously, for the first time in history, to add compounds to the schedules, the lists of chemicals that are regulated under the convention. The four entries comprise toxic nerve agents with no known civilian use: three cover phosphorus-based agents (in the ‘novichok family’), and the fourth is a family of carbamates, another kind of nerve agent. The convention already prohibited using these (or any chemical) to intentionally kill or harm people through toxicity. Now, their production, transfer and storage are subject to stringent verification by the OPCW, through declarations and on-site inspections.”
“Yet some states have been reticent to share data on these chemicals with the OPCW. The lack of information on the newly scheduled chemicals is in jarring contrast to what we have on other weapons listed in the convention and on their precursors. To ensure the health and safety of staff members during inspections, the OPCW needs the best understanding of these chemicals’ properties, the types of personal protective equipment and medical countermeasures that are effective against them and the analytical methods for detecting them. These data would also help us to provide the best information and training to all member states, ensuring that they are prepared in the event that any of these chemicals are used as a weapon.”
“29 Morally Bankrupt Governments, Headed by Russia, Voted Against the OPCW’s Resolutions”
The Syrian Network for Human Rights recently released this report “…emphasizing that many states worldwide must bring cases against the Syrian regime before the International Criminal Court (ICC) over the regime’s repeated violations of the Chemical Weapons Convention (CWC).”
“In the 15-page report, SNHR notes that the Syrian regime has carried out 184 chemical attacks since ratifying the Convention in September 2013. The report outlines the decisions adopted by the Organization for the Prohibition of Chemical Weapons (OPCW), identifying the states that voted against those decisions, or in other words the states that support the continuation of the Syrian regime’s chemical weapons program. Through this action, it notes, these states are, in effect, encouraging the regime to use weapons of mass destruction – chemical weapons – and emboldening it to carry out more chemical weapons attacks against the Syrian people.”
“Scientific Experts Provide Key Recommendations on Biotoxin Analysis to the OPCW”
“The Scientific Advisory Board (SAB) of the Organisation for the Prohibition of Chemical Weapons (OPCW) endorsed a report outlining key recommendations on biotoxin analysis and investigations of their alleged use as weapons submitted by a SAB Temporary Working Group (TWG) earlier this year.”
“Biotoxins are toxic chemicals produced by living organisms, which vary widely in properties such as structure, size, and mechanisms of toxicity. Some biotoxins can be more toxic than traditional nerve agents. There are two biotoxins subject to stringent verification measures under the Chemical Weapons Convention – ricin and saxitoxin – with many others also posing safety and security concerns.”
“The risk of misuse of biotoxins as weapons requires the OPCW to be prepared to conduct various investigations and missions related to their alleged use. To ensure the Organisation’s readiness to do so, the TWG’s report makes critical recommendations to the OPCW…”
“2023 Catalogue of Civil Society Activities Supporting the Chemical Weapons Convention”
The Stimson Center recently released its 2023 Catalogue of Civil Society Activities Supporting the Chemical Weapons Convention, “a catalogue of civil society capacity-building, assistance, and/or research programs supporting the Chemical Weapons Convention (CWC). The catalogue highlights all interested parties, including the CWC States Parties, the Organisation for the Prohibition of Chemical Weapons (OPCW), the Global Partnership Against the Spread of Weapons and Materials of Mass Destruction, international organizations, and industry stakeholders, civil society’s contributions to strengthen reducing the threat of chemical weapons and promoting the peaceful use of chemistry. By providing a uniform product, interested parties will be able to easily identify programs, experts, and organizations that support the CWC and related chemical weapons nonproliferation instruments.”
“Emerging and Re-Emerging Chemical Threats (Part 2)”
MRIGlobal continues their discussion of CW threats with “Chemical Threats on the Battlefield and Home Front” in this blog post, explaining in part “Today’s conflicts around the world highlight the current and pressing need for continued research to help ensure the safety of anyone in danger. And though we touched on “Emerging and Re-emerging Chemical Threats” earlier in the year, because emerging and re-emerging chemical threats pose an ever-present challenge to both warfighters and civilians, we are revisiting the topic to share additional expertise. To learn more, we visited with Cristina Youngren and Evan Durnal, subject matter experts in MRIGlobal’s Integrated Defense Solutions division.”
“What Does a French Arrest Warrant Mean for Normalization With Assad?”
Julia Neumann discusses what France’s arrest warrants for Bashar al-Assad and several associates mean in practice and for regional normalization in this piece for Syria Direct.
“Why Cheap Drones Pose a Significant Chemical Terrorism Threat”
Zachary Kallenborn recently published this piece with The Bulletin of the Atomic Scientists, writing in part “Relatively cheap drones are becoming a mainstay of conflicts, from the war in Ukraine to the Israel-Hamas conflict in Gaza. Though drones were once the purview of rich and powerful militaries, it’s now possible to use cheap consumer drones in battle. With a few tweaks, they can whistle past even sophisticated air defenses. As Al-Bared’s case highlights, they may also present a significant chemical terrorism threat. Drones can be equipped with sprayers to deliver chemical weapons, or they could be used in an attack on a chemical plant. They could also provide critical attack support, helping with reconnaissance to plan out and conduct an attack, monitor law enforcement response, and create propaganda to highlight terrorist activities.”
“Stanford Emerging Technology Review: Reporting on Key Technology Areas and Their Policy Implications”
“Emerging technologies are transforming societies, economies, and geopolitics. This moment brings unparalleled promise and novel risks. In every era, technological advances buoy nations that develop and scale them—helping to save lives, win wars, foster greater prosperity, and advance the human condition. At the same time, history is filled with examples where slow-moving governments stifled innovation in ways policymakers never intended, and nefarious actors used technological advances in ways that inventors never imagined. Technology is a tool. It is not inherently good or bad. But its use can amplify human talent or degrade it, uplift societies or repress them, solve vexing challenges or exacerbate them. These effects are sometimes deliberate but often accidental.”
“The stakes of technological developments today are especially high. Artificial intelligence (AI) is already revolutionizing industries, from music to medicine to the military, and its impact has been likened to the invention of electricity. Yet AI is just one among many technologies that are ushering in profound change. Fields like synthetic biology, materials science, and neuroscience hold potential to vastly improve health care, environmental sustainability, economic growth, and more. We have experienced moments of major technological change before. But we have never experienced the convergence of so many technologies with the potential to change so much, so fast.”
“The Stanford Emerging Technology Review(SETR) is the first product of a major new Stanford technology education initiative for policymakers. Our goal is to help both the public and private sectors better understand the technologies poised to transform our world so that the United States can seize opportunities, mitigate risks, and ensure that the American innovation ecosystem continues to thrive.”
ICYMI: FBI Director Statement Before the House Committee on Homeland Security
FBI Director Christopher Wray delivered this statement to the House Committee on Homeland Security last month, highlighting the work of his agency across several mission areas, including emerging technologies and counter WMD. Wray explained in part of this statement that, “In addition to fighting terrorism, countering the proliferation of weapons-of-mass-destruction materials, technologies, and expertise, preventing their use by any actor, and securing nuclear and radioactive materials of concern are also top national security priority missions for the FBI. The FBI considers preventing, mitigating, investigating, and responding to weapons of mass destruction (“WMD”) terrorism a “no-fail” mission because a WMD attack could result in substantial injuries, illness, or loss of lives, while yielding significant social, economic, political, and other national security consequences. In collaboration with federal, state, local, tribal, territorial, and other partners, the FBI integrates complementary efforts to counter WMD terrorism. An example of this collaboration is the FBI-led Weapons of Mass Destruction Strategic Group. This interagency crisis action team spans more than 15 departments and agencies to coordinate the federal government’s response to WMD threats and incidents. Alongside the FBI, the Department of Homeland Security maintains the largest footprint on the strategic group.”
NEW: Looking Ahead in Ukraine: What Could Increase the Risk of Escalation?
“As U.S. lawmakers debate the question of continued defense and humanitarian aid to Ukraine, the Ukrainian fight to expel Russian invaders continues with no end in sight. The stalemate on the front lines in Ukraine masks continued intense fighting and demands for resources on both sides that may drive longer-term changes—on the battlefield, inside Russia, and beyond. This could lead to further escalation, including the potential to turn the conflict into a wider war. Understanding which circumstances and policies may risk escalation in Ukraine is paramount: not only are decisions about supporting Ukraine critical to the long-term trajectory of the conflict but also the United States confronts a broad set of challenges across the globe.”
“Please join RAND’s National Security Research Division on Tuesday, December 5, 2023, 9:30 – 11:00 am ET, for a moderated panel discussion about which circumstances or policies may risk escalation in Ukraine—either deliberate or inadvertent—and the potential triggers and restraining factors likely to shape Russian escalation decisions in particular.”
“Missy Ryan, a national security reporter at the Washington Post, will moderate the discussion.”
NEW: Threat Agnostic Biodefense Webinar: Assessing the Zoonotic Risk of Pre-Emergent Viruses
From PNNL: “Exploration of the “virosphere” is in its golden age. The sheer number of new viruses discovered daily, and the fact that most cannot be cultured, creates enormous uncertainty about where to allocate attention and resources. It is not an intractable problem, however, to distinguish those few viruses that are likely to emerge as zoonoses from the many others that are not. This talk describes two diametric approaches to addressing this problem. The first approach involves a field-to-lab investigative methodology that, when combine with biologically informed predictive computational models, can assess the zoonotic risk of viruses that have not yet been identified in humans. The second approach relies on the power of modern methods in anthropology and ethnography to identify zoonotic transmission pathways, even before the identification of any pathogens that might traverse those pathways. A unifying example is simian hemorrhagic fever virus and its relatives in the family Arteriviridae, which cause important animal diseases but have never been documented to infect humans. Both approaches identify these viruses as high-risk pre-emergent zoonoses.”
Learn more and register for this December 6 event here.
NEW: Bio & Beer
“As a rising global leader in the bioeconomy, investments in the future STEM workforce are critical in order to secure the U.S.’s position as a world resource for biohealth technology and innovations. Join us and our three guest speakers as we discuss the importance of a diverse, skilled STEM workforce to address rapidly increasing industry demand. We will also talk about training and other opportunities designed to prepare individuals for STEM careers. Enjoy an evening of networking, drinks, and fun!”
Meeting the Moment: Biodefense Policy, Procurement, and Public Health
From the Bipartisan Commission on Biodefense: “As the Nation continues to endure the consequences of recent pandemics, and with continued interest in biological weapons by nation states and other enemies, the federal government has an opportunity to address vulnerabilities in the biodefense enterprise. At this meeting, titled Meeting the Moment: Biodefense Policy, Procurement, and Public Health, the Commission intends to further explore : (1) biodefense policies and activities at the Department of Defense; (2) federal stockpile evaluation and decision-making for smallpox medical countermeasures; (3) needed authorities of the Department of Health and Human Services, including the Centers for Disease Control and Prevention; and (4) biodefense leadership.”
This meeting will take place on December 5, from 10:30 am until 4 pm ET. Register here.
2023 EPA International Decontamination Research and Development Conference-“Advancing Preparedness through Science and Collaboration”
“The clean-up of chemical, biological, or radiological (CBR) contamination incidents and natural disasters is a critical challenge for the United States. Understanding how to characterize and remediate affected areas of environmental contamination and waste is necessary for daily life to return.”
“The Decon Conference is designed to facilitate presentation, discussion, and further collaboration of research and development topics focused on an all-hazards approach to remediate contaminated indoor and outdoor areas, critical infrastructure, water distribution systems, and other environmental areas/materials.”
“This conference is free and open to the public. Content and presentations are geared towards the emergency response community, including local and state emergency managers, homeland security officials, first responder coordinators, private sector industry, risk managers, educators in the field of emergency management, and others.”
This event will take place December 5-7 in Charleston, SC. Learn more and register here.
Mitigating Arboviral Threats and Strengthening Public Health Preparedness
“Arboviruses are a broad group of viruses that are spread by arthropods, such as ticks and mosquitoes. Diseases caused by arboviruses, like dengue, chikungunya, Zika, and yellow fever, present a significant public health burden and threaten billions of people worldwide. Despite the global recognition of the devastating health and economic impacts of these diseases, the need persists for improved integration of mitigation efforts into public health systems and environmental and urban planning.”
“The National Academies Forum on Microbial Threats will conduct a two-day workshop that will identify lessons learned from previous outbreaks, outline current arbovirus surveillance capacities, and describe novel approaches to arbovirus mitigation. The workshop will include perspectives from researchers, public health practitioners, and environmental management experts from across the globe.”
This event will take place on December 12 and 13. Learn more here.
Presidential Advisory Council on Combating Antibiotic-Resistant Bacteria (PACCARB) Virtual Meeting
“The Presidential Advisory Council on Combating Antibiotic-Resistant Bacteria (PACCARB) provides advice, information, and recommendations to the U.S. Secretary of Health and Human Services (HHS Secretary). The council supports and evaluates U.S. government activities focused on fighting antimicrobial resistance (AMR) in human health, animal health, and environmental health. Using this One Health approach, members of the PACCARB have expertise from a range of backgrounds, including academia, industry, public health, advocacy, veterinary, and agricultural production.”
“As a federal advisory committee, the PACCARB looks to engage with the public and all AMR stakeholders. The council holds several public meetings every year both in-person and live streamed on the HHS.gov website. These meetings are open to anyone with an interest in combating AMR. See how to get involved!”
This virtual meeting will take place on December 20 from 9-4 EST. Learn more here.
61st ISODARCO Course: Nuclear Order and International Security after Ukraine
“The war in Ukraine has had an enormous impact on global security, reviving nuclear fears, undermining the prospects for arms control, and shattering many of the norms and constraints that were the foundation of European security. ISODARCO 2024 will examine the global nuclear order in light of the Ukraine war, focusing on the states, the policies and the technologies that will shape the future in a much more difficult environment. How will we cope with this more dangerous world?”
This course will take place January 7-14, 2024, at the University of Trento. Learn more and register here.
International Conference, CBRNE Research & Innovation
“The last 40 years have demonstrated that both military and civilian populations could be exposed to highly hazardous CBRNE agents following conflicts, natural outbreaks and disasters, industrial incidents or terrorist attacks.”
“Worldwide, researchers, responders and industrial capacities have been commited to provide adapted response to these challenges.”
“Building on the success of the first 5 International Conferences « CBRNE Research and Innovation » which took place in Antibes (2015), Lyon (2017), Nantes (2019), on line (2021) and Lille (2022), we want to give you a new opportunity to build up or strengthen collaborative networks in Strabourg (March 19th – 21rst 2024).”
“The CBRNE R&I Conference is specifically devoted to scientific updates, responders’ feedbacks and expression of needs. It also includes workshops and demonstrations of innovative materials, technologies and procedures, according to the following themes: DETECTION – IDENTIFICATION, PROTECTION – DECONTAMINATION, MEDICAL COUNTERMEASURES, RISKS & CRISIS MANAGEMENT.”
“Looking forward to your proposals for communication and to welcoming you at Strasbourg in March 2024!”
Registration is now open for the Global Health Security 2024 conference in Sydney, Australia. This iteration will take place 18-21 June, 2024. The call for abstracts is also still open. “The mission of the Global Health Security conference is to provide a forum where leaders, researchers, policy-makers, and representatives from government, international organisations, civil society, and private industry from around the world can engage with each other, review the latest research and policy innovations, and agree solutions for making the world safer and healthier. To that end, our mission is to help foster a genuinely multidisciplinary community of practice that is committed to working collaboratively to enhance global health security and eliminate disease, irrespective of its origin or source.”
Council on Strategic Risks Launches the Nuclear Weapon Systems Project
“How states view the roles and relevance of nuclear weapons is changing. While these perspectives have been dynamic since the dawn of the atomic age, the changes occurring today and drivers of these changes are particularly worrisome—in particular given that they seem to be on the cusp of reversing a period heavily characterized by arms control agreements, reductions in global arsenals, and advances in international cooperation to reduce nuclear weapons risks.”
“CSR’s core nuclear policy work to address this challenging time has focused largely on qualitative approaches to reducing the risks of nuclear miscalculations, uses of these weapons, arms racing behavior, and other dangerous trends. Going beyond numbers of weapons—which has been a major policy focus given numerical limitations in past nuclear treaties—a qualitative view of the nuclear weapons landscape is done through the lens of the nuclear capabilities nations seek, and associated policies and postures. This can help to show where multiple nations might find areas for potential cooperation that would be mutually beneficial. It can also help to show where nations currently possess the capabilities they claim to need, and thereby in what ways cooperative or unilateral measures of restraint are the most appropriate.”
“In order to facilitate this work by CSR and by others, we are launching The Nuclear Weapon Systems Project to help visualize how the types of nuclear capabilities fielded in the world have evolved since the advent of these weapons.”
“This project seeks to document and characterize every deployed nuclear weapons system that NPT-recognized nuclear states have developed in history. More than just a list of bombs, missiles, and artillery shells, the resulting dataset illustrates a complex story of risks, strategies, and lessons learned—and lost. We consider this data to be a living resource, and encourage outside contributions and feedback.”
“Georgetown Global Health Center Launches First Open-Access Wildlife Disease Database”
Georgetown University Medical Center’s Center for Global Health Science and Security recently announced “the launch of a first-of-its-kind wildlife disease database — a system for collecting records of viruses, bacteria, fungi, parasites, etc. — designed to support an early warning system for potential viral emergence. The Pathogen Harmonized Observatory, or PHAROS, is open to the global community and free to access.”
“Scientists in GHSS’ Verena program, a collaborative institute comprising a global team of scientists, designed PHAROS to advance research and education around viral emergence — the process of viruses jumping from animals to humans. Verena co-founder and director Colin Carlson, PhD, says most platforms designed to track diseases in wild animals are very limited and are developed only in response to a major outbreak, such as birds dying off suddenly due to avian flu.”
‘“Our goal is to build a data sharing system that lets us eventually predict pandemics like the weather,” Carlson says. “When we collect data on wildlife viruses, it gets published in journals and then lost forever, because it isn’t ever standardized or compiled. After COVID, there’s no excuse to keep working that way.”’
Texas A&M Research Assistant Professor (Pandemic Preparedness/Biosecurity) Openings
Texas A&M University’s Scowcroft Institute of International Affairs is seeking up to two Research Assistant Professors with expertise in pandemic preparedness and/or biosecurity. The Research Assistant Professor will be in the Scowcroft Institute of International Affairs, Bush School of Government & Public Service, and will work with the Pandemic Preparedness & Biosecurity Policy Program. Responsibilities include teaching graduate courses, conducting research, and writing policy-relevant publications on biosecurity, global health security, bio and agro-defense, federal life sciences policy, one health, biotechnology, or related policy topics.
Happy Friday! This week we are covering President Biden’s announcement that the national and public health emergency declarations for COVID-19 will terminate on May 11, recommendations to expand federal oversight of biosecurity and risky research, and the OPCW Investigation and Identification Team’s third report on the 2018 Douma chemical attack. We also have a number of new publications and a podcast episode featuring Dr. Glenn Cross, an alumnus of the Biodefense PhD Program, discussing Rhodesia’s CBW program during its counterinsurgency in the 1970s.
Biden Administration to End COVID-19 Emergency Declarations in May
In September of last year, President Biden declared in an interview on “60 Minutes” that “The pandemic is over,” drawing swift backlash for seemingly endorsing the sentiment that the pandemic is over because Americans want to behave like it is. He continued, saying “We still have a problem with COVID. We’re still doing a lot of work on it…but the pandemic is over. If you notice, no one’s wearing masks. Everybody seems to be in pretty good shape. And so I think it’s changing.” We wrote then, “Everybody” is definitely not “in pretty good shape.” With developments announced this week, this has potential to become even more true later this year with the end of pandemic protections.
President Biden notified Congress this week that he plans to end the national emergency and public health emergency declarations for the COVID-19 pandemic on May 11, a move that will shift the federal response to one designed at managing an endemic threat and end several protections and benefits. It comes as many have pushed for a “return to normal” and House Republicans threaten to end the national emergencies themselves. The end of these emergencies will likely mean that many Americans will have to pay for COVID-19 testing, vaccinations, and treatments out of pocket that were previously free to them. Zeke Miller explains this further in AP News, writing in part “It comes as lawmakers have already ended elements of the emergencies that kept millions of Americans insured during the pandemic. Combined with the drawdown of most federal COVID-19 relief money, it would also shift the development of vaccines and treatments away from the direct management of the federal government.”
Congress has refused to authorize additional funding for COVID-19 vaccines, prompting the federal government to begin preparations to move this care to the commercial market last year. Pfizer and Moderna have indicated that their prices for COVID-19 vaccines will likely be between $82 and $130 per dose. This amount is between three and four times what the federal government has paid for them through bulk purchasing programs, according to the Kaiser Family Foundation. The same Kaiser analysis found that, “If payers end up paying those prices for one dose per adult, the analysis estimates that the total cost of purchasing booster shots commercially would run between $6.2 billion and $29.7 billion a year, depending on price and how many people nationally get the vaccine or booster.”
The federal government spent over $30 billion on these vaccines to “…encourage their development, guarantee a market, and ensure that the public can access them at no charge.” Insurers may be able to negotiate discounted prices, but as Kaiser also points out, “…they will have limited leverage because they will generally be required to cover all recommended vaccines and boosters.” While those with public or private insurance may not personally bear this cost, this could drive up insurance premiums. Worse, those who are uninsured will lose their guaranteed access to these vaccines and, given the prices announced per dose by Pfizer and Moderna, paying out-of-pocket will likely be out of reach for many.
And the number of uninsured also has potential to rise with the end of expanded Medicare coverage in response to the COVID-19 pandemic. AP explains, “Medicaid enrollment ballooned during the pandemic, in part because the federal government prohibited states from removing people from the program during the public health emergency once they had enrolled. The program offers health care coverage to roughly 90 million children and adults — or 1 out of every 4 Americans. Late last year, Congress told states they could start removing ineligible people in April. Millions of people are expected to lose their coverage, either because they now make too much money to qualify for Medicare or they’ve moved. Many are expected to be eligible for low-cost insurance plans through the Affordable Care Act’s private marketplace or their employer.”
Worse yet “Food help for unemployed adults, under the age of 50 and without children, will also change after the public health emergency is lifted in May. During the emergency declaration, a rule that required those individuals to work or participate in job training for 20 hours per week to remain eligible for SNAP benefits was suspended. That rule will be in place again starting in June. SNAP aid for more low-income college students will also draw down in June.” Important to note here is that it is estimated as many as 4 million Americans are out of work because they are dealing with long COVID. The unemployment rate stayed roughly the same in January 2023 as job growth continued, but this does not address discrepancies between stagnated wages and rising costs of living. Ultimately, the end of all these expanded benefits and protections now will only harm especially vulnerable populations, more than likely threatening their overall health.
Finally, the Office of Budget and Management indicated this week that “…an abrupt end to the emergency declarations would create wide-ranging chaos and uncertainty throughout the health care system — for states, for hospitals and doctors’ offices, and, most importantly, for tens of millions of Americans. During the PHE, the Medicaid program has operated under special rules to provide extra funding to states to ensure that tens of millions of vulnerable Americans kept their Medicaid coverage during a global pandemic. In December, Congress enacted an orderly wind-down of these rules to ensure that patients did not lose access to care unpredictably and that state budgets don’t face a radical cliff. If the PHE were suddenly terminated, it would sow confusion and chaos into this critical wind-down. Due to this uncertainty, tens of millions of Americans could be at risk of abruptly losing their health insurance, and states could be at risk of losing billions of dollars in funding.” If the last three years have taught us anything, it is that giving about 100 days notice for these kinds of changes is hardly helpful for those who will be the most impacted.
Of course, the end of the national emergencies does not mean the pandemic is actually over. Three years after its inaugural meeting, the International Health Regulations (2005) Emergency Committee released the report from its fourteenth meeting regarding COVID-19. While the committee and WHO Director-General Tedros Adhanom Ghebreyesus acknowledged the pandemic is likely at a transition point, the “WHO Director-General concurs with the advice offered by the Committee regarding the ongoing COVID-19 pandemic and determines that the event continues to constitute a public health emergency of international concern (PHEIC).”
Importantly, “The WHO Secretariat expressed concern about the continued virus evolution in the context of unchecked circulation of SARS-CoV-2 and the substantial decrease in Member States’ reporting of data related to COVID-19 morbidity, mortality, hospitalization and sequencing, and reiterated the importance of timely data sharing to guide the ongoing pandemic response…WHO is urging countries: to remain vigilant and continue reporting surveillance and genomic sequencing data; to recommend appropriately targeted risk-based public health and social measures (PHSM) where necessary; to vaccinate populations most at risk to minimize severe disease and deaths; and to conduct regular risk communication, answering population concerns and engaging communities to improve the understanding and implementation of countermeasures.”
Ultimately, apathy towards this ongoing emergency is driving the end of protections and needed benefits for those that need them most. The pandemic is not over, despite politicians’ interest in that being the case. No amount of political rhetoric will ever substitute making needed investments in adequately managing and preventing these kinds of public health emergencies–a lesson the United States seems destined to “re-learn” yet again.
This illustration, created at the Centers for Disease Control and Prevention (CDC), reveals ultrastructural morphology exhibited by coronaviruses. Note the spikes that adorn the outer surface of the virus, which impart the look of a corona surrounding the virion, when viewed electron microscopically. A novel coronavirus, named Severe Acute Respiratory Syndrome coronavirus 2 (SARS-CoV-2), was identified as the cause of an outbreak of respiratory illness first detected in Wuhan, China in 2019. The illness caused by this virus has been named coronavirus disease 2019 (COVID-19).| Credit: CDC PHIL
National Science Advisory Board for Biosecurity Recommends Changes in Biosecurity Oversight
The National Science Advisory Board for Biosecurity endorsed a set of draft recommendations this past week that found, among other things, that current definitions of potential pandemic pathogens (PPP) and enhanced potential pandemic pathogens (ePPP) are too narrow and over-focused on pathogens that “…are both likely “highly” transmissible and likely “highly” virulent”. Their recommendations would expand oversight to cover work considered less risky and end blanket exclusions for “research activities associated with surveillance and vaccine development or production,” among several other measures aimed at enhancing safety and transparency. The White House will decide whether or not to adopt these recommendations.
Dr. Gregory Koblentz, Biodefense Graduate Program Director, discussed these recommendations with The New York Times, saying ““If the government implements the spirit of what they’ve written, this would be a major overhaul of dual-use research oversight in the United States,”. The article also explains his argument that the White house should go beyond these recommendations and create an independent agency to perform this oversight and streamline a system he says is too fragmented.
OPCW Investigation and Identification Team Releases Third Reporton Douma Attack
The Organisation for the Prohibition of Chemical Weapons released its third report from its Investigation and Identification Team investigating a chemical weapons attack that occurred on April 7, 2018, in Douma, Syrian Arab Republic. The report indicates that “Based on the holistic assessment of the large volume and wide range of evidence gathered and analysed, and on the convergence of the outcomes of such corroborated multiple analyses, the IIT concluded that, on the evening of 7 April 2018, at least one helicopter of the Syrian “Tiger Forces” Elite Unit dropped two yellow cylinders containing toxic chlorine gas on two apartment buildings in a civilian-inhabited area in Douma, killing 43 named individuals and affecting dozens more.”
🔴 Reasonable grounds to identify Syrian Arab Air Forces as perpetrators of 2018 #Douma#ChemicalWeapons attack, #OPCW IIT report concludes.
Syria’s Foreign Ministry commented on the report: “The [Syrian Foreign Ministry] statement said that the report lacks scientific and objective evidence, and no sane person or specialist can reach such misleading conclusions,” Syria’s state-run SANA news agency summarized the foreign ministry as saying….”Those who prepared this report neglected the objective observations raised by State parties, experts, academics and former OPCW inspectors, known for their expertise and knowledge.”
However, as polygraph.info explains, “That is false…The OPCW reviewed over 19,000 files, obtained and assessed 66 witness statements, and considered data related to 70 samples. It also followed up on “lines of inquiry” suggested by Syria and other state parties…Adhering to “best practices,” the OPCW reached its conclusions after collecting, scrutinizing and corroborating all the available information gathered throughout the course of its nearly two-year investigation.”
US Secretary of State Antony Blinken issued a joint statement with UK Secretary of State for Foreign, Commonwealth and Development Affairs James Cleverly, French Minister of Europe and Foreign Affairs Catherine Colonna, and German Federal Foreign Minister Annalen Baerbock discussing the OPCW report:
Today, the Organization for the Prohibition of Chemical Weapons (OPCW) released a report that found the Assad regime responsible for the deadly chemical weapons attack on Douma on April 7, 2018. The report refutes the Russian claim that it was an opposition attack.
The report concludes that there are reasonable grounds to believe that, around 19:30 local time on April 7, 2018 at least one Mi-8/17 helicopter of the Syrian Arab Air Force, departing from Dumayr airbase and operating under the control of the Tiger Forces, dropped two yellow cylinders which hit two residential buildings in a central area of the city releasing chlorine killing 43 named individuals and affecting dozens more.
This report marks the ninth instance of chemical weapons use independently attributed to the Assad regime by UN and OPCW mechanisms.
Our governments condemn in the strongest terms the Syrian regime’s repeated use of these horrific weapons and remain steadfast in our demands that the Assad regime immediately comply with its obligations under the Chemical Weapons Convention (CWC) and relevant UN Security Council resolutions. Syria must fully declare and destroy its chemical weapons program and allow the deployment of OPCW staff to its country to verify it has done so.
The report also points out that the IIT received credible information, corroborated through multiple sources, that Russian forces were co-located at Dumayr airbase alongside the Tiger Forces. The IIT also obtained information that, at the time of the attack, the airspace over Douma was exclusively controlled by the Syrian Arab Air Force and the Russian Aerospace Defence Forces.
We call on the Russian Federation to stop shielding Syria from accountability for its use of chemical weapons. No amount of disinformation from the Kremlin can hide its hand in abetting the Assad regime. In the aftermath of Syria’s chemical attack on April 7, 2018, Russian military police helped the Syrian regime obstruct OPCW access to the site of the attack and attempted to sanitize the site. Russian and Syrian troops also staged photographs later disseminated online in an attempt to support its fabricated narratives of this incident.
We commend the independent, unbiased, and expert work of the OPCW staff, condemn the use of chemical weapons anywhere, by anyone, under any circumstances. We also reaffirm our commitment to hold accountable the perpetrators of all chemical weapons attacks in Syria and beyond.
The @OPCW found Syria responsible for the deadly chlorine attack on #Douma. I join my German, French and British counterparts in condemning Syria for its repeated use of chemical weapons. We also call on Russia to stop shielding Syria from accountability. https://t.co/te9HnJSNmM
Dr. Gregory Koblentz, Biodefense Graduate Program Director, said of the OPCW report: “This report documents the fifth chemical attack that can be directly attributed to the Syrian air force. The chlorine attack on Douma fits a pattern of chemical weapon use by the Assad regime and was an integral part of the brutal counterinsurgency operation the Assad regime was conducting at the time. The report is based on a thorough, multidisciplinary investigation that refutes Syrian and Russian allegations that this attack was somehow staged by the rebels. The report breaks new ground by naming the Syrian military officer responsible for conducting this attack: Brigadier General Souheil Al-Hassan, commander of the notorious Tiger Forces, which has been responsible for a series of chemical attacks and other atrocities during the Syrian civil war.”
“Pandemic Origins: Technologies, Challenges, and Policy Options to Support Investigations”
This report from the Government Accountability Office discusses the findings of the office’s technology assessment, Pandemic Origins: Technologies and Challenges for Biological Investigations and covers “(1) key technologies available for pandemic origin investigations, (2) strengths and limitations of these tools and how researchers use them to investigate pandemic origins, and (3) cross-cutting challenges researchers face in trying to determine a pandemic’s origin.” GAO identified several challenges that can inhibit determination of a pandemic’s origin, including challenges in acquiring data and the lack of a sufficient and skilled workforce. According to the report, “GAO identified five policy options that may help address the cross-cutting challenges, including proactively establishing multilateral agreements for accessing and sharing samples and genetic sequence data, taking steps to grow an interdisciplinary workforce, and developing a national strategy targeted to pandemic origin investigations. These policy options represent possible actions that policymakers—who may include Congress, federal agencies, state and local governments, academia, industry, and international organizations—could consider taking.”
Disease X: The 100 Days Mission to End Pandemics
This new book was published this week by Kate Kelland, Chief Scientific Writer at the Coalition for Epidemic Preparedness Innovations (CEPI). “Distilling insights from health security experts, examining epidemics and pandemics of the past and present, and analysing what governments, societies and their people got right and wrong in the response to COVID-19 and other devastating disease outbreaks, Kelland explores why and how viruses—tiny as they are—can wreak enormous havoc on our way of life. But she also tells a story of hope, giving readers a glimpse of a future where the threat of pandemics has been neutralised by a prepared and collaborative world.”
Governing Pandemics Snapshot Inaugural Issue
The first issue of Governing Pandemics Snapshot is available now from the Geneva Graduate Institute’s Global Health Centre. “Welcome to the inaugural issue of the Governing Pandemics Snapshot, a publication aiming to provide a concise, periodic overview on the state of efforts to strengthen global pandemic preparedness and response (PPR). This first issue looks back at 2022 and forward to 2023, examining three topics that will recur with each issue: negotiations towards a Pandemic Treaty (or instrument), amendment of the International Health Regulations; and Financing of PPR. Each issue will also cover a rotating special topic, and we begin here with Pathogen- and Benefit-Sharing (PBS). More frequent updates are available on our timeline at GoverningPandemics.org.”
“Addressing Misconceptions About Biological and Chemical Weapons and Related Legal Frameworks”
This new report from VERTIC is available now here. “The main purpose of this resource is to disprove misconceptions about biological and chemical weapons and related international instruments. It addresses misconceptions about biological and chemical weapons and related legal frameworks that VERTIC staff have identified through interactions with states over 20 years’ work on these treaties, and from other sources such as the media. Each misconception is broken down into an explanation of the misconception and its implications, and how to address it. The misconceptions are then disproved through factual and legal discussions, supported by expert commentary.”
“New Bio-Defense Strategy to Eschew ‘One Bug, One Drug’ Programs”
This piece in National Defense covers discussion of the upcoming Bio-Defense Posture Review with USAF Col. James Harwell, deputy director for chemical, biological, radiological and nuclear defense at the Joint Chiefs of Staff’s Joint Requirements Office. The article reads in part, “Gone are the days where we take long periods of time to identify an emerging threat and build a specific countermeasure to that threat. Science is moving at a pace that allows for new threats to rapidly emerge and to undermine our ability to achieve our National Defense Strategy,” Harwell said.”
“The Doomsday Clock is Ticking on Biosecurity”
In this piece for Defense One, Suzet McKinney, Asha George, and David Relman discuss the Bulletin of the Atomic Scientists’ Science and Security Board’s setting of the Doomsday Clock’s time to 90 second to midnight. They acknowledge that it was mostly moved because of the war in Ukraine, but they also write that “The impact of this war on the global order has implications far beyond the nuclear realm and the battlefield more generally. The war thwarts international cooperation exactly when we need cooperation most—to address pressing 21st-century threats such as climate change, mis- and disinformation, and a problem we and others know quite well: the proliferation of biological threats.”
“Managing the Risks of Biotechnology Innovation”
In this workshop policy paper for the Council on Foreign Relations, Dr. Gigi Kwik Gronvall discusses the risks posed by biotechnological progress and summarizes a November CFR workshop titled “Managing the Risks of Biotechnology Innovation.” She identifies several gaps in global governance of these risks, including misinformation and disinformation’s influence on the progress and governance of biotechnology, writing in part “Well-funded groups have undermined the development of various biotechnologies, as seen in “golden rice,” which was developed in the 1990s to combat vitamin A deficiency. However, this intervention has not been deployed due to unjustified safety concerns, and millions of children have died from vitamin A deficiency. Misinformation about GMOs, vaccines, and therapies is common, and has intensified during the COVID-19 pandemic. In addition, Russia has recently presented the presence of public health laboratories in Ukraine as cause for suspicion of misuse of biotechnologies. Sometimes institutions, newspapers, or research groups will organize to counter specific threads of misinformation and disinformation, but it is a significant, often uncompensated, obligation for those involved.”
“The Next Generation of Coronavirus Vaccines: A Graphical Guide”
“Vaccines against the coronavirus SARS-CoV-2 have been given to billions of people to protect them from COVID-19, and have saved more than 20 million lives. But viral variants can evade some of the immunity provided by the original vaccines. As a result, vaccine developers around the world are working on dozens of ‘next-generation’ COVID-19 vaccines: not just updates of the first versions, but ones that use new technologies and platforms.” Check out this graphical guide from Nature that covers the next generation of COVID-19 vaccines.
“Could a Chatbot Teach You How to Build a Dirty Bomb?”
In this piece for Outrider, Matt Korda discusses concerns brought about by chatbots like ChatGPT and OpenAI. He writes in part, “But despite being programmed to align with human values, could ChatGPT be tricked into doing harm? To answer this question, many researchers (myself included) picked up ChatGPT’s proverbial gauntlet and went to work searching for creative ways to circumvent the AI model’s safety guardrails. The results of this collective experiment were often funny and—worryingly—occasionally successful.”
What We’re Listening To 🎧
Poisons and Pestilence “14 Bonus Episode: Dirty War with Glenn Cross”
In this latest episode, Dr. Brett Edwards discusses Rhodesia’s development of a CBW program and its use during the country’s counterinsurgency in the 1970s with Dr. Glenn Cross, an alumnus of the Biodefense PhD program and author of Dirty War, a book discussing this program in-depth that is a must read.
This Podcast Will Kill You “Episode 111 RSV: What’s syncytial anyway?”
“We’re kicking off our sixth season in the same way we ended our fifth: with another headline-making respiratory virus. But as our listeners know, not all respiratory viruses are the same, and it’s often those differences among them that play the biggest role in their spread or the symptoms they cause. This episode, we’re exploring the virus that everyone has been talking about lately. No, not that one. Or that one. The other one. Yes, we’re talking about respiratory syncytial virus, or RSV. For many people, the recent surge in RSV infections that dominated headlines this winter may have been the first time they had heard of this viral infection or realized how deadly it could be. But for others, RSV has long inspired fear and dread. In this episode, we Erins explain why this virus deserves such notoriety, how long we’ve recognized the dangers of infection, and what hope the future may hold for novel RSV treatments or vaccines. If at any point you’ve wondered what all the fuss is about this virus or how to pronounce syncytial, then this is the episode for you!”
Prosperity and Human Security: Japan and Asia’s 21st Century Governance Challenges
Join Harvard’s Program on US-Japan Relations for this symposium that includes panels on “Development and Governance Challenges in Public Health” and “Development, Climate Change, and Climate Migration”. The former will feature Dr. Yanzhong Huang, Senior Fellow for Global Health at the Council on Foreign Relations, discussing “China, Covid-19, and global health governance”. This event will take place on February 6 at 12 pm EST. Learn more and register here.
Jonathan Tucker CBW Symposium
“The James Martin Center for Nonproliferation Studies cordially invites you to the 11th annual Jonathan Tucker Symposium on chemical and biological weapons issues on February 9th and 10th, 2023.” BW topics include “Revisiting the Siege of Caffa & Catapulting Cadavers” and “Governance of Dual-Use Biological Research,” the latter of which will be moderated by Dr. Gregory Koblentz. CW topics include “Lessons learned from the U.S. Chemical Weapons Destruction Program” and “The 2023 CWC Review Conference”. Learn more and register for the virtual events here.
Join the Strategic Trade Research Institute on February 15, at 9 am EST for this launch event moderated by Dr. Andrea Viski, a Schar School adjunct professor who teaches courses on strategic trade controls. Featured authors will engage in a virtual interactive panel discussion discussing the new edition. Learn more and register here.
Personal Protective Equipment and Personal Protective Technology Product Standardization for a Resilient Public Health Supply Chain
“The National Academies will convene a public workshop, March 1-2, to examine standards gaps related to personal protective equipment (PPE) and personal protective technology (PPT). The event will explore innovative approaches and technologies needed to update and streamline the U.S. standardization system for PPE and PPT in support of supply chain resiliency. Policymakers, manufacturers, users, and relevant technical contributors will discuss ways to improve the effectiveness, safety, supply stability, and accessibility of PPE and PPT in health care settings and increase usage by critical infrastructure workers and the general public.” Learn more and register here.
Novel Applications of Science and Technology to Address Emerging Chemical and Biological Threats
For the first time since 2019, this Gordon Research Conference is back, this time in sunny Ventura, CA. “The Chemical and Biological Defense GRC is a premier, international scientific conference focused on advancing the frontiers of science through the presentation of cutting-edge and unpublished research, prioritizing time for discussion after each talk and fostering informal interactions among scientists of all career stages. The conference program includes a diverse range of speakers and discussion leaders from institutions and organizations worldwide, concentrating on the latest developments in the field. The conference is five days long and held in a remote location to increase the sense of camaraderie and create scientific communities, with lasting collaborations and friendships. In addition to premier talks, the conference has designated time for poster sessions from individuals of all career stages, and afternoon free time and communal meals allow for informal networking opportunities with leaders in the field.” The conference will be held March 19-24, 2023. Learn more and apply here by February 19.
Weekly Trivia Question
You read the Pandora Report every week and now it’s time for you to show off what you know! The first person to send the correct answer to biodefense@gmu.edu will get a shout out in the following issue (first name last initial). For this week, our question is: In February 1964, Albert Nickel, an animal caretaker at Fort Detrick, contracted and died from a disease after he was bitten by an infected rodent. What is the name of the disease and what is its causative agent?
Shout out to Pappas G. for winning last week’s trivia! The correct answer to “On April 22, 1915, the German Army infamously unleashed more than 160 tons of chlorine gas on French trenches near which Belgian city?” is Ypres. Check out the National World War I Museum and Memorial’s page on this event.
Summer Workshop on Bioterrorism, Pandemics, and Global Health Security – A Recap
“The spectrum of biological threats is often much wider than many realize. From the current Ebola virus disease outbreak in the Democratic Republic of the Congo to CRISPR-designed babies, there are a lot of biological issues that trickle over into health care and public health. This week, I attended the Summer Workshop on Pandemics, Bioterrorism, and Global Health Security: From Anthrax to Zika, where conversations ranged from protecting the bioeconomy to vaccine development. Here are the key takeaways: First, it’s a startling truth, but biological threats aren’t just black and white, but a vast spectrum of gray. We no longer live in a world where it’s just pandemics and bioterrorism, but also conversations surrounding dual-use research of concern (DURC), gene drive worries with CRISPR-modified mosquitoes, pandemic response, vaccine development, and so much more. FBI Supervisory Special Agent Edward You discussed concerns of garage biohacking and how the US government has policies on oversight for life sciences DURC. Furthermore, You discussed synthetic biology and how the price for DNA synthesis kits (ie, biohacking kits) have dramatically dropped over the years.”
Bashar al-Assad is Waging Biological War – By Neglect
Going against the traditional definition of biological warfare, Annie Sparrow discusses how the deliberate efforts by the Assad regime to destroy public health and healthcare are actually a form of biological warfare. “Beyond being unpredictable and difficult to control, anthrax or sarin attacks are too visible and risk a global reaction. And in war, they kill in far smaller numbers and much less reliably than common diseases and wound infections. In contrast, the behavior of Assad’s preferred pathogens is predictable. Here lies the key to a far more insidious strategy: By deliberately degrading an already precarious public health situation, the new biological warfare is able to fly under the radar. Assad’s most visible mass atrocities include indiscriminate attacks on and the resulting forced displacement of civilians, devastating sieges, and assaults on hospitals. But an unappreciated dimension of his total-war strategy has been his attacks on public health infrastructure and programs in order to fast-track the epidemic diseases that thrive in the crowded living conditions created by mass displacement, while simultaneously withholding essential public health tools and medicines. The aim is to weaken the entire population in these areas and overburden the rudimentary medical facilities that were able to survive in an effort to punish populations opposed to Assad. While there is a brutal battlefield logic to these attacks on health care infrastructure, they are prohibited by the Geneva Conventions, which are designed to spare civilians—and the institutions on which they depend—from the hazards of war. Assad is deliberately engaging in war crimes.”
In Memory of Prof. Andrew Price-Smith
The biodefense world got a bit dimmer with the passing of one its greats – Dr. Andrew Price-Smith. The author of one of my personal favorites – Contagions and Chaos, “Professor Andrew Price-Smith, David Packard Professor of International Relations and Director of the Global Health Initiative, passed away last week after a lengthy illness. He is survived by his wife, Janell Price-Smith, and their two children. Our thoughts and prayers are with Drew’s family, colleagues, and friends. Professor Price-Smith joined the CC faculty in 2005 and served as chair of the political science department from 2013-2016 and as the founding director of our Global Health Initiative. Drew’s research focused on the effects of disease, environmental change, and energy scarcity on the security of nations and taught courses on the environment, health and security, and international relations.”
UK Parliament Inquiry into Government’s Biosecurity Efforts
It’s been a year since the UK Government published their first ever Biosecurity Strategy, and the Joint Committee on the National Security Strategy is set to inquire how they’re approaching biosecurity and human health. “The strategy is intended to coordinate a cross-government approach to biosecurity threats, whether they materialise naturally, accidentally or deliberately in the form of a malicious attack. It cites globalisation and technology as key factors in today’s biosecurity risks. The Government has long prioritised public health as a national security issue, with pandemics and emerging infectious diseases categorised as a top-tier risk in the 2010 and 2015 National Security Risk Assessments. Attacks using biological weapons are categorised as a second-tier risk, along with attacks using chemical, radiological and nuclear weapons. In 2018, the Government’s National Security Capability Review elevated ‘diseases and natural hazards affecting the UK’ to one of six principal challenges likely to drive national security priorities over the coming decade.” You can read the UK Biological Security Strategy here, which “recognises the importance of intervening early to prevent biological threats from emerging, or from spreading once they emerge. To this end, it sets out how we will make best use of our international activity to help reduce the risks to the UK and our interests, at home and overseas. This includes our engagement with international partners (at local, regional and national levels) and forums. Our investment in overseas biological security education and our international work on global health security, led by DHSC and DFID, is building resilience to health threats in developing countries.”
Ebola Outbreak Updates
The outbreak of Ebola virus disease in the DRC has been changing daily, but here’s an update to help catch you up. On Wednesday, it was reported that more violence has occurred in the outbreak region, “the Allied Democratic Forces (ADF), a rebel group, attacked two villages near Beni, killing 12 people who live in the heart of the Democratic Republic of the Congo’s (DRC’s) ongoing Ebola outbreak. The terrorists killed nine in Eringeti and three in Oicha, according to Reuters. ADF has not publically pledged allegiance to the Islamic state (ISIL), but that hasn’t stopped ISIL from claiming responsibility for the attacks.” This comes has the World Bank Group announced it would be mobilizing $300 million to help respond to the outbreak. “The US$300 million in grants and credits will be largely financed through the World Bank’s International Development Association (IDA) and its Crisis Response Window, which is designed to help countries respond to severe crises and return to their long-term development paths. The financing package will cover the Ebola-affected health zones in DRC and enable the government, WHO, UNICEF, WFP, IOM and other responders to step up the frontline health response, deliver cash-for-work programs to support the local economy, strengthen resilience in the affected communities, and contain the spread of this deadly virus. This amount is approximately half of the anticipated financing needs of the Fourth Strategic Response Plan (SRP4), which is expected to be finalized in the coming week by the Government and the international consortium of partners working on the response. The World Bank has been supporting programs to combat DRC’s ongoing battle with Ebola since May 2018, with resources going to the frontline response, health system strengthening, and preparedness to reduce the risk of spread.” This outbreak in particular has forced response efforts to change the way we approach not only outbreak control, but also vaccine deployment. “Every aspect of the outbreak is affected by the area’s long history of conflict and trauma. Residents have endured more than two decades of terror from armed groups, along with resource exploitation, political instability and neglect from the world at large. That has bred distrust of authorities — including foreign health workers — and conspiracy theories about why Ebola is thriving. One popular rumour alleges that Ebola responders inject people with deadly substances at treatment centres and vaccination sites. These false ideas have fostered nearly 200 attacks on Ebola responders and treatment centres so far this year, according to the WHO. Seven people have been killed and 58 injured.” You can check the latest case-counts here, which shows now 2,620 cases.
Defense Officials See Increased Threat from Chinese, Russian Chem-Bio Weapons
At a recent CBRN Conference, a hot topic of concern was the threat of Chinese and Russian CBW. In fact – Dr. Kilianski (GMU biodefense professor) spoke on this – “Much attention has been focused on Russia and China’s modernization of their nuclear and conventional forces. But there is growing concern at the Pentagon about those nations’ chemical and biological weapons, U.S. officials said July 23. There is now an increased focus on threats posed by near-peer adversaries, noted Andrew Kilianski, chief intelligence officer at the joint program executive office for chemical, biological, radiological and nuclear defense. ‘They’re in that emerging space … in terms of things we haven’t seen before or things that we don’t have a lot of information on,’ he said during remarks at the National Defense Industrial Association’s annual CBRN Conference and Exhibition in Wilmington, Delaware. The question now is, ‘how do we build capability against a threat space which … we don’t know much about?’ he added”.
DARPA Awards ASU Contract to Build Epigenetic-based WMD Exposure Measurement Tool
For $38.8 million, Arizona State University will get the chance to help build a measurement tool against WMDs. “Arizona State University announced today that it has been awarded $38.8 million by the US Defense Advanced Research Projects Agency (DARPA) to build a field-deployable, point-of-care device that can determine if a person has been exposed to weapons of mass destruction or their precursors, in 30 minutes or less. The grant, which will be funded over four years in phases and options, was awarded under DARPA’s Epigenetic Characterization and Observation (ECHO) program, which aims to identify epigenetic signatures created by exposure to threat agents and to develop technology that performs highly specific forensic and diagnostic analyses to reveal the exact type and time of exposure. ASU said the device it plans to develop will be capable of detecting the health effects of a number of substances associated with weapons of mass destruction — including biological agents, radiation, chemicals, and explosives — from a single drop of blood. The technology could also eventually be used for simple, low-cost monitoring of epigenetic changes to detect a broad range of human diseases.”
Troublesome Ticks: Dispelling Bioweapon Rumors
“A government-owned island used for biodefense testing, a devastating vector-borne disease, and an amendment quietly slipped into major legislation—Although these might sound like scenes from the latest sci-fi movie, they are actually part of a current hot topic that stemmed from some rather poor information. Let’s start from the beginning as we tackle the misinformation circulating in today’s anti-vaccine movement. Plum Island, as idyllic as it sounds, is an island off the coast of Orient Point, New York. Purchased by the US government in the 1950s, it became the home for animal disease research, first for the US Army and then for the US Department of Agriculture. The island is now the site of the Plum Island Animal Disease Center (PIADC), which falls under the Department of Homeland Security (DHS) Science and Technology Office of National Laboratories (ONL). The island allows PIADC to maintain a safe, isolated area to develop biodefense efforts to defend against intentional, accidental, or natural animal diseases like foot-and-mouth (FMD), which can be devastating to cattle. Hundreds of investigators and employees come to the island to work on research, which can include efforts of treatment, diagnostics, vaccines, and bioforensics. Not surprisingly, rumors about the island and its work have swirled for decades. Like all the other biodefense laboratories, it maintains a heavy biosecurity and biosafety culture.”
Stories You May Have Missed:
Highly Resistant Malaria Spreading Rapidly in Southeast Asia – “An aggressive strain of drug-resistant malaria that originated in Cambodia has rapidly spread into neighboring countries, causing high rates of treatment failure to first-line treatment and complicating efforts to eliminate the disease, according to two studies published yesterday in The Lancet Infectious Diseases. One of the studies found that the KEL1/PLA1 strain of Plasmodium falciparum, the parasite that causes malaria, now accounts for more than 80% of the malaria parasites in northeastern Thailand and Vietnam, and has acquired new genetic mutations that have enhanced its fitness and ability to resist treatment. The strain is resistant to dihydroartemisinin-piperaquine, a form of artemisinin-based combination therapy (ACT) that has been the first-line treatment for malaria in Cambodia for more than a decade, and was more recently adopted as the preferred treatment in Thailand and Vietnam.”
Outbreak of Chapare-like Virus in Bolivia– “On June 28, 2019, the Bolivian Ministry of Health received notice of three cases of hemorrhagic fever syndrome. Two additional cases have since been reported. Current evidence suggests that the etiologic agent is Chapare virus or a similar virus, according to the US CDC”.
Summer Workshop on Pandemics, Bioterrorism, and Global Health Security: From Anthrax to Zika
The early-bird registration discount deadline is fast approaching, so make sure you’re signed up for the workshop on all things health security from July 18-20! Whether it’s the 2001 anthrax letter attacks, SARS and avian influenza, Ebola in West Africa, or dual-use research of concern, we’ll be covering it all in this three-day workshop. Where else can you mingle with some of the top minds in the field, engage with other passionate health security professionals, and learn about the latest issues in biodefense?
80,000 Hours Interview With Dr. Tom Inglesby – Careers & Policies That Can Prevent Global Catastrophic Biological Risks
If you’re not listening to the 80,000 Hours podcast, make sure to add it to your list. This is a wonderful podcast on making the right career choices and lucky us, they’re covering global health security jobs. In October, NTI’s Dr. Beth Cameron spoke about fighting pandemics and the challenge of preparing an entire country. Cameron spoke about the current state of American health security, what we’ve learned, new technologies, and more. This week, they spoke with Dr. Tom Inglesby from the Johns Hopkins Center for Health Security on how passionate health security gurus can pursue a career in the field, the top jobs, worrisome scientific breakthroughs, etc. You’ll even catch Dr. Inglesby discuss PhD programs and advisors in the field, in which he names GMU’s very own Dr. Gregory Koblentz! During his talk, Inglesby notes that “I don’t think it’s a good approach to think about it [catastrophic biological risk] as zero sum with other epidemic problems and here’s why: I think in many cases it’s gonna be similar communities that are thinking about these problems. I don’t think it’s likely, even if we really decided to get very serious as a world, I don’t think it’s likely that there will be a community solely dedicated. I don’t want to say never, because it could happen, but I don’t think it’s likely that there will be a robust enduring community of professionals that would only, solely be dedicated to global catastrophic risk, biological risks alone.”
An Afternoon with ASPR – Dr. Robert Korch and Dr. Dana Perkins
GMU Biodefense MS student Anthony Falzarano is reporting on his time at the National Academies monthly series on biological, chemical, and health security issues. “This luncheon – consisting of an open forum session with a two-member panel and a moderator – featured Dr. George W. Korch and Dr. Dana Perkins, both from the Department of Health and Human Services office of the Assistant Secretary for Preparedness and Response (ASPR). Drawing from their current roles with ASPR as well as their illustrious careers and vast experiences, two presenters made for a compelling afternoon discussing health security issues and the work being done by ASPR to prepare for and address them.” Make sure to read his report-out on this luncheon to learn Dr. Korch’s favorite priorities for ASPR!
Chemical Weapons Attack on Douma – Update
Last Saturday, 105 missiles were fired against three Syrian chemical weapons facilities in a joint effort by the U.S., UK, and France. While this is unlikely to have completely removed Assad’s chemical weapons capabilities, many are wondering how effective the airstrike truly is. “‘This is now part of their standard combat doctrine’,” said Gregory Koblentz, a chemical weapons expert at the Schar School of Policy and Government at George Mason University. The attack April 7 that triggered the U.S.-led retaliatory strikes forced the surrender of a rebel group holed up in a suburb of Damascus. ‘It changed the course of battle on the ground,’ Koblentz said.” Social media is also increasingly playing a large role in the U.S. and Russian dialogue of the attacks. “The heavy reliance of President Donald Trump’s administration on publicly available information marks a shift from his predecessor’s, which insisted on obtaining physical evidence of chemical weapons use with an established chain of custody before considering the use of force. It also highlights the difficulties Western intelligence agencies have faced in obtaining such evidence — blood, hair, or soil samples — from the Damascus suburb of Douma in the days following the April 7 chemical weapons attack that left nearly 50 dead and hundreds wounded.” The Director-General of the OPCW (Organization for the Prohibition of Chemical Weapons) recently provided an update on the fact-finding mission (FFM) in Douma, which you can find here. Challenges were found in OPCW actually getting into the site. “The United Nations Department of Safety and Security (UNDSS) has made the necessary arrangements with the Syrian authorities to escort the team to a certain point and then for the escort to be taken over by the Russian Military Police. However, the UNDSS preferred to first conduct a reconnaissance visit to the sites, which took place yesterday. FFM team members did not participate in this visit.On arrival at Site 1, a large crowd gathered and the advice provided by the UNDSS was that the reconnaissance team should withdraw. At Site 2, the team came under small arms fire and an explosive was detonated. The reconnaissance team returned to Damascus.” “The delay in the inspectors’ arrival, 10 days after the attack, will raise fresh concerns over the relevance of the OPCW investigation and possible evidence-tampering. The efforts to investigate the attack, which has been blamed on Bashar al-Assad’s government and sparked a joint operation by the US, Britain and France to bomb chemical weapons facilities near Damascus, has been repeatedly delayed despite Syria’s claim to have established full control over Douma and the surrounding region.” Koblentz notes that “Douma has been completely surrounded by the Syrian government and has been subject to intensive bombardment as part of the regime offensive since February,. The problem is that the territory is now occupied by the Syrian government and the crime scene is no longer secure. It doesn’t lend itself to a credible investigation. It’s like the criminals came back to the scene of the crime and they can do whatever they want with the evidence before the cops show up.”
CRISPR, Avengers, & Super Soldiers, Oh My!
As we get closer to the release of Marvel’s Avengers: Infinity War, discussions about super soldiers and genome editing are growing like a mean, green, fighting machine. A frequent topic of conversation during the December 2017 Meeting of States Parties (at least among the ELBI attendees!), Matt Shearer posed the question – is Captain America a biological weapon? What about the other Avengers though – like Hawkeye, who is one of the few “normal” humans in the group? “Hawkeye’s accuracy with a bow and arrow is heavily dependent on his eyesight, which is clearly more advanced than the average human’s. As far as we know, his genome has not been intentionally altered, leading us to believe that Hawkeye has inherited his extraordinary eyesight from his parents. This theory is strengthened by the fact in the Marvel comic books, Barney Barton, Clint’s brother, is also an accomplished archer thanks to his enhanced vision. Perhaps Hawkeye’s advanced eyesight is the result of thousands of years of genetic evolution in the form of adaptation, genetic drift, or mutation of his ancestor’s DNA.” Writers at Synthego decided to look at which genes would need CRISPR modification to improve vision – like targeting specific opsin genes OPN1SW, OPN1MW, etc.
Survey – Most Americans Favor More Funding to Support Biosecurity Capabilities
A new survey by Alliance for Biosecurity has found that public confidence in US preparedness to address biosecurity has dropped. “Nationally, 73% of the 1,612 Americans surveyed say they would have a favorable reaction ‘if Congress decided to increase the budget this year for developing preventive measures for biological and chemical threats.’ How elected officials act on biosecurity issues is important enough to affect voters at the ballot box, according to the survey. A majority of Americans – 52% – say they are more likely to support their elected representative if that representative is ‘actively engaged in promoting and supporting biosecurity.’ Similarly, 52% say they would become less likely to re-elect a representative who voted AGAINST providing additional funding to the Strategic National Stockpile (SNS) and Biomedical Advanced Research and Development Authority (BARDA). Only 20% say voting against the additional funding would make them more likely to re-elect that representative.” The survey found that only 31% of Americans are confident in our national preparedness, which is a drop from the 50% found in a March 2016 survey.
Curious 2018
Are you planning on being in Germany July 16-18? Don’t miss out on the Curious2018 Future Insight conference in Darmstadt. “The Curious2018 Future Insight conference is a world-renowned event around the future of science & technology and its application to build a better world for humanity. The best minds in science, technology, and entrepreneurship will come together to make great things happen and join forces to realize the dreams of a better tomorrow.” Topics will include healthy lives, materials & solutions, life reimagined (synthetic biology!), vibrant digital, and bright future.
Foodborne Illness Outbreaks – Romaine Lettuce and Eggs
Cobb salads may be taking a beating this week as two main ingredients are setting food epidemiologists into overtime with E.coli and Salmonella outbreaks. Three days ago, it was announced that the source of a 16-state E. coli O157:H7 outbreak, had been identified as a romaine lettuce farm in Yuma, AZ. The CDC recently announced that 53 people have been sickened and the common ingredient amongst them was chopped romaine lettuce, which was traced back to the Yuma region. If that wasn’t bad enough, over 206 million eggs have been recalled across 9 states due to a Salmonella outbreak linked back to eggs from a farm in Hyde County, N.C., and distributed by an Indiana company. “The FDA said the voluntary recall is the result of 22 illnesses reported in East Coast states, which led to extensive interviews and an inspection of the Hyde County farm. The outbreak involves the Salmonella Braenderup subtype. Federal and state officials have been investigating the outbreak since early March.”
Stories You May Have Missed:
Holding Russia Accountable in Salisbury– During this week, the UN Security Council and the Executive Council of the Organization for the Prohibition of Chemical Weapons (OPCW) met to discuss the most recent OPCW findings. Per the U.S. State Department – “The OPCW’s independent report, released last week, confirms the UK lab analysis regarding the identity of the chemical used in Salisbury. We applaud the OPCW’s expeditious support and technical efforts to uncover the facts. We fully support the UK and the need for today’s special meetings of the OPCW Executive Council and the UN Security Council to discuss the chemical weapons attack in Salisbury and the OPCW’s detailed independent analysis.”
Apartment Mice: Harborers of Disease? “In a study today in mBio, the researchers report that a genetic analysis of droppings collected from house mice in New York City detected several types of bacteria capable of causing gastrointestinal disease, including Shigella, Salmonella,Escherichia coli, and Clostridium difficile. They also found genes that confer resistance to fluoroquinolones, beta-lactam antibiotics, and methicillin. Overall, more than a third of mice carried at least one potentially pathogenic bacterium, and nearly a quarter carried at least one antibiotic resistance gene.”
Thank you for reading the Pandora Report. If you would like to share any biodefense news, events, or stories, please contact our Editor Saskia Popescu (biodefense@gmu.edu) or via Twitter: @PandoraReport
Blue Ribbon Study Panel Meeting – Transnational Biological Threats & Global Security
On April 25th, the Blue Ribbon Study Panel on Biodefense will be hosting a meeting regarding transnational biological threats. From 10am to 3pm, you can attend (or watch live!) this event. “Biological threats to the Nation increase continuously, recognizing no borders. As emerging and reemerging naturally occurring diseases continue to spread throughout the world, terrorists continue to pursue biological weapons to add to their arsenal, and nation states are establishing new and reinvigorating old offensive biological weapons programs. This meeting of the Study Panel, chaired by former Senator Joe Lieberman and Governor Tom Ridge, will provide the Study Panel with a better understanding of: Current transnational biological threats, Homeland defense and security in the global context, Global security efforts to combat these threats, International public health security efforts; and the need to elevate global health security as a national and global priority”.
Who Owns Smallpox?: The Nagoya Protocol and Smallpox Virus Retention
This week the Center for the Study of WMD held a talk on smallpox stockpiles. Spotlight speaker Michelle Rourke discussed her article regarding the convention on biological diversity and the Nagoya Protocol. If you missed the event, GMU biodefense graduate student Morasa Shaker was able to attend and has provided a detailed account of the day. “While the case can be made that endangered species pose an intrinsic value to the world’s genetic diversity, it is has proven less feasible to make the same case for a virus, specifically the variola virus—the causative agent of smallpox. Nevertheless, Michelle Rourke, a Fulbright scholar at Georgetown University’s O’Neill Institute for Domestic and Global Health Law, led an in-depth educational seminar organized by the Center for the Study of Weapons of Mass Destruction to support that very case—the smallpox virus is worthy of our conservation efforts.”
Controlling Dangerous Biological Research
Filippa Lentzos is asking a question we’ve been trying to avoid for a while – how can we control biological research that is inherently dangerous? The desire to advance technologically and in the life sciences pushes researchers and defense programs to invest in biological sciences, like synthetic biology. Just as we make gains in such research, we also worry that adversaries could use the same technologies against us. “Washington, Moscow, and other governments say they are focused only on ‘defensive’ biosecurity activities, but there is a fine line between ‘defensive’ and ‘offensive’ in this realm, and the alarming military focus on synthetic biology may cause people to wonder if there is some way to control the weaponization of biology.” Lentzos calls upon the international community to face the monster head on – let’s discuss how to address biological research that pushes the boundary of defense into offense. “To accomplish any of this, we have to be able to both characterize and evaluate biological research with high misuse potential. This is exceptionally difficult to do, and continues to elude both the international community and national policymakers.” Lentzos points to the horsepox synthesis experiment as a good example of the failures that occurred along the way and that ultimately, risk-benefit analysis is the wrong approach to biosecurity review. “Good security rests not on evaluating risks and benefits, but rather on managing uncertainty, ambiguity, and ignorance—sometimes even situations where we don’t know what we don’t know. Standard risk-benefit calculations are the wrong approach to evaluating biological research with high misuse potential.”
HHS Large-scale Exercise Moving Highly Infectious Patients
How do you transport a highly-infectious patient? The care of Ebola patients in the United States during the 2014/2015 outbreak highlighted the challenges of moving such patients to regional treatment centers. HHS sponsored a large-scale exercise that took place this week, with a hot-wash today. “The exercise focuses on moving seven people acting as patients with Ebola symptoms in different regions of the country. The patients, including one pediatric patient, first present themselves at one of the following healthcare facilities: CHI St. Luke’s Health-The Woodlands Hospital in The Woodlands, Texas; Medical University of South Carolina in Charleston, South Carolina; Norman Regional Hospital in Norman, Oklahoma; St. Alphonsus Regional Medical Center in Boise, Idaho, and St. Luke’s Regional Medical Center in Boise, Idaho.At each facility, healthcare workers will collect and ship samples for diagnostic tests to state laboratories, which in turn will practice running the necessary laboratory tests to diagnose the patients with Ebola. As part of the exercise, each patient will receive a positive diagnosis. Using appropriate isolation techniques and personal protective equipment, health care workers then must take steps to have six of the patients transported by air to designated Regional Ebola Treatment Centers. These patients will be placed into mobile biocontainment units for these flights. The pediatric patient will be placed into protective equipment and transported by ground ambulance.” The drills will also involve several airports, which include LAX, Charleston International, etc.
NASEM Bio, Chem, and Health Security Luncheon: April
Don’t miss the National Academies-hosted lunch today from noon to 1:30PM EDT. “April’s event features features George Korch, Senior Science Advisor to the Assistant Secretary for Preparedness and Response (ASPR) in the Department of Health and Human Services and Dana Perkins, Senior Science Advisor in ASPR’s Office of Policy and Planning. Dr. Korch will discuss recent developments and ASPR strategic priorities in support of the Public Health Emergency Medical Countermeasures Enterprise (PHEMCE). Dr. Perkins will talk about implementation of the recommendations arising from the Federal Experts Security Advisory Panel (FESAP) and current activities for 2018. This event is free and open to the public, but you must register to attend. This event will not be webcast, and a summary will not be provided after the fact, so please register to attend in person if you are interested! A light lunch and beverages will be provided for all attendees.”
Cyberbiosecurity – A New Way To Protect The Bioeconomy and Gene Editing for Good
How can we better ensure cybersecurity and biosecurity? Researchers are bringing forth this emerging hybrid field that we should be giving more attention to. Life sciences and biotech are heavily engrained in cyber systems. Consider 3-D printing, personalized genomics, medical labs and surgical robots, etc. “We propose ‘Cyberbiosecurity’ as an emerging hybridized discipline at the interface of cybersecurity, cyber-physical security and biosecurity. Initially, we define this term as ‘understanding the vulnerabilities to unwanted surveillance, intrusions, and malicious and harmful activities which can occur within or at the interfaces of comingled life and medical sciences, cyber, cyber-physical, supply chain and infrastructure systems, and developing and instituting measures to prevent, protect against, mitigate, investigate and attribute such threats as it pertains to security, competitiveness and resilience’.” Promoting this field and strengthening educational strategies is key to inform people on cyberbiosecurity and ensure a trajectory that can be supported. How do we move cyberbiosecurity forward though? “Academia, industry, government or non-profits (including policy, regulatory and legal experts) need to begin to learn to communicate with and educate each other, harmoniously identify and develop priorities, opportunities and specify ‘next steps.’ A major opportunity exists right now to propose a unified structure and common vernacular. Lastly, while definition and assemblage of Cyberbiosecurity is occurring, national or international strategies should be pursued to harmonize the emerging enterprise and foster measurable value, success and sustainability.” As the talks surrounding cyberbiosecurity grow, it’s hard not to consider some of the technologies we’re discussing and their potential. Bill Gates recently wrote for Foreign Affairs regarding the good that CRISPR could do. “the next decade, gene editing could help humanity overcome some of the biggest and most persistent challenges in global health and development. The technology is making it much easier for scientists to discover better diagnostics, treatments, and other tools to fight diseases that still kill and disable millions of people every year, primarily the poor. It is also accelerating research that could help end extreme poverty by enabling millions of farmers in the developing world to grow crops and raise livestock that are more productive, more nutritious, and hardier. New technologies are often met with skepticism. But if the world is to continue the remarkable progress of the past few decades, it is vital that scientists, subject to safety and ethics guidelines, be encouraged to continue taking advantage of such promising tools as CRISPR.” Gates points to several avenues for good – feeding the world, ending malaria, etc. He also notes though that there are legitimate questions regarding the potential for misuse and risks, and that regulations for genetic engineering are decades old and need revision to remain applicable. Part of the process for truly utilizing CRISPR is also to responsibly assess risks and communicate openly.
3MT Competition
The George Mason University 3-Minute Thesis competition took place this past weekend and we’d like to congratulate Biodefense PhD student Chris Brown on his participation in this exciting event! He was one of ten finalists who competed to explain their dissertation to a non-specialist audience in 3 minutes. Chris described his dissertation regarding protecting critical workers against emerging infectious diseases – “Many different types of workers, including those who provide essential services the rest of us frequently depend on, are at risk of exposure to emerging infectious diseases that spread through the general population. Although many factors play into these types of workers being exposed on the job, protective gear—equipment like gloves, gowns, goggles, and respirators—is an essential part of infection prevention programs aimed at keeping workers healthy. During recent outbreaks, the public health enterprise has tended toward reinventing guidelines for each new infectious disease we face. That can lead to confusion about what guidelines for worker protection should be followed, as well as delays in implementing protective measures as science works to understand the disease agent and its transmission mechanisms. Pivoting toward a system based on worker exposures associated with various job tasks instead of one built around accurately characterizing transmission routes, my research offers a guideline for protective gear that is applicable to a wide range of diseases and that can be used as soon as outbreaks begin. It serves as an off-the-shelf solution for worker protection until empirical evidence supports using disease-specific infection prevention practices.”
Stories You May Have Missed:
In Pictures: Decades of Navy Efforts To Combat Malaria – “Malaria is ranked by the Department of Defense as the number one infectious disease threat to military personnel deployed to areas where malaria is endemic. This includes countries spanning the tropical and subtropical regions of the world, including most of sub-Saharan Africa and larger regions of South Asia, Southeast Asia, Oceania, central Asia, the Middle East, Central and South America and the Caribbean.”
Thank you for reading the Pandora Report. If you would like to share any biodefense news, events, or stories, please contact our Editor Saskia Popescu (biodefense@gmu.edu) or via Twitter: @PandoraReport
Nerve agent attacks, horsepox synthesis, and funding global health security, oh my! On top of all the biodefense news we’ve got in store for you this week, we’re also thoroughly excited to announce the 2018 summer workshop on pandemics, bioterrorism, and global health security.
Summer Workshop on Pandemics, Bioterrorism, and Global Health Security – From Anthrax to Zika
We’re delighted to release the dates for the summer workshop on all things global health security. The recent publication of the horsepox synthesis study, uncertain future of U.S. investment in global health security, and a severe flu season, are just a handful of the topics we’ll be addressing in this three-day workshop from July 18-20, 2018. Did I mention that it’s also the centennial of the 1918/1919 pandemic? We face unprecedented microbial challenges in this modern age – whether it be the risk of nefarious actors misusing genome editing, antimicrobial resistance, or the speed at which a disease can circumvent the globe. Our workshop is the perfect place to learn from experts in the field and meet with a diverse group of fellow biodefense gurus. If you register before May 1st or are a returning member or GMU alum, you can even get a discount! From anthrax to Zika, our July workshop is the place to be for all things health security.
The Herculean Challenge of Assessing the De Novo Synthesis of Horsepox
Nine-headed Hydra or cleaning out the Augean stables? None of these tasks were particularly easy, and neither is truly assessing the risks and benefits of the recent horsepox synthesis. Two of the latest articles analyzing the implications of this research have been released this week in mSphere. In the editorial, Michael J. Imperiale points to the increased attention on DURC and the debate surrounding the benefits of a new vaccine versus the potential for a nefarious actor to misuse the process. “The two articles posted today come from Gregory Koblentz at George Mason University, who argues that this work was poorly justified on two fronts, scientifically and commercially, and from Diane DiEuliis and Gigi Gronvall from National Defense University and the Center for Health Security at Johns Hopkins University Bloomberg School of Public Health, respectively, who discuss this study in the larger context of how the risks and benefits of dual use research are assessed and managed. (mSphere asked the leadership of Tonix to submit a manuscript, but we received no response.)” Koblentz first underlines the weak scientific foundation for the claim that the horespox synthesis aids in the development of a new smallpox MCM. He states that the “combination of questionable benefits and known risks of this dual use research raises serious questions about the wisdom of undertaking research that could be used to recreate variola virus.” Within his commentary, Koblentz addresses the scientific and commercial rationale for synthesizing the virus as well as the weak scientific basis for its use as a safer alternative for human vaccine use and the lack of demand for a new smallpox vaccine. “At the heart of the dual use research dilemma is the need to assess and balance the benefits and risks presented by an experiment or line of research. This is a difficult task given the largely theoretical risks posed by unknown adversaries in the future and the enticing yet uncertain benefits that the research may eventually yield. Indeed, measuring risks and benefits and weighing them can be a wicked problem that defies simple or straightforward conclusions. The difficulty of the task, however, does not excuse researchers, funders, or journal editors from trying to do so. While the benefits of biotechnology and life sciences research are beyond question, we should not take for granted the benefits of specific experiments or avenues of dual use research.” In their counterpoint article, Diane DiEuliis and Gigi Kwik Gronvall emphasize that the horsepox researchers went through due biosecurity diligence at their research institution, the importance of utilizing an analytical framework for assessing the risks and benefits of DURC, and discuss “relevant components of biosecurity policy and the biodefense enterprise (including the acquisition of medical countermeasures) in the United States.” DiEuliis and Kwik Gronvall point to the horespox synthesis (and the controversy) as an opportunity to evaluate how dual-use risks should be handled, the complicated approach to stockpiling MCM, and “the challenges of forecasting risks and benefits from a particular scientific discovery or technology”. They highlight the National Academies Imperiale report framework for evaluating the capacity for technology to be misused, which includes factors like weighing the use of the technology itself against consequence management, etc. They also note three issues that have been raised by the horespox paper that require additional consideration – “The decision of what to do with a technology or research area that is dual use cannot be black or white, MCMs cannot be a check-the-box procedure for the USG, The synthesis of and booting up of a pathogen should serve as strategic warning that current biosecurity controls and preparedness are insufficient.” DiEuliis and Kwik Gronvall note that “Now that the work has been published, the authors examined the research according to the Imperiale report framework, which aims to provide a systematic way to evaluate biosecurity risks. We again found that while dual use information would benefit highly experienced actors who are intent on misuse, the recreation of smallpox virus may require additional research and development steps than have been described in this publication: smallpox virus is less similar to horsepox virus than horsepox virus is to vaccinia virus, the tools to recreate horsepox virus were originally developed for vaccinia virus, and they might require additional troubleshooting for re-creation of smallpox virus.”
NTI Launches GHS Video: Act Now to Protect U.S. Investment in Global Health Security
The Nuclear Threat Initiative (NTI) has launched a new video urging Congress to act now and ensure funding for global health security. Dr. Elizabeth Cameron, NTI VP, global biological policy and programs, is spear-heading the endeavor to turn the tides and ensure sustained funding for global biodefense. “Without sufficient funding of $208 million a year for the Center for Disease Control (CDC) and $172 million a year at the United States Agency for International Development (USAID), we weaken the global network of protection, increase risk to American lives, and threaten investments from other governments and the private sector. Urge Congress to act now to provide sustained funding for global biodefense.” Cameron notes that “in response to the devastating Ebola crisis of 2014, the United States Congress authorized over $900 million in supplemental funding to support the Global Health Security Agenda (GHSA) for five years to help countries prepare for and address biological threats. This critical funding runs out at the end of fiscal year 2019, placing up to 80% of our global health security efforts abroad – offices, personnel, and programs – at risk. Also at risk? U.S. health security and extended biodefenses. Without sufficient funding of $208.2 million a year for the Center for Disease Control (CDC) and $172.5 million a year at the United States Agency for International Development (USAID), we weaken the global network of protection, increase risk to American lives, and threaten investments from other governments and the private sector.”
Ominous Biosecurity Trends Under Putin
If you ever needed a reminder of the importance of investing in global health security, this just might provide that cold dose of reality. The latest book from Raymond Zilinskas and Philippe Mauger, Biosecurity in Putin’s Russia, assesses Russia’s actions regarding DURC and biosecurity measures. “They investigate — solely through open sources — the current Russian position. They especially dig into issues such as ‘genetic weapons’ (bioweapons aimed at damaging DNA, potentially of specific individuals or groups) and biodefence research. Their underlying intention throughout seems to be to examine the likelihood that the Russian government is itself willing to engage in banned activities related to biowarfare agents. The book thus becomes a technical-scientific detective story.” This is an in-depth analysis by two top biological weapons specialists – definitely worth the read!
Netflix Documentary – Rajneesh Salad Bar Bioterrorism
Get ready for some Netflix and nerdom on March 16th as the documentary on the largest bioterrorist attack in the United States is released. “In 1984, more than 700 people in The Dalles, OR, contracted Salmonella infections after followers of Rajneesh sprinkled the pathogen on salad bar ingredients in 10 local restaurants. The action was an effort to swing the results of an election.” Don’t miss out on the biosecurity twitter activity during a virtual viewing party – @pandorareport!
#NoImpunity: Will The Newest International Effort to Stop Chemical Attacks in Syria Succeed?
How can we stop the use of chemical weapons if there is no authority on attribution? GMU professor Gregory Koblentz is delving into the latest strategy to hold the Assad regime accountable for their continued use of chemical weapons. Between Russian vetoes that halt OPCW efforts and the death of the Joint Investigation Mechanism, many worry that the lack of punishment will encourage further CW use by the Assad regime. “To fill this gap in the global anti-chemical weapon architecture, France launched an international initiative in January to pressure the Assad regime to halt its use of chemical weapons. The Partnership Against Impunity, which uses the hashtag #NoImpunity on Twitter, is a group of 25 countries motivated by the twin goals of deterring future chemical attacks and bringing to justice the perpetrators of past attacks.” Sure, the sanctions by some of these countries are ultimately more symbolic than behavior-changing, but they are now infusing a dose of public shaming into the mix. “First, by curating a public database that lists all of the front companies and procurement agents used by the SSRC, the Partnership Against Impunity makes it easier for other countries and companies around the world to avoid doing business with Syria’s chemical weapons program. While sanctioning these shadowy companies and middlemen is like playing ‘whack-a-mole,’ it is an essential element of preventing Syria from rebuilding the capabilities that the OPCW destroyed after Syria joined the Chemical Weapons Convention.” The Partnership Against Impunity is also laying “the groundwork for future prosecutions of military officers and government officials who engaged in war crimes” and establishing a “concrete manifestation of the noble goal enshrined in the preamble of the Chemical Weapons Convention ‘to exclude completely the possibility of the use of chemical weapons’.”
Assessing CRISPR – The Dread And the Awe
Genome editing is a hot topic – both in terms of future possibilities, but also potential peril. GMU biodefense professor Sonia Ben Ouagrham-Gormley and doctoral student Saskia Popescu are teaming up to review two new books on this gene editing technology. First, A Crack in Creation by Jennifer Doudna, one of CRISPR’s creators, who discusses the revolutionary marvel with a mixture of hope and dread. “Doudna became aware of this paradox soon after publishing the seminal 2012 article that announced her discovery. She was surprised and delighted by the technology’s rapid spread and its use in a variety of fields, yet some applications—such as the use of Crispr to edit human embryos, as performed for the first time by Chinese scientists in 2015—made her uneasy about the future of the technology. Unscrupulous individuals’ interest in using Crispr for pure profit made her uneasy as well.” Next, Modern Prometheus by computational biologist and freelance writer, Jim Kozubek. “He ponders the power of genetic manipulation as a gateway to the dehumanization of medicine and the objectification of human beings. Kozubek draws comparisons with ‘Jurassic Park’ and Mary Shelley’s Frankenstein to pose larger questions about genetic engineering—and also to point out that, though people are fascinated with technological advances, they often neglect to consider technologies’ implications, notably on people themselves.”
The U.S. and Global Health Security At A Time of Transition
The Kaiser Family Foundation will be hosting this free event on Monday, March 12th from 2-3:30pm EDT at the Kaiser Family Foundation Barbara Jordan Conference Center in Washington, D.C. This event will seek to explore the future of U.S. global health security efforts, what role the U.S. will play in the future of the GHSA, and more through a panel of experts. “Jen Kates, Vice President and Director of Global Health and HIV Policy, will provide opening remarks, and Anne Schuchat, Acting Director, Centers for Disease Control and Prevention (CDC), will give a keynote address on U.S. global health security efforts. Josh Michaud, Associate Director of Global Health Policy at the Kaiser Family Foundation, will moderate a follow up discussion with Beth Cameron, Vice President for Global Biological Policy and Programs at the Nuclear Threat Initiative (NTI); Rebecca Katz, Associate Professor and Co-Director of the Center for Global Health Science and Security at Georgetown University; Nancy Knight,Director of the Division of Global Health Protection at CDC; and J. Stephen Morrison, Senior Vice President and Director of the CSIS Global Health Policy Center.”
New Paradigms for Global Health: Building Capacity through Science and Technology Partnerships
The American Association for the Advancement of Science and Hitachi Ltd. will be hosting this event on March 21st from 11:30am-12:30pm at the AAS headquarters in New York City. “Why are science and technology partnerships — and science diplomacy — more critical to global health than ever before? Jimmy Kolker, former U.S. ambassador to Uganda and to Burkina Faso and the Obama Administration’s chief HHS health diplomat, offers a practitioner’s perspective on new ways of integrating and advancing global health science, security, and assistance. Public-private and technical partnerships can enable the best experts to build sustainable capacity in low- and middle-income countries, strengthening global health science, policy, systems, and delivery.”
Stories You May Have Missed:
The Troubling Truth About Medicine’s Supply Chain – Maryn McKenna (author of Big Chicken and all around global health guru) is lifting back the curtain on the painful reality that is America’s hospital supply chains. While not something the public generally considers, it’s something we need to start fixing. “Missing IV bags and missing pharmaceuticals seem like unrelated problems, a temporary disruption layered on top of a longstanding problem. But in fact, they are unavailable for the same reason. The United States has allowed the manufacturing of most of its drugs and medical devices to drift offshore, at the end of long, thin supply chains.”
Thank you for reading the Pandora Report. If you would like to share any biodefense news, events, or stories, please contact our Editor Saskia Popescu (biodefense@gmu.edu) or via Twitter: @PandoraReport
Welcome back to your weekly dose of all things biodefense! We’ve got a packed newsletter for you, so buckle up. Curious about CRISPR and how it works? Check out the best and worst analogies here.
Read Out On The GHSA Ministerial Meeting in Kampala
If you missed our Read-Out on the GHSA meeting in Kampala, we’ve got a great overview with attachments. The NextGen Global Health Security Network Reflections can be found here and Coordinator Jamechia Hoyle was kind enough to provide her powerpoint from the Read-Out, which you can access here. The Read-Out involved presentations and discussions from not only NextGen GHSA Coordinator Hoyle, but also Jennifer Nuzzo from the Center from Health Security, and two GMU Biodefense MS students – Anthony Falzarano and Stephen Taylor. In fact, Anthony and Stephen provided several great photos from the Kampala summit, which you can see here. “While they discussed that the dialogue was driven by high level members of government. The overall consensus was the need to bring in non-governmental and academic voices. The panel members emphasized this by showcasing the work with Next Generation Global Health Security Leaders and the continued efforts to bring young professionals and students into these working groups. From the discussion, it is evident that GHSA’s efforts are being felt in many nations. The Response Center in Uganda, while small, had the hallmarks of the CDC and other organizational support.” Dr. Nuzzo brought her talk to a close with a poignant quote from the summit – “it is much cheaper to spend on preparedness than it is to spend on response.” Attendee and biodefense MS student Janet Marroquin noted that “the containment of the Marburg virus in Uganda during the conference perfectly illustrated the benefits of improved health security measures, but it is easy to overlook this success when good health is expected as a guarantee. In addition to bringing attention to current deficiencies in global health security, the GHSA is needed to look to the future and anticipate and prevent roadblocks in implementation.”
Biological Weapons Convention Meeting of States Parties – Recap
Last week, GMU biodefense PhD student Saskia Popescu attended the Biological Weapons Convention Meeting of States Parties (MSP) with the Johns Hopkins Center for Health Security ELBI program. This MSP started on somewhat of a bated breath as last year’s Review Conference was, as described by many, an epic failure. Having endorsed the Joint NGO Statement, Popescu noted that “the role of the NGOs felt even more important in such a disjointed climate where the future of the BWC was in many ways, up in the air. The importance of support and pushing for future cohesion regarding not only the intersessional process (ISP), but also S&T developments, was a significant point within the NGO statement.” As you can find in many of the live-tweeting that was occurring (#MSP2017), the MSP started off with a bang as Iran noted that they were not convinced further ISP work would be productive and if the BWC isn’t legally binding, it can’t truly be universal. Chairman Gill started the MSP with a quote from Rumi and worked tirelessly to maintain focus and forward momentum. Thankfully, despite several days of closed-door discussion, consensus was reached and the ISP was established to include 4 days of meetings of the MSP and 5 meetings of experts, which would focus on cooperation and assistance, development S&T, strengthening national implementation, assistance for preparedness and response, and the institutional strength of the BWC. You can also find detailed overviews of each day here. A few of Popescu’s favorite moments from attending: “Sweden’s inclusion of antimicrobial resistance in their opening statement, Australia’s comments on the need for a more diverse attendance in the future and the growing presence of women within the BWC. It was also surprising how shockingly low the states costs for BWC inclusion are…and how some are delinquent by a few hundred dollars. Lastly and perhaps the most important part of the trip was getting to attend a pivotal event in biodefense history with such an amazing group of people who were all as excited and enthusiastic as I was. As we took a break to visit the WHO and peered upon the famous smallpox statue, I think it all hit us how vital this work is on a global level.”
Jurassic Ticks?
Paleontologists have recently announced the finding of a 99-million-year-old tick that not only was holding on for dear life within the feathers of a dinosaur, but provides evidence that these blood-suckers fed on dinosaurs. While this tick came from the Cretaceous period, it feels eerily similar to how Jurassic Park began. “This study provides the most compelling evidence to date for ticks feeding on feathered animals in the Cretaceous,” said Ryan C. McKellar, a paleontologist at the Royal Saskatchewan Museum in Canada who was not involved in the study. “It demonstrates just how much detail can be obtained from a few pieces of amber in the hands of the right researchers.” Imagine the kind of dino-arboviruses we might come across with this finding! It’s hard not to chuckle at the timing of the announcement since the latest Jurassic World movie trailer was released just last week.
Podcast “Syria(s) Problem: Chemical Weapons & International Norms from Power Problems“
Don’t miss this episode of the bi-weekly podcast Power Problems from the Cato Institute hosted by Emma Ashford and GMU biodefense professor Trevor Thrall. In this episode on the use of chemical weapons in Syria, GMU biodefense professor and graduate program director Gregory Koblentz discusses how the use of such weapons calls into question the utility of international norms. Some of the show notes also include the discussion of taboos against chemical weapons, and antibiotic resistance as a biological threat.
Is North Korea’s Bioweapons Threat Growing With Increasing Biotech Expertise?
Are the technical hurdles to biological weapons eroding in North Korea? Advances in the life sciences have brought forth a wealth of new capabilities, like manipulating DNA, but are we also lowering the bar for bioweapons development? There’s been increasing talk regarding the potential for North Korea to develop and deploy biological weapons. While there certainly has been a lowering of technical hurdles in some aspects of bioweapons development, has North Korea truly developed a functioning program? “The gains have alarmed U.S. analysts, who say North Korea — which has doggedly pursued weapons of mass destruction of every other variety — could quickly surge into industrial-scale production of biological pathogens if it chooses to do so. Such a move could give the regime yet another fearsome weapon with which to threaten neighbors or U.S. troops in a future conflict, officials and analysts say. Current and former U.S. officials with access to classified files say they have seen no hard evidence so far that Kim has ordered production of actual weapons, beyond samples and prototypes. And they can only speculate about the reasons.” Many note that their possession of biological agents is known but that the unknown is just how far along a bioweapons program might be. The development of a high-functioning and successful bioweapons program requires significant funding, human resources, and tacit knowledge. Dr. Sonia Ben Ouagrham-Gormley recently broke down just how realistic these concerns are (hint: she’s a GMU biodefense professor and guru on tacit knowledge). In response to this week’s increased attention on a potential program in North Korea, Dr. Ben Ouagrham-Gormley was also interviewed regarding the cost of a biological weapons program and just how much it would take to truly develop and maintain one. “The cost of maintaining an active biological weapons program is high, according to Sonia Ben Ouagrham-Gormley, associate professor in the Schar School of Policy and Government at George Mason University. She said the Soviet Union spent ‘several billion dollars’ on its program, while terrorist group Aum Shinrikyo spent about $10 million, though the latter ‘failed at every step.’ The United States spent about $700 million on its program, which was active over the course of roughly 27 years. ‘The challenge is in acquiring the expertise to handle and manipulate living organisms that are fragile and unpredictable: that requires time and a work organization that ensure continuity and stability of work,’ Ben Ouagrham-Gormley said. ‘These are conditions that are difficult to maintain in a covert program. That’s why most covert bioweapons programs have failed thus far’.”
Global Health Security and the US Export Economy
It’s easy for many to think that outbreaks only impacts public health, but the truth is that the effects of health security threats are felt across many sectors and industries. The export economy is not immune to disruption should there be a public health emergency. A recent study reviewed economic vulnerability to the US export economy that would be impacted by disruptions in 49 countries. These 49 countries are currently being targeted by the CDC and partners to improve capabilities to prevent/respond to public health infectious disease threats throughout laboratories, workforce, surveillance, and response systems. Enhancing global health security by strengthening the country capacity is the goal for these 49 countries. “US exports to the 49 countries exceeded $308 billion and supported more than 1.6 million jobs across all US states in agriculture, manufacturing, mining, oil and gas, services, and other sectors. These exports represented 13.7% of all US export revenue worldwide and 14.3% of all US jobs supported by all US exports. The economic linkages between the United States and these global health security priority countries illustrate the importance of ensuring that countries have the public health capacities needed to control outbreaks at their source before they become pandemics.” The numbers are startling, especially if you consider that the 2002-2003 SARS epidemic was estimated to have a global economic impact of almost $40 billion USD. The total value of US material goods/services exported to all countries was estimated to be $2.3 trillion in 2015. The findings of this study point to the significant economic disruption that would occur if a health security event occurred in one of these 49 countries. Global health security is truly an investment that provides a return, as we know that an outbreak anywhere is an outbreak everywhere.
Cyberbiosecurity: DNA Has Gone Digital – What Could Possibly Go Wrong?
As biotechnology and biology go full-steam ahead, there is increasing use of technology and informatics databases to support such innovation. Where does that leave us in terms of cybersecurity? Coined as “cyberbiosecurity”, many in the field, like Colorado State University’s Jean Peccoud, are drawing attention to the risk this new frontier has for researchers, industry, and the government. Peccoud and his colleagues point to the potential for accidental or intentional breaches, noting that “In the past, most biosecurity and biosafety policies were based on sample containment,” Peccoud says. “Now, it’s so easy to read DNA sequences, for example, or to make DNA molecules out of sequences publicly available from bioinformatics databases. Most projects have a cyber dimension, and that introduces a new category of risk.” Traditional biosecurity efforts focus on containment of the organism from accidental or nefarious use, but that doesn’t really focus on the computational aspect of new biotech, like synthetic biology. “The authors recommend employee training, systematic analyses to examine potential exposure to cyberbiosecurity risks, and the development of new policies for preventing and detecting security incidents. ‘Once individuals in a community are aware of cyberbiosecurity risks, they can begin to implement safeguards within their own work environments, and work with regulators to develop policies to prevent cyberbiosecurity breaches,’ they write.” Peccoud also pointed to the potential for computer viruses to impact the physical world. Citing the 2010 computer virus that caused equipment failure at an Iranian nuclear plant, such malware could result in biological outcomes that could be dangerous. It doesn’t take much of a venture down the rabbit hole to think about the automated processes that are used in laboratories, especially high-containment labs, and how they could be damaging if commandeered for nefarious purposes. So what can be done? The first step is truly recognizing the threat – “The threats are bidirectional. And not all cyberbiosecurity threats are premeditated or criminal. Unintentional errors that occur while translating between a physical DNA molecule and its digital reference are common. These errors might not compromise national security, but they could cause costly delays or product recalls.” Synthetic biology and biotech have taken us to places we would’ve never dreamed of, but it’s critical that the ability to manipulate DNA be protected through proper measures and we protect the digital components as well. The growing attention to cyberbiosecurity also comes at a time when the FDA has issued a warning on DIY gene therapy, noting that “the sale of these products is against the law. FDA is concnered about the safety risks involved.” “Last month, Josiah Zayner, CEO of The Odin, which sells DIY biology kits and supplies through its website, posted a video in which he injected himself with the gene-editing tool CRISPR during a biohacker conference in California. That video has been viewed more than 58,000 times on YouTube. In its statement, which FDA Commissioner Scott Gottlieb tweeted on November 21, the same day it was posted to the agency’s website, the regulator took aim directly at companies selling CRISPR supplies intended for self-administration.”
Biodosimetry: A Future Tool for Medical Management of Radiological EmergenciesHow can we better manage patients in radiological emergencies? GMU biodefense PhD student Mary Sproull and professor/graduate program director Gregory Koblentz are looking at biodosimetry as a medical management tool for this very predicament. “The field of radiation biodosimetry has advanced far beyond its original objectives to identify new methodologies to quantitate unknown levels of radiation exposure that may be applied in a mass screening setting. New research in the areas of genomics, proteomics, metabolomics, transcriptomics, and electron paramagnetic resonance (EPR) applications have identified novel biological indicators of radiation injury from a diverse array of biological sample materials, and studies continue to develop more advanced models of radiation exposure and injury. In this article, we identify the urgent need for new biodosimetry assessment technologies, describe how biodosimetry diagnostics work in the context of a broad range of radiation exposure types and scenarios, review the current state of the science, and assess how well integrated biodosimetry resources are in the national radiological emergency response framework.”
Fellowship in Grand Strategy, Security, and Statecraft
The International Security Program of Harvard Kennedy School’s Belfer Center for Science and International Affairs and the MIT Security Studies Program at the Center for International Studies in the School of Humanities, Arts, and Social Sciences are launching a collaborative program to mentor the next generation of foreign policy scholars. The Project on Grand Strategy, Security, and Statecraft is made possible with support from the Charles Koch Foundation: a $1,846,200 grant to MIT and one for $1,853,900 to Harvard Kennedy School (HKS). Those interested in this fellowship should apply to the International Security Program Fellowship when the Belfer Center’s online application system becomes available on December 15, 2017. Those desiring to apply before then may apply through MIT’s application system. For more information, click here.
National Academies Publication – Combating Antibiotic Resistance
The National Academies has released their latest report on a one health approach to the global threat that is antimicrobial resistance. “As of 2017, the emergence and spread of antimicrobial resistance continues unabated around the world, leaving devastating health and economic outcomes in its wake. Those consequences will multiply if collaborative global action is not taken to address the spread of resistance. Major drivers of antimicrobial resistance in humans have been accelerated by inappropriate antimicrobial prescribing in health care practices; the inappropriate use of antimicrobials in livestock; and the promulgation of antibiotic resistance genes in the environment.” The report focuses on the global momentum to counter AMR, microbial movements across the one health domain, utilization of social and behavioral sciences to combat AMR, R&D, and strengthening partnerships and international cooperation. AMR is a multi-sectoral, international problem that requires a One Health approach to combat it – reports like these are a critical step towards combatting AMR
Boston University’s Needle Gets the Greenlight After years of controversy and $200 million in federal funds spent on a BSL 4 high-containment lab, the Boston University Lab “The Needle” is finally opening. Located in the heart of the city, local citizens raised substantial opposition over biosafety concerns for the neighboring areas. It’s taken nearly a decade to get to this point, but the Boston Public Health Commission gave the official greenlight for the lab to open. “The commission’s OK was the final step allowing the study of Biosafety Level 4 pathogens — those that have no treatment or vaccine, such as Ebola. Level 4 research could begin in a month or two at the facility, called the National Emerging Infectious Disease Laboratories. Facing fierce opposition from neighbors and others concerned that dangerous germs would escape, the biolab underwent more than a dozen years of risk assessments, public hearings, and failed lawsuits. It received more than 50 permits and approvals from federal, state, and city agencies, most recently passing muster a year ago with the US Centers for Disease Control and Prevention.”
Doreen and Jim McElvany Nonproliferation Challenge
To advance this goal, the Doreen and Jim McElvany Nonproliferation Challenge will recognize the most outstanding new ideas and policy proposals published in Volume 25 (2018) of the Nonproliferation Review. The Challenge will award a grand prize of $5,000, a $3,000 runner’s-up prize, and a $1,000 honorable mention prize. The deadline to submit is 11:59 pm/EST, July 6, 2018. However, due to the limited number of pages that we can publish in a single volume, eligible articles will be accepted for publication on a rolling basis. We therefore encourage interested authors to submit early. Decisions on the winners of the scholarly award will be announced in early 2019
Stories You May Have Missed:
Most Americans Think A Zombie Pandemic Is Likely – We recently stumbled across this survey and were surprised to find that while a surprisingly high number of Americans think a zombie plague is going to happen, few are prepared for it. “Only 9% of respondents considered it likely that undead zombies might ever walk the earth. Nearly three times that many respondents (28%) consider it likely that a worldwide epidemic of a neurological disease that makes people more aggressive and likely to lose control of their thoughts and motor functions.”
Thank you for reading the Pandora Report. If you would like to share any biodefense news, events, or stories, please contact our Editor Saskia Popescu (biodefense@gmu.edu) or via Twitter: @PandoraReport
Reflections from the GHSA Ministerial Meeting in Kampala, Uganda
The recent GHSA Ministerial Meeting was not only a success, but also reaffirmed the importance of the agenda and those dedicated to combatting health security threats. We’re excited to provide you with a series of on-the-ground reflections from those who participated through the George Mason Global Health Security Ambassador Fellowship and the Next Generation Global Health Security Network. Within these reflections, you’ll get to hear from Next Generation Coordinator Jamechia D. Hoyle and a wonderful array of international students and professionals. Hoyle notes that “the meeting was called to order during a time where health security professionals were addressing a plague outbreak in Madagascar and a local Marburg outbreak in the host country, Uganda. This alone was a vivid reminder that health security must remain a priority.” The reflections present unique outlooks on the meeting and range from detailed descriptions of the sessions to visiting the Uganda Virus Research Institute, and more. Make sure you catch reflections from GMU biodefense MS students Anthony Falzarano and Stephen Taylor!
Did Russia Accidentally Provide the Best Evidence of the Syrian Government’s Involvement in Sarin Attacks?
Russia has been trying to downplay the Syrian government’s role in chemical weapons attacks, but their latest press conference may have just backfired on them. The November 2nd press conference in which Russian officials responded to the Organization for the Prohibition of Chemical Weapons – UN Join Mission, included a presentation that revealed a bit more than anticipated. “The presentation included a series of slides, which included diagrams of two types of chemical bombs, designated the MYM6000 and M4000. Remarkably, the Russian presentation appears to be the first-time images of these munitions have been made public, and before the press conference, no other references to MYM6000 or M4000 bombs appear online.” GMU Biodefense Graduate Program Director and Professor Dr. Gregory Koblentz noted that “‘these designations match bombs declared by Syria to the OPCW’, although there appears to be no open source material that provides specifics about the types of bombs declared to the OPCW. In the press conference the source of the diagrams are described as being provided ‘by certain organisations’, but no more specifics are given.” The Russian presentation diagrams provide some pretty clear matches between munitions found during investigations into the attacks. “The only way for the Russian or Syrian governments to now deny the M4000 bomb was used is to produce detailed photographs of the M4000 bomb, showing the same parts indicated above, or, if the Syrians still claim all these bombs were destroyed after 2013, declassify and publish further information about the bomb.”
The Center for Global Security Research – Student InternshipThe Center for Global Security Research, Lawrence Livermore National Laboratory is now accepting applications for Spring 2018 student internships! “The Center for Global Security Research (CGSR) was established at Lawrence Livermore National Laboratory (LLNL) in 1996 to bring together experts from the science, technology, and policy communities to address pressing national security challenges. For more than 20 years, CGSR has engaged diverse perspectives on topics important to national security, deterrence, diplomacy, dual-use technology, arms control, nonproliferation, peacekeeping, cyber defense and energy security.”
A Field Test of CRISPR
Researchers are getting to test, for the first time, treatment of a genetic disorder with gene-editing tools infused into the patient’s blood. The 44-year-old man suffers from Hunter syndrome, which is a metabolic disorder. “The company (Sangamo Therapeutics) inserts a replacement copy of the gene, using gene editing to snip the DNA helix of liver cells in a specific place near the promotor, or on-off switch, for the gene for a protein called albumin. The cells fix the damage by inserting the DNA for the new gene, supplied by the researchers along with the gene editor’s DNA scissors, and the gene’s activity is then controlled by the powerful albumin promotor. The idea is to turn these modified liver cells into a factory for making the enzyme missing in Hunter syndrome.” This is an exciting step forward for gene-editing technologies and their ability to treat chronic diseases. Curious what CRISPR looks like in action? Check out this video here.
Call for Papers- Women’s Health in Global Perspective World Medical & Health Policy’s call for papers on Women’s Health in Global Perspective seeks to contribute to understanding and improve policy on women’s health and wellbeing around the world. Manuscripts on all factors that influence health outcomes for women will be considered, including social determinants such as education, nutrition, poverty, violence, access to health care, job opportunities and personal freedom. The 2018 Workshop on Women’s Health in Global Perspective will follow a successful 2016 workshop by the same name (see video at http://www.ipsonet.org/conferences/whgp/2016-womens-health-in-global-perspective-videos), which resulted in a special issue http://onlinelibrary.wiley.com/wol1/doi/10.1002/wmh3.212/full and an ongoing series of articles in WMHP highlighting global women’s health issues and their implications for economic, political and social development. Abstract submission deadline (250 words): December 15, 2017. Contact: Bonnie Stabile, Co-Editor, bstabile@gmu.edu
Three Decades of Responding to Infectious Disease Threats
NIAID Director Anthony Fauci has been fighting infectious diseases in his role since 1984. After 30+ years of work, Dr. Fauci undoubtedly has some fascinating stories, whether it be from the beginning of the HIV pandemic or SARS. “Initial responses to a newly recognized disease, now known as HIV/AIDS, in the early 1980s were criticized as being too slow, the essay notes. ‘The insidious emergence of HIV/AIDS and the lack of due attention by policymakers illustrate how some outbreaks that start subtly can grow to global proportions if they are not aggressively addressed early on,’ Dr. Fauci writes. Between the early 1980s and the early 1990s, federal funding for HIV/AIDS research increased markedly, reaching $1 billion by the end of 1992. The accelerated government response supported both research and research infrastructure, and yielded advances in countering the HIV/AIDS pandemic domestically and internationally. Ultimately, notes Dr. Fauci, sustained support for scientific research coupled with political and community engagement helped transform HIV/AIDS from a nearly universally fatal disease to a condition that can be managed with appropriate treatment.”
The One Health Commission’s Call to Action for Social Scientists
“The One Health Commission, a 501(c)(3) global non-profit organization based in the U.S., stresses recognition of human, animal, and ecosystems interconnections and facilitates collaboration of all professions required to achieve global and planetary health. The One Health Social Sciences Team invites social scientists of all disciplines to become involved in the One Health community. By forging new and innovative partnerships, collaborations across human, animal, plant and ecosystem health communities will collectively enable betterment of health and well-being for all.” To learn more and get involved please contact the One Health and Social Sciences Working Group at ohss@onehealthcommission.org.
What Should The US National Biodefense Strategy Look Like?The complex nature and painful lessons of biological threats, regardless of source, have challenged U.S. biodefense efforts for decades. As the Blue Ribbon Study Panel on Biodefense pointed out in their report, there is a general lack of clear leadership and coordination. The 2016 National Defense Authorization Act required that the DoD, DHHS, DHS, and USDA, all develop a national biodefense strategy and plan for implantation. Laura H. Kahn has provided a handful of critical strategies that are necessary. “First, human-intelligence-based monitoring of rogue nations and militant groups that use bioweapons is critical. Second, a national strategy must include a plan for disease surveillance of humans and animals, with a view to predicting the next naturally occurring epidemic. This kind of work is difficult, because there are so many viruses that could spill over from other mammals or birds into humans.” Kahn also highlights laboratory security and the importance of high-containment lab biosecurity, review of the Federal Select Agent Program, investigation of large-scale wildlife die-offs, and recognizing the importance of One Health. “Threat to one component in this triad threatens them all. For that reason, animal and environmental health must be taken just as seriously as human health—which requires devoting personnel and resources to monitoring them, which requires sufficient funding for entities like the EPA and the Fish and Wildlife Service.” Kahn also draws attention to the recent GAO report on biological threat awareness and the need to share information and resources. “Most distressingly, the current administration appears willfully ignorant of scientific issues, while at the same time disinclined to fund critical scientific efforts. The White House Office of Science and Technology Policy, which is intimately involved with biodefense issues, remains leaderless and understaffed.” Overall, a national biodefense strategy will not be easy, but it must be as comprehensive and wholistic as the biological threats we face.
The World’s Deadliest Diseases: How Is Biotech Fighting Them?
Biotech has an increasingly important role of health security and infectious disease response. As we saw with CRISPR this week, it has the capacity to help treat chronic conditions, but what about infectious diseases? Rapid diagnostics and development of medical countermeasures are critical during outbreaks and can determine if an epidemic will turn into a pandemic. Ute Boronowsky, pulling on Robert Herriman’s list of the five deadliest diseases, is looking to the biotech approaches for such biothreats. Whether it be plague or amebic meningoencephalitis, biotech advances are providing new avenues for treatment and response. Naegleria fowleri (the amoeba that causes the fatal meningoencephalitis) can be difficult to track within water sources and treatment is even trickier. “In 2015, investigational breast cancer and anti-leishmania drug miltefosine was used successfully on a 12-year-old girl at the Arkansas Children’s Hospital. However, when the same drug was used on two other patients, one of them died, and the other suffered from major neurological damage. This year saw a new therapeutic approach when scientists at the Virginia Commonwealth University found evidence that Naegleria relies on matrix metalloproteases to degrade the host extracellular matrix during infection, identifying these enzymes as potential therapeutic targets.” Other biotech advances, like prion disease therapy kinase inhibitors on the unfolded protein response, or the latest Ebola vaccine, all highlight the importance of biotech advances in combatting infectious diseases.
Stories You May Have Missed:
Legionella in Disneyland – GMU biodefense PhD student Saskia Popescu is looking at the latest outbreak of Legionnaires’ disease and how it highlights the challenges of prevention. “There are many factors that may attribute an outbreak, such as warming climates, a large aging population, and increased attention on the disease, which all lead to a better chance of infections being reported. The recent outbreak in Disneyland is a good reminder of the inherent challenges with disinfection efforts and continued vigilance that is needed to ward off this bacterial infection. It is also a reminder that outbreaks can happen anywhere there is a water source, even Disneyland, or other areas that somehow seem to be untouchable.”
Bulgaria and South Africa Battle HPAI – The two countries are dealing with outbreaks related to highly virulent strains of avian influenza. “A US vaccine company announced that the US Department of Agriculture (USDA) has conditionally approved the first DNA avian flu vaccine for chickens. Also, the United Nations Food and Agriculture Organization (FAO) provided a snapshot of current highly pathogenic H5 observations and what could play out in the upcoming season, and Chinese researchers reported new findings on airborne spread of avian flu based on sampling in a live-poultry market.”
Thank you for reading the Pandora Report. If you would like to share any biodefense news, events, or stories, please contact our Editor Saskia Popescu (biodefense@gmu.edu) or via Twitter: @PandoraReport
Happy Friday – we hope you had a wonderful time celebrating 
The Pandora Report 