Pandora Report 10.25.2024

Happy almost Halloween! This week’s Pandora Report includes news from the Biodefense Graduate Program and discussion of the Biden administration’s latest National Security Memorandum, a new multilateral effort from the US, Canada, and Mexico to improve regional health security, the WHO’s praise for Rwanda’s swift and effective Marburg response, and more.

Upcoming Virtual Information Sessions on the Biodefense Graduate Program

If you are interested in a career in biodefense or global health security or want to develop the knowledge and skills necessary to work at the nexus of health, science, and security, find out what the Schar School of Policy and Government has to offer. 

The Schar School PhD programs will be holding a virtual open house on Wednesday, October 30 from 6-7:30 PM. Please join Dr. Gregory Koblentz, director of the Biodefense Graduate Program, to learn more about the Biodefense PhD program and ask any questions you may have. Register here.

GMU Biodefense Students Tour Mason’s Biomedical Research Laboratory

Last week twelve Biodefense students had the opportunity to visit George Mason’s 52,000 square-foot Biomedical Research Laboratory (BRL) located on the SciTech campus in Manassas, Virginia. The BRL was inactive after being decontaminated for annual maintenance . The tour, led by the BRL’s Director of Research Operations, Rachel Pepin, provided students with a firsthand look at Mason’s Biosafety Level 3 (BSL-3) and supporting Biosafety Level 2 (BSL-2) labs. Among the many highlights was the BRL’s autoclaves and gloveboxes, which left students impressed.

The BRL is one of 12 Regional Biocontainment Labs in the United States funded by the National Institute of Allergy and Infectious Diseases NIAID. Constructed in 2010, it became an active “hot” lab in 2012. Fifteen Mason faculty members and thirty students at any time work within the facility on research pertaining to a variety of infectious diseases, new vaccines, diagnostics, and therapeutics. The stated mission of Mason’s BRL is to 1) advance pathogen biology, 2) train the future workforce to safely handle infectious agents and conduct innovative research in BSL-3 environments, 3) evaluate diagnostics, therapeutics and vaccines, and 4) serve as a resource in the event of a bioterrorism or infectious disease emergency. Overall, students gained an appreciation for the critical work and numerous safety controls in George Mason’s BSL-3 laboratory.

This write up was written by Biodefense MS Student Will MacDonald.

OPCW Workshop on Legislative and Regulatory Frameworks for Chemical Security
On October 21-22, 2024, Dr. Gregory Koblentz, director of the Biodefense Graduate Program, attended a meeting of chemical security experts sponsored by the Organization for the Prohibition of Chemical Weapons (OPCW) to discuss best practices for establishing legislative frameworks for chemical security. According to INTERPOL, from the records of 4,100 captured ISIS members, 109 of them have a background related to chemistry, science, technology, engineering, and mathematics. Meanwhile, across the word, the chemical industry and trade are rapidly growing, increasing the risk of toxic chemicals being misused, especially by non-state actors. Many countries are therefore seeking to strengthen their legal and regulatory regimes to address risks such as attacks on chemical facilities, the theft of toxic chemicals, or their release with malicious intent. Initial take-aways from the meeting included a recognition that there is an urgent need for robust national legislative frameworks for chemical security in many countries, that national threat assessments and risk analyses should be the basis for identifying legislative needs, and best practices are most useful if they can be adapted to country-specific contexts and resource setting. This meeting of an international group of chemical security experts kicks off a longer-term discussion on best practices for establishing legislative frameworks for chemical security sponsored by the Implementation Support Branch of the International Cooperation and Assistance Division at OPCW.
A Risky Review of Research
On September 25, 2024, Senator Rand Paul introduced a revised version of the Risky Research Review Act (S. 4667) which was voted out of the Senate Homeland Security and Government Affairs Committee by a vote of 8-1. In a recent OpEd in StatNews, Gregory Koblentz, director of the Biodefense Graduate Program, and David Gillum and Rebecca Moritz, past presidents of the American Biosafety Association (ABSA) wrote of the original bill: “this legislation threatens to cast a shadow over the future of life sciences research and slow it down.” While this revised bill contains some positive changes, it remains deeply flawed and does not represent a viable solution to the challenges posed by dual-use research. You can read their analysis of the good, the bad, and the ugly of the revised Risky Research Review Act here.
Russia Expanding Secret BSL-4 Lab at Sergiev Posad
The Washington Post has identified new construction activity at Sergiev Posad-6, part of the former Soviet and current Russian biological weapons program, consistent with the building of additional high containment laboratories, including BSL-4 lab suites. The construction started in 2022, shortly after Russia’s invasion of Ukraine which was accompanied by unfounded allegations that Ukraine was developing biological weapons with the help of the United States and other NATO countries. Dr. Gregory Koblentz, director of the Biodefense Graduate Program, is quoted in the article as saying, “I would not be surprised if some influential segment of the Russian national security community has drunk the Kool-Aid and really believes that the United States really is developing biological weapons.” Satellite imagery obtained and analyzed by the Washington Post has identified the construction of “10 new buildings, totaling more than 250,000 square feet, with several of them bearing hallmarks of biological labs designed to handle extremely dangerous pathogens.” The Global BioLabs Initiative identified Sergiev Posad-6 as having a BSL-4 lab in 2021. The existence of a BSL-4 lab at this site was confirmed by a 2017 scientific article co-authored by a researcher at the 48th Central Research Institute of the Ministry of Defense at Sergiev Posad. Russia has not declared the existence of a BSL-4 lab at this site on Form A of the confidence building measures that it submits to the Biological Weapons Convention. 

White House Releases New National Security Memorandum on Advancing AI Leadership

The Biden administration issued this week the first-ever National Security Memorandum (MSM) on AI. The NSM direct the federal government to take steps to 1) “ensure that the United States leads the world’s development of safe, secure, and trustworthy AI,” 2) “harness cutting-edge AI technologies to advance the U.S. Government’s national security mission,” and 3) “advance international consensus and governance around AI.”

The NSM directives are focused on actions to improve chip supply chain security and diversity, making collection on competitors’ operations against the US AI sector a top-tier intelligence priority, formally designating the AI Safety Institute, doubling down on the National AI Research Resource, directing “the National Economic Council to coordinate an economic assessment of the relative competitive advantage of the United States private sector AI ecosystem,” and more.

Among its other measures, the NSM also directs the creation of a Framework to Advance AI Governance and Risk Management in National Security, which was published alongside the NSM. This framework and any successor document will specify that each covered agency has a chief AI officer and guidance boards, offer guidance on AI activities that pose “unacceptable levels of risk and that shall be prohibited,” and more.

A fact sheet for the new NSM is available here.

US, Canada, and Mexico Announce Efforts to Improve Regional Health Security

This week, the US Departments of Health and Human Services, State, Agriculture, and Homeland Security, along with their counterparts in Canada and Mexico made good on commitments made at the 2021 and 2023 North American Leaders’ Summits in releasing the North American Preparedness for Animal and Human Pandemics Initiative (NAPAHPI). NAPAHPI is “…a flexible, scalable, and cross-sectoral platform to strengthen regional capacities for prevention, preparedness, and response to a broad range of health security threats that builds on lessons learned from COVID-19 and other health security events in the last decade. It is based on a long-standing trilateral collaboration under the 2007 North American Plan for Avian and Pandemic Influenza and the 2012 North American Plan for Animal and Pandemic Influenza. This initiative recognizes that the high degree of interconnectedness among our three countries of our critical infrastructure, supply chains, and societies means that disruptions affecting one country often impact the others. Only by working together can we protect the health security of our region.”

Learn more here.
Egypt Declared Malaria Free

Egypt was officially certified malaria-free by the World Health Organization this week. Following Morocco and the UAE, Egypt is just the third country in the WHO’s Eastern Mediterranean region to receive this certification. Globally, 44 countries and one territory currently have this designation.

“This certification of Egypt as malaria-free is truly historic, and a testament to the commitment of the people and government of Egypt to rid themselves of this ancient scourge,” said WHO Director-General Tedros Adhanom Ghebreyesus in a statement. “I congratulate Egypt on this achievement, which is an inspiration to other countries in the region, and shows what’s possible with the right resources and the right tools.”

WHO Praises Rwanda’s Marburg Response

WHO Director-General Tedros Adhanom Ghebreyesus praised Rwanda’s response to its Marburg virus outbreak, noting their success in treating patients infected with this especially deadly disease. As of earlier this week, Rwanda has made it a full week with no new cases, and its total number of patients still in treatment is down to just one. “Leadership from the highest levels of government is essential in any outbreak response, and that’s what we see here in Rwanda,” Tedros said during the press briefing. The Director-General also noted that multiple patients experiencing multiple organ failure were put on life support, intubated, and eventually extubated. “We believe this is the first time patients with Marburg virus have been extubated in Africa. These patients would have died in previous outbreaks,” Tedros explained. 

Burgers, Deli Meat, and Waffles-Oh My! US Responding to E. Coli and Listeria Outbreaks

It has been a rough couple of weeks for many major food suppliers in the United States amid headlines about recalls and reports of multiple cases of E. coli and listeria across the country. McDonald’s, KFC, Burger King, and other restaurant chains have pulled onions from their menus following an outbreak of E. coli traced back to McDonald’s Quarter Pounders. The CDC announced this week it is investigating 49 cases linked to “slivered onions used in the Quarter Pounder and sourced by a single supplier than serves three distribution centers.” One person is dead and ten more have been hospitalized. The supplier, Taylor Farms, has issued a recall on all of its peeled, diced, and whole peeled yellow onion packs due to potential contamination.

This comes amid multiple listeria outbreaks affecting several kinds of products, including deli meat, frozen waffles and pancakes, and even salmon. While these recalls are certainly nothing to ignore, they might not necessarily be happening more frequently than before as some have suggested. Dr. Céline Gounder, CBS News medical contributor and editor-at-large for public health at KFF Health News, told CBS this week that “Every step of food processing, there’s the opportunity for contamination. That’s number one. Consumers want ready-to-eat food, so of course, they’re more processed as a result.” She continued, saying “We have better tests. So it used to be we might not have been aware or known what made you sick. Now we can actually test, detect and tell you what made you sick.”

“Assessing the Burden of and Potential Strategies to Address Antimicrobial Resistance”

From NASEM: “Antimicrobial resistance (AMR) is linked to millions of deaths globally each year. As an evolving public health threat, there is a need to further develop methods to quantify AMR’s burden within medical practice and other sectors like food production. The National Academies Forum on Microbial Threats hosted a public workshop in March 2024 to explore the burden of AMR and discuss clinical, scientific, and policy strategies for addressing the growing AMR health threat across sectors.”

“This proceedings highlights the presentations and discussions that occurred at the workshop.”

“The Changing Face of Pandemic Risk: 2024 Report”

From GPMB: “The 21st century has seen a significant rise in global health threats. Epidemics and pandemics are now a constant danger rather than rare events. The 2024 GPMB report, The changing face of pandemic risk, is a call to action for global leaders, policy-makers, health professionals, and communities to build a safer, more resilient future. It outlines the key drivers of pandemic risk and provides a roadmap for strengthening our defences.”

“Mpox: Neglect Has Led to a More Dangerous Virus Now Spreading Across Borders, Harming and Killing People. Leaders Must Take Action to Stop Mpox Now”

McNab et al. recently published this opinion article in PLOS Global Public Health, writing in part “In other words, mpox is an ever-growing regional health crisis in Africa, and without urgent action to stop the epidemics when and where they occur, it will continue to spread across borders and continents. The few tools we have that could help to stop the outbreaks have yet to become adequately available in the most affected low-income countries where they are urgently required, as is financing to support the public health response. Mpox cannot be allowed to continue spreading widely across the African continent or anywhere. The world cannot continue to simply ‘learn’, but not apply the costly lessons of neglecting disease outbreaks.”

“Are We Ready For A Bird Flu Vaccination Campaign?”

Ram Koppaka and Richard Hughes IV discuss the possibility of H5N1 human transmission and a hypothetical mass vaccination program against this virus in this piece for Health Affairs. They write in their conclusion, “The most recent pandemic clearly demonstrated the inadequacy of our existing level of vaccine preparedness. So far, we have failed to seize this moment and put in place the infrastructure to support immunization of both children and adults. Worse still, it indicates a failure to learn some of the pandemic’s hardest lessons. As a result, we are destined to once again endure the consequences, knowing that they had been largely avoidable…Or we can do it differently this time. We can act now to be truly ready and prepared to mount a mass vaccination campaign against the next pandemic threat—whenever it comes. We have risen to the occasion before, and we can do it again.”

“COVID, Mpox, Cholera: Is the World Prepared for Another Pandemic?”

Faras Ghani discusses recent outbreaks and infectious disease developments, alongside analysis of global lack of adequate access to essential healthcare services and an interview with Dr. Ahmed Ogwell, Vice President of Global Health Strategy at the UN Foundation, in this piece for Al Jazeera.

“Inside the Bungled Bird Flu Response, Where Profits Collide With Public Health”

Katherine Eban discusses the USDA’s action or lack thereof in responding to H5N1 cases in Texas dairy cattle in this Vanity Fair article, writing in her summary “When dairy cows in Texas began falling ill with H5N1, alarmed veterinarians expected a fierce response to contain an outbreak with pandemic-sparking potential. Then politics—and, critics say, a key agency’s mandate to protect dairy-industry revenues—intervened.”

“Combining AI Breakthroughs and Better Policy to Defeat Superbugs”

Akhila Kosaraju discusses the transformative opportunity AI poses in addressing AMR in this piece for the Stanford Social Innovation Review: “Superbugs may have met their match in generative AI, but to fully tackle the crisis of antimicrobial resistance, policy makers need to find new ways to help scientists and researchers overcome long-standing obstacles and revitalize a broken antibiotic market.”

“NTI | Bio Champions Effort to Enhance Transparency to Strengthen the Biological Weapons Convention”

From NTI: “From September 30 to October 2, 2024, NTI | bio convened more than 30 experts for a workshop on enhancing transparency for bioscience research and development and bolstering confidence in compliance with the Biological Weapons Convention (BWC). Held in Amsterdam, The Netherlands, the workshop gathered an international group of participants from 15 countries spread across five continents with expertise in biosecurity and biotechnology governance and international security, as well as previous experience working to establish a verification mechanism for the BWC and involvement in ongoing discussions to strengthen the Convention.”

“The meeting updated existing concepts and generated new ideas about options to enhance transparency in regard to BWC compliance. NTI helped frame these discussions by tabling a concept paper on this topic, and the group discussed approaches to advance these goals, including through scientific and technical measures for data collection and analysis, procedural approaches, and institutional structures to house such efforts. Dozens of approaches were discussed during the meeting which will inform NTI’s continued efforts to highlight and explore promising opportunities to further advance this work.”

Read more here.

“Preparing for Ecological Disruption: A Strategic Foresight Approach to Ecological Security”

Lily Boland recently authored this report for the Council on Strategic Risks: “This report leverages insights gained from the use of strategic foresight as an approach for better anticipating how risks to global security are heightened by ecological disruption. It offers a range of use-cases for applying the foresight toolkit to the field of ecological security and to establish a knowledge base to assist practitioners, governments, and institutions in enhancing their anticipatory decision-making and planning processes for addressing the security ramifications of large-scale destabilization and decline of the biosphere and ecosystems.”

“How Zombies and Vampires Help Me Grapple with Disaster”

Neil Vora, a physician who has served in the Epidemic Intelligence Service and now treats TB patients and works with Conservation International, discusses what many in this field know all too well-an obsession with works of horror, especially those about contagions and disasters. Vora explains in part, “To help manage my anxieties about the fate of the world, I often turn to scary stories about contagions and other doomsday scenarios. This may seem counterintuitive, but I find the horror genre to be a perfect sandbox to explore pressing societal problems without real-world repercussions. Horror allows me to navigate my fears to their extremes from the comforts of my living room.”

However, the author also cautions, “But while fictionalized catastrophes help me grapple with my worst fears, I’ve also come to realize that consuming them without a critical eye can lead to a paralyzing level of despair—a luxury we can’t afford at this pivotal moment in history.”

While you’re at it, check out this episode of the Poisons and Pestilence podcast guest starring Biodefense PhD Program alumna and faculty member Saskia Popescu reviewing the films, Contagion and Outbreak, and read about her intro to the field at just 9-years-old via Richard Preston’s book, The Hot Zone.

NEW: Vision for Health Forum

From Johns Hopkins: We hope you can join us in November for the Vision for Health Forum with collaboration between Johns Hopkins Howard County Medical Center and Johns Hopkins Applied Physics Laboratory. 

Panel Discussion 
Moderator:  
M. Shafeeq Ahmed, M.D., MBA, F.A.C.O.G
President, Johns Hopkins Howard County Medical Center

Topic: Partnership between JHHCMC and APL
Jeanette Nazarian, M.D., Vice President, Medical Affairs and Chief Medical Officer- Johns Hopkins Howard County Medical Center 

Topic: Revolutionizing Health through Science and Engineering
Sheri Lewis, MPH, Deputy Mission Area Executive, Global Health -Johns Hopkins Applied Physics Lab 

Topic: APL-HCMC Partnership for Project Firstline: Safeguarding Our Nation’s Frontline Healthcare Workers
Lucy Carruth, Ph.D, Assistant Program Manager- Johns Hopkins Applied Physics Lab 
Brian Damit, Ph.D, Project Manager- Johns Hopkins Applied Physic Lab 

This event will take place at the Johns Hopkins Applied Physics Laboratory on November 4 at 4:30 pm EST. Learn more here.

The Advancing Threat Agnostic Biodefense Webinar Series

From PNNL: “Please join us in welcoming Drs. Matthew Kasper and Lindsay Morton from the Department of Defense (DoD) Global Emerging Infections Surveillance (GEIS) program for their talk titled “Challenges and Opportunities in Pathogen Agnostic Sequencing for Public Health Surveillance: Lessons Learned From the Global Emerging Infections Surveillance Program.” This webinar will take place Tuesday, October 29th, at noon PT.”

Learn more and register here.

13th Annual Jonathan Tucker Symposium

“The James Martin Center for Nonproliferation Studies cordially invites you to the 13th annual Jonathan Tucker Symposium on chemical and biological weapons issues on November 13th and 14th, 2024.”

Among this year’s speakers are Dr. Yong-Bee Lim, an alumnus of the Biodefense PhD Program and Deputy Director of the Converging Risks Lab and Biosecurity Projects Manager at the Council on Strategic Risks, who will give a talk titled “Technology Democratization and its Implications for CBW Safety and Security: Lessons Learned from Engagement with Non-Traditional Communities.”

Learn more and register here.

One Health and the Politics of COVID-19 Book Launch

The Writer’s Center is hosting a book launch for Dr. Laura Kahn’s new book, One Health and the Politics of COVID-19 (blurb below) on November 23 at 2 pm EST in Bethesda, MD. Learn more and RSVP here.

“One Health and the Politics of COVID-19 unpacks the mysteries of COVID-19’s origins to impart important lessons for future outbreaks. The One Health concept recognizes the interconnected links among the health of humans, animals, plants, and the environment. By comparing the history, science, and clinical presentations of three different coronaviruses—SARS-CoV-1, MERS, and SARS-CoV-2 (COVID-19)—Kahn uncovers insights with important repercussions for how to prepare and avoid future pandemics. The One Health approach provides a useful framework for examining the COVID-19 pandemic. Understanding the origins of this zoonotic disease requires investigating the environmental and molecular biological factors that allowed the virus to spread to humans. The book explores the many ways in which the wild animal trade, wet markets, and the camel industry contributed to the spread of the earlier SARS-CoV-1 and MERS coronaviruses. For SARS-CoV-2 (COVID-19), Kahn examines the biosafety, biosecurity, and bioethics implications of gain-of-function research on pandemic potential pathogens. This book is a must read to understand the geopolitics of the COVID-19 pandemic.”

2024 CBD S&T Conference

From DTRA: “The CBD S&T Conference brings together the most innovative and influential chemical and biological defense community members from around the globe to share insights and collaborate on the emerging chem-bio threats of tomorrow.”

“Join the Defense Threat Reduction Agency’s (DTRA) Chemical and Biological Technologies Department in its role as the Joint Science and Technology Office (JSTO) for Chemical and Biological Defense, an integral component of the Chemical and Biological Defense Program, as we Focus Forward to uncover novel concepts and examine groundbreaking discoveries within the chem-bio defense landscape.”

“The 2024 CBD S&T Conference will be held at the Broward County Convention Center, December 2–5, 2024.”

Learn more and register here.

BID2025 Stakeholder Input Request
“From BARDA: We are excited to host our next BARDA Industry Day (BID) conference on June 30 – July 1, 2025, in Washington, D.C.! BID2025 will delve into the critical intersection of health security and sustainability with experts from various sectors to discuss cutting-edge medical countermeasure (MCM) innovations and strategies.”

“We want to make sure that the event reflects the interests of our attendees. Your feedback will help us curate sessions, speakers, and topics that are relevant and engaging for you. This short questionnaire should take no more than three minutes to complete. Please share your thoughts on what you would like to see at the conference by October 30, 2024.“

Share thoughts here.

US AI Safety Institute Issues RFI on Responsible Development of Chem-Bio Models

From AISI: “The U.S. Artificial Intelligence Safety Institute (U.S. AISI), housed within the U.S. Department of Commerce’s National Institute of Standards and Technology (NIST), released a Request for Information seeking insight from stakeholders regarding the responsible development and use of chemical and biological (chem-bio) AI models.”

“Input from a broad range of experts in this field will help the U.S. AISI to develop well-informed approaches to assess and mitigate the potential risks of chem-bio AI models, while enabling safe and responsible innovation.”

“Respondents are encouraged to provide concrete examples, best practices, case studies, and actionable recommendations where possible. The full RFI can be found here.”

“The comment period is now open and will close on December 3, 2024, at 11:59PM Eastern Time. Comments can be submitted online at www.regulations.gov, under docket no. 240920-0247.”

Pandora Report 5.3.2024

This edition of the Pandora Report covers the United States’ accusations against the Russian Federation regarding the use of chloropicrin and riot control agents “as a method of warfare” in Ukraine, the Biden administration’s new framework for nucleic acid synthesis screening, DHS’ new guidelines on preventing AI threats to critical infrastructure and CBRN weapons design, and more.

United States Accuses Russia of Violating Chemical Weapons Convention, Announces Further Sanctions

On Wednesday, the US officially accused Russia of violating the CWC by deploying chloropicrin weapons against Ukrainian forces and using riot control agents “as a method of warfare” in Ukraine. Chloropicrin (PS), a choking agent, was first used during World War I, and it is explicitly banned under the CWC, as is the use of RCAs not included in the CWC’s schedules when used as a method of warfare. In a statement, the US Department of State said “The use of such chemicals is not an isolated incident, and is probably driven by Russian forces’ desire to dislodge Ukrainian forces from fortified positions and achieve tactical gains on the battlefield. Russia’s ongoing disregard for its obligations to the CWC comes from the same playbook as its operations to poison Aleksey Navalny and Sergei and Yulia Skripal with Novichok nerve agents.”

Credit: National Museum of Health and Medicine

The State Department and the Department of the Treasury have announced sanctions against more than 280 individuals and entities, including more than 80 known to be engaged in sanction evasion or that are related to Russia’s CBW and defense industrial base. In its statement, the Treasury said “Treasury is also targeting three Russia-based entities and two individuals involved in procuring items for military institutes involved in Russia’s chemical and biological weapons programs. In coordination, the Department of State is separately designating three Russian government entities associated with Russia’s chemical and biological weapons programs and four Russian companies contributing to such entities. These actions are being taken concurrent with the Department of State’s imposition of Chemical and Biological Weapons Control and Warfare Elimination Act of 1991 (the CBW Act) sanctions on Russia over its use of the chemical weapon chloropicrin against Ukrainian troops.”

White House Releases Framework for Nucleic Acid Synthesis Screening

On Monday, the White House Office of Science and Technology Policy (OSTP) announced the release of its Framework on Nucleic Acid Synthesis Screening, as directed by President Biden’s Executive Order on the Safe, Secure, and Trustworthy Development of Artificial Intelligence. The framework aims to help manage AI risks so that its benefits can be used in synthetic biology by encouraging “providers of synthetic nucleic acids to implement comprehensive, scalable, and verifiable screening mechanisms.”

In its statement, OSTP said “Through the AI executive order, President Biden has directed action on AI across the economy, including AI applied to biotechnology and synthetic biology. Nucleic acids serve as the critical building blocks for life science research and development (R&D) —including the development of new biomedical products, novel strategies for recycling and energy production, and the creation of new classes of materials. It is essential that nucleic acid synthesis technologies are appropriately managed to promote positive outcomes and prevent nefarious uses. Nucleic acid synthesis screening is an effective, targeted measure to mitigate the potential for misuse of AI-enabled biotechnologies.”

“This framework recommends that providers of synthetic nucleic acids screen purchases to prevent misuse, building on recent guidance from the Department of Health and Human Services. The National Institute of Standards and Technology will further support implementation of this framework by engaging with industry to develop technical standards for screening, as directed by the Executive Order.”

“As directed by the Executive Order, within 180 days of the release of this framework, federal research funding agencies will require recipients of federal R&D funds to procure synthetic nucleic acids only from providers that implement these best practices. While this framework establishes requirements for federally funded research, it is anticipated that these requirements may be adopted more broadly by other research funders.”

DHS Warns AI Could Be Used to Design WMD

This week, the Department of Homeland Security released a new report discussing potential ways that artificial intelligence could be used to help design chemical, biological, radiological, and nuclear weapons as well as guidelines addressing this threat. DHS also released guidelines on securing critical infrastructure in light of advancements in AI, as required by President Biden’s Executive Order (EO) 14110, “Safe, Secure, and Trustworthy Development and Use of Artificial Intelligence (AI)”.

The report on CBRN weapons and AI risks, which was submitted to President Biden, “…identifies trends within the growing AI field along with distinct types of AI and machine learning models that might enable or exacerbate biological or chemical threats to the U.S. It also includes national security threat mitigation techniques through oversight of the training, deployment, publication and use of AI models and the data used to create them — particularly regarding how safety evaluations and guardrails can be leveraged in these instances.”

Meanwhile, the guidance on protecting critical infrastructure focuses its attention on water treatment facilities and supplies, telecom operations, and power grids in light of recent cyber attacks targeting these kinds of facilities. “AI can present transformative solutions for U.S. critical infrastructure, and it also carries the risk of making those systems vulnerable in new ways to critical failures, physical attacks, and cyber attacks. Our Department is taking steps to identify and mitigate those threats,” said Secretary of Homeland Security Alejandro Mayorkas in a press release. 

Asia Centre for Health Security Opens in Singapore

Recently, the Asia Centre for Health Security (ACHS) opened its doors at the National University of Singapore’s Saw Swee Hock School of Public Health, marking an important development for health security research in the region. In a statement about ACHS, the Centre’s Director and Vice Dean of Saw Swee Hock SPH, Hsu Li Yang, told The Straits Times “The focus includes all manner of catastrophic biological threats, rather than just zoonoses. So laboratory biosafety and deliberately released or man-made biological agents are also a part of our work…Rather than hardcore biomedical science and technology, we work on health systems, global health law and regulations, and global relations where it pertains to health security issues.”

Joyce Teo explains in the same piece that “Established with the help of generous philanthropic funding, ACHS is steered by a multidisciplinary team with expertise in areas from public health and clinical practice to global health law and policymaking. It will work closely with the S. Rajaratnam School of International Studies at Nanyang Technological University in areas such as research and training.”

“National Intelligence Estimate: Dynamics Shaping Global Health Security In the Next Decade”

The Office of the Director of National Intelligence recently approved for release this December 2023 National Intelligence Estimate (NIE) from the National Intelligence Council. The estimate’s key takeaway is that “During the next decade, the global health security landscape will be stressed by climate and societal changes, strained health infrastructure and capacity, and eroding global health governance. Regardless of the severity and scope, global health emergencies are likely to continue to strain national health systems, particularly disadvantaging poorer countries, as well as encourage and result in responses that are constrained by major power competition. Nonetheless, promising health initiatives utilized during the COVID-19 pandemic, coupled with burgeoning technological advances, are likely to help fill some shortfalls, but will require overcoming competitive approaches and geopolitical rivalry.”

“Public Health Preparedness: HHS Should Address Strategic National Stockpile Coordination Challenges”

From the Government Accountability Office: “The federal government coordinates with states, localities, territories, and Tribes to distribute life-saving medicines and supplies from the Strategic National Stockpile during public health emergencies…But during recent public health responses, such as COVID-19 and mpox, jurisdictions weren’t clear on how and from whom to request supplies, causing confusion and delays. Additionally, some Tribal officials cited challenges with having the facilities needed to receive and store delivered supplies…Our recommendations address this and other issues we found.”

“Who Could Catch Bird Flu First? These Experts Have an Idea, and a Way to Help.”

Erin M. Sorrell, Monica Schoch-Spana and Meghan F. Davis recently published this opinion piece in The New York Times discussing the need to improve protections for those working in the farming industry. They write in part “So far, bird flu testing of this cohort has been woefully inadequate. Testing is usually under the purview of state authorities following federal Centers for Disease Control and Prevention guidelines. Tests are recommended for symptomatic workers. The exact number of dairy workers and other people who have so far been tested for H5N1 is not publicly available at the federal level. There is no excuse to continue only limited testing of this vulnerable population. Any serious surveillance efforts of H5N1 demand that the country do better to ensure proper testing and health care is provided to these workers now, lest we risk being caught flat-footed by a new pandemic so soon after Covid.”

“WHO Overturns Dogma on Airborne Disease Spread. The CDC Might Not Act on It.”

Amy Maxmen discusses the CDC’s potential response to recent changes in how the WHO defines airborne disease spread in this piece for KFF Health News: “However, the WHO report stops short of prescribing actions that governments, hospitals, and the public should take in response. It remains to be seen how the Centers for Disease Control and Prevention will act on this information in its own guidance for infection control in health care settings.”

“A Pandemic Agreement Is Within Reach”

Anita Cicero and Alexandra Phelan recently authored this editorial piece for Science, explaining their introduction “At the end of May, 194 member states of the World Health Organization (WHO) will meet for the World Health Assembly. Negotiations underway now will determine whether they vote then to adopt a pandemic agreement. For the past 2 years, discussions have focused on articulating essential components of a robust and equitable architecture for pandemic preparedness and response. Despite this, talks have failed to produce sufficient consensus on a detailed draft, prompting the intergovernmental negotiating body to propose a “streamlined” version. The new text, released on 16 April, consolidates provisions for research and development, technology transfer, pathogen access and benefit sharing (including pandemic products such as medicines and vaccines), with many particulars deferred to future procedures. Ultimately, success of the agreement will depend on these details and implementation. Nevertheless, member states shouldn’t bypass the consensus reached to date, but continue progress to adopt this agreement.”

CARB-X 2023 Annual Report

Boston University’s Combating Antibiotic-Resistant Bacteria Biopharmaceutical Accelerator (CARB-X) recently released its 2023 Annual Report, which identifies several trends, including:

  • “Rapid diagnostics expanded during the COVID-19 pandemic, leaving product developers poised to capitalize on their investments by embracing new sample types and pathogens;
  • More than half of therapeutics applicants were in the hit-to-lead stage, reinforcing the evident dearth of oral therapeutics in the clinical and preclinical pipelines; and 
  • CARB-X received expressions of interest from the vaccine community in response to the lack of vaccines in development for K. pneumoniae, ExPEC, S. aureus, A baumannii, and N. gonorrhoeae.“

“Ralph Baric, Whose Virology Techniques Were Used in Wuhan, Testified That Lab Leak Was Possible”

Katherine Eban, co-author of the widely criticized Vanity Fair and ProPublica article discussing the possibility of a lab leak origin of the COVID-19 pandemic at the Wuhan Insitute of Virology, recently published this Vanity Fair piece, writing “The UNC coronavirologist who has collaborated on gain-of-function research with the Wuhan Institute of Virology’s Shi Zhengli, told congressional investigators that he has long worried about biosafety protocols inside China. Though he thinks it’s far more likely COVID-19 originated in nature, he said of a possible laboratory escape, “You can’t rule that out.”’

“A Virus Hunter’s Struggle for Respect in Post-COVID China”

In this piece for Think Global Health, Yanzhong Huang discusses how Zhang Yongzhen, the scientist who first published the genome sequence of SARS-CoV-2, has struggled with his employer-the Shanghai Public Health Clinical Center-as China moves on from COVID-19: “In a shocking turn of events, Zhang Yongzhen, PhD, the internationally renowned scientist credited with first publishing the genome sequence of the SARS-CoV-2 coronavirus, staged a sit-in protest outside his laboratory at the Shanghai Public Health Clinical Center (SPHCC). In a country that values stability and obedience, this dramatic action quickly captured the attention of both Chinese and international media. As Edward Holmes, a leading virologist at the University of Sydney, remarked in Nature, “it is unfathomable to me to have a scientist of that caliber sleeping outside his lab.”‘

“China Has a Controversial Plan for Brain-Computer Interfaces”

Emily Mullin discusses Chinese aspirations of cognitive enhancement in this Wired piece, explaining in part ‘“China is not the least bit shy about this,” he says, referring to ethical guidelines released by the Communist Party in February 2024 that include cognitive enhancement of healthy people as a goal of Chinese BCI research. A translation of the guidelines by CSET says, “Nonmedical purposes such as attention modulation, sleep regulation, memory regulation, and exoskeletons for augmentative BCI technologies should be explored and developed to a certain extent, provided there is strict regulation and clear benefit.”’

“The translated Chinese guidelines go on to say that BCI technology should avoid replacing or weakening human decisionmaking capabilities “before it is proven to surpass human levels and gains societal consensus, and avoid research that significantly interferes with or blurs human autonomy and self-awareness.”’

“The Czech Illegals: Husband and Wife Outed as GRU Spies Aiding Bombings and Poisonings Across Europe”

Michael Weiss, Roman Dobrokhotov, and Christo Grozev recently published this investigative piece in The Insider covering the work of Elena and Nikolai Šapošnikov’s support of GRU Unit 29155, explaining in part “While both Šapošnikov spouses engaged in espionage for Russia assisted GRU’s sabotage operations, the wife, Šapošnikova, 62, appears to have been directly integrated with Unit 29155, as evidenced both by findings by the Czech investigators and by The Insider’s independent discovery of documentary evidence. As such, Czech investigators have concluded, she likely directed and supervised her husband’s – and possibly their son’s – activities in support of Russian state interests. The family’s clandestine duties ranged from intelligence-gathering to logistical facilitation, providing safe havens, recruitment efforts, and even aiding in securing physical access for GRU operatives conducting sabotage missions.”

“UNSCR 1540 at 20 Years”

Christina McAllister and Annie Trentham recently published this commentary piece with the Stimson Center covering the first two decades since UNSCR 1540 was passed. They explain in their introduction, “United Nations (UN) Security Council Resolution 1540 marked a round birthday of 20 years on April 28, approaching its age of majority in a very different world to the one into which it was born two decades ago. Obligating all UN member states to implement measures preventing the proliferation of weapons of mass destruction (WMD), delivery systems, and related materials, particularly to non-state actors, its passage in 2004 was a historic achievement by an international community shaken by the 2001 terror attacks on the United States as well as the exposure of A.Q. Khan’s nuclear proliferation activities. It is hard to imagine such unified action today, amid the geopolitical tensions that consume so much valuable multilateral energy and resources. Yet while the international context has changed significantly since 2004, the need for Resolution 1540 has only grown, even while implementation challenges remain.”

First Issue of the UNSCR 1540 Compass

The UN Interregional Crime and Justice Research Institute (UNICRI) recently released the first edition of the UNSCR 1540 Compass. In a statement about the new publication, UNICRI Acting Director Leif Villadsen said “This new e-journal comprises one of the ways in which the Institute is committed to advancing the objectives of UNSCR 1540 and bolstering the global non-proliferation framework. The publication aims to shed light on the impact, challenges and INTRO 9 opportunities of UNSCR 1540, as well as the work of the 1540 Committee. It also seeks to establish a dynamic platform for international dialogue and knowledge exchange among Member States, experts, practitioners, and organizations involved in implementing UNSCR 1540. Moreover, it will enable us to stay abreast of emerging trends, threats and risks. I trust that it will generate informed discussions and actionable insights that can help us forge better collective understanding of the field of non-proliferation as it stands today.”

Read the first issue here.

NEW-H5N1 What Do We Know So Far?

From Boston University Center on Emerging Infectious Diseases: “Cases of the H5N1 strain of avian flu have been reported in US dairy cattle since March 2024. As we have seen avian influenza (or “bird flu”) has the ability to be transmitted from birds to mammals such as cows and humans. We know that this strain of avian flu is transmittable to humans; in April 2024 a case was reported in a dairy farm worker who had been in contact with infected cattle.”

“This begs the question, how concerned should we be about future spread of H5N1 from animals to humans? And how does the risk of infection vary for farmers compared to the general population? Based on experience with other strains of avian flu, how do experts foresee this strain potentially evolving?”

“Join Boston University’s Center on Emerging Infectious Diseases for a discussion with experts in epidemiology, infectious diseases, and veterinary medicine as we unpack these questions and more.”

This virtual event will take place on May 9 at 10 am EST. Learn more and register here.

NEW-Biosafety and the Origin of the COVID-19 Pandemic: Evidence and Policy Implications

From Brookings: “The world just lived through the COVID-19 pandemic, with more than 7 million reported direct deaths globally, more than 775 million reported cases, more than 14 million indirect excess deaths, and likely millions more unreported deaths. Despite the devastating effects on people and economies around the world, we still do not know with certainty how the pandemic originated, with the two most likely hypotheses either a natural spillover from an animal host or a research lab leak. Finding an answer to this question is not just a matter of doing justice to the millions of victims of COVID-19—it will have significant ramifications for policy implementation to help prevent the next pandemic.”

“Importantly, the catastrophic impact of the COVID-19 disease has shown us that preventing the next pandemic and biosafety in general should be top of mind for researchers, regulators, policymakers and public health officials, and it will likely require an array of measures by private, public, and nongovernmental organizations. This includes reconsidering our early warning systems for emergent diseases from the natural world, and taking a closer look at research with dangerous pathogens in biolabs. Identifying the origins of the recent pandemic can help target those efforts.”

“On May 14, the Brookings Center on Regulation and Markets will address these complex questions. First, Alina Chan, scientific advisor at the Broad Institute, and Alison Young, Curtis B. Hurley chair in public affairs reporting at the University of Missouri School of Journalism, will explain why the origin of the SARS-CoV-2 virus matters for public policy. Then, a balanced expert panel will debate the two most likely origins: natural spillover or a leak from a lab. A final panel of biosafety experts will discuss what measures would be best suited to improve biosafety and reduce the risks for research-related lab incidents as well as future pandemics. This event is a part of the CRM series on Reimagining Modern-day Markets and Regulations.”

This online event will take place on May 14 at 1:30 pm EDT. Learn more and access the event here.

3rd International Biosecurity Virtual Symposium

From ABSA: “The Symposium will bring together biosecurity professionals from a wide range of disciplines with varying expertise to share their experiences and knowledge on diverse biosecurity topics. The Symposium will offer attendees an opportunity to learn the latest in biosecurity and have thought-provoking conversations about real-world biosecurity issues, concerns, and scenarios.”

This symposium will take place May 7-8. Learn more and register here.

Addressing the Challenges Posed by Chemical and Biological Weapons: Intensive Online Introductory Course for Students of Technical Disciplines

“SIPRI and the European Union Non-Proliferation and Disarmament Consortium (EUNPDC) invite graduate and postgraduate students of the technical or natural science disciplines to apply for an intensive online introductory course on chemical and biological weapons—their proliferation, the efforts to eliminate them, the various mechanisms used to control their spread—and endeavours underway to reduce the risk of chemical or biological agents in terrorist attacks. The course will take place online, during four half-days on 28–31 May 2024, 14:00 to 18:00 Central European Summer Time (CEST).”

“The course will cover the fundamentals of chemical and biological weapons as well as of missiles and other means of delivery; the history of chemical and biological warfare; the evolution of international norms against these weapons; the threats associated with potential terrorist uses of chemical and biological material; bioweapons and other related scientific advances; the current challenges posed by chemical weapons; arms control treaties; and mechanisms to curb the spread of dangerous substances, including export controls.”

“The course will also discuss the role of the EU institutions and industry to address the challenges mentioned above. The course will be instructed by renowned experts on non-proliferation, arms control, disarmament, export controls, verification and related subjects from SIPRI, other European research centres, think tanks and international organizations.”

Learn more and apply here.

Registration for GHS 2024 Now Open

Registration is now open for the Global Health Security 2024 conference in Sydney, Australia. This iteration will take place 18-21 June, 2024. The call for abstracts is also still open. “The mission of the Global Health Security conference is to provide a forum where leaders, researchers, policy-makers, and representatives from government, international organisations, civil society, and private industry from around the world can engage with each other, review the latest research and policy innovations, and agree solutions for making the world safer and healthier. To that end, our mission is to help foster a genuinely multidisciplinary community of practice that is committed to working collaboratively to enhance global health security and eliminate disease, irrespective of its origin or source.”

SBA.3 International Synthetic Biology, and Biosecurity Conference in Africa

“Join us for the SBA.3 International Synthetic Biology and Biosecurity Conference in Africa, a groundbreaking event that brings together experts, researchers, and enthusiasts in the field of synthetic biology. This in-person conference will take place at the Laico Regency Hotel from Wed, Jul 17, 2024 to Friday, Jul 19, 2024.”

“Get ready to dive into the exciting world of synthetic biology and explore its potential applications in Africa. From cutting-edge research to innovative solutions, this conference offers a unique opportunity to learn, network, and collaborate with like-minded individuals.”

“Discover the latest advancements, trends, and challenges in synthetic biology through engaging keynote speeches, interactive workshops, and thought-provoking panel discussions. Immerse yourself in a vibrant atmosphere where ideas flow freely and new connections are made.”

“Whether you’re a seasoned professional or just starting your journey in synthetic biology, this conference provides a platform to expand your knowledge, exchange ideas, and contribute to the growth of the field in Africa.”

“Don’t miss out on this extraordinary event that promises to shape the future of synthetic biology and biosecurity in Africa. Mark your calendars and join us at the SBA.3 International Synthetic Biology and Biosecurity Conference in Africa!”

Learn more and register here.

Pandora Report 4.26.2024

Happy Friday! This week’s edition of the Pandora Report covers Volodymyr Zelenskyy’s warning about Russia’s continued occupation of Zaporizhzhia Nuclear Power Plant on the 38th anniversary of the fateful explosion at Chernobyl Nuclear Power Plant, updates on the federal government’s sluggish response amid continued spread of H5N1 in the United States, and more.

On Chornobyl Disaster Anniversary, Zelensky Warns Russian Seizure of Zaporizhzhia Nuclear Power Plant Could Lead to Similar Disaster

Today, on International Chernobyl Disaster Remembrance Day and the 38th anniversary of the explosion at Chernobyl Nuclear Power Plant, Ukrainian President Volodymyr Zelenskyy highlighted the ongoing risk posed by Russia’s occupation of the Zaporizhzhia Nuclear Power Plant. Russia has occupied the plant since March 2022, and it briefly held the site in Chornobyl earlier in its invasion. Both incidents have sparked concern due to unsafe practices at both locations.

In his statement, Zelenskyy said “Radiation sees no borders or national flags. The Chornobyl disaster demonstrated how rapidly deadly threats can emerge. Tens of thousands of people mitigated the Chornobyl disaster at the cost of their own health and lives, eliminating its terrible consequences in 1986 and the years after…For 785 days now, Russian terrorists have held hostage the Zaporizhzhia NPP. And it is the entire world’s responsibility to put pressure on Russia to ensure that ZNPP is liberated and returned to full Ukrainian control, as well as that all Ukrainian nuclear facilities are protected from Russian strikes. This is the only way to prevent new radiation disasters, which the Russian occupiers’ presence at ZNPP constantly threatens.”

As of March this year, “The International Atomic Energy Agency (IAEA) board of governors resolution notes that the six-unit Zaporizhzhia nuclear power plant (ZNPP) has been under Russian military control for more than two years and “expresses serious concern about the unstable state of nuclear safety and security at the ZNPP, especially the lack of adequately qualified personnel at the site, gaps in planning and prevention work, the lack of reliable supply chains, the vulnerable state of water and electricity supply outside the site, as well as the installation of anti-personnel mines in the buffer zone between the internal and external perimeter of the installation”.” (World Nuclear News)

Another Game of Infectious Disease Chicken? Federal Government Under Scrutiny for Slow H5N1 Response

Veterinarians and other professionals in the United States and abroad are increasingly criticizing the federal government for what they describe as a delayed effort to share data on viral changes, spread, and milk safety as H5N1 continues to spread in several states. So far, 33 dairy cattle herds in eight states have tested positive. Following the announcement of a human case in Texas recently, concern among scientists and the general public has continued to grow, though authorities continue to emphasize the US milk supply is safe and the risk to the general public is low.

Source: USDA

However, 1 in 5 retail milk samples in the country now test positive for H5N1 fragments according to the FDA, leaving some even more weary. This comes as the Department of Agriculture recently announced that there is growing evidence the virus is spreading among cows, in addition to continued spread from birds to cows. Furthermore, officials in North Carolina have reported a herd tested positive while remaining asymptomatic, though USDA has yet to discuss this publicly. The USDA is currently not requiring farms to test their herds for infection, though it did announce it will begin reimbursing farms for testing cows that are not symptomatic in addition to those that are visibly ill.

As STAT News explains, “Three and a half weeks after first announcing the startling news that cows from a milking herd in Texas had tested positive for H5N1, the government agencies involved in the investigations have not yet revealed what research shows about whether pasteurization of milk kills this specific virus. And until Thursday, U.S. officials had not disclosed whether the now 29 affected herds in eight states form a single linked outbreak fueled by the movement of cattle from the Texas panhandle, where the first outbreak was discovered. At present, STAT was told, that does not appear to be the case.”

The same article continues: “Other countries are trying to determine whether this event is a strange one-off, or proof that the wily virus has evolved to be able to infect cattle more easily, and what risk their own herds — and potentially people — could face if the latter is true. But they are operating largely in the dark because the United States has released such sparse information, said Marion Koopmans, head of the department of viroscience at Erasmus Medical Center in the Dutch city of Rotterdam.”

As this all points to the outbreak being larger than previously thought, the USDA has implemented a rule requiring the testing of all lactating cows before they can be moved across state lines, though experts think this is probably not going to do much to contain transmission at this point. There have also yet to be cases in pigs, which is good because pigs have human and avian receptors, making them especially dangerous in the context of H5N1 spread. However, the US government’s slow reaction and hesitancy to share information is deeply concerning for several key reasons.

A lack of transparency now holds the potential to be incredibly damaging if H5N1 spreads much further, particularly if it does begin spreading in pigs or person-to-person. While the US government does have stockpiled antivirals and vaccines that should be effective against this virus, depending on these measures and continuing to act as if everything is fine is a very dangerous game. Public trust in relevant institutions and these tools is at a dangerous low, and the public is likely to be more susceptible to mis- and disinformation if the federal government continues to drag its feet on sharing information now. This is a major threat to global health, and action needs to be taken now to give everyone, not just the US, the best chance to respond appropriately if this problem does escalate.

Donna E. Shalala Named Co-Chair of Bipartisan Commission on Biodefense

Former Secretary of Health and Human Services Donna E. Shalala was named Co-Chair of the Bipartisan Commission on Biodefense this week following the passing of former Senator Joe Lieberman, a founding Co-Chair of the Commission, last month. She will serve alongside former Pennsylvania Governor and DHS Secretary Tom Ridge. The Commission’s announcement explains that “Dr. Shalala is Trustee Professor of Political Science and Health Policy at the University of Miami, where she served as president from 2001-2015. She served in the U.S. House of Representatives from 2018-2020, representing Florida’s 27th Congressional District. In 1993, President Clinton nominated her as Secretary for Health and Human Services, where she served for eight years. Most recently, Dr. Shalala was named interim president of The New School in New York City.”

‘“This issue of biodefense, of keeping us safe from biological weapons and pandemic-causing diseases, was of great importance to Joe as it is to each of us who continue this work,” said Dr. Shalala. “I thank Gov. Ridge for his steadfast leadership, and for welcoming me as his co-chair.”’

Michael Koeris Appointed Director of DARPA’s Biotechnologies Office

Michael Koeris, Professor of Bioprocessing and a member of the Amgen Bioprocessing Center at the Keck Graduate Institute, was recently tapped to lead the Defense Advanced Research Agency (DARPA) Biotechnology Office (BTO). Koeris has been influential in the field of synthetic biology for years, having recently led the NIH’s RADx initiative as a portfolio executive and serving as Senior Bio Advisor & Venture Partner to The Venture Collective. In this new role, Koeris will oversee DARPA’s efforts to prioritize advancements in synthetic biology, particularly as it relates to areas like AI and space.

Read more about Koeris’ background and path to DARPA’s BTO here.

“Reinforcing Global Biodefense: The Case for Amending the Biological Weapons Convention to Enhance International Law and Legitimacy”

Biodefense PhD Student Ryan Houser recently published this article in the Rutgers Law Record, explaining in his introduction “The BWC is the cornerstone of the biological weapons disarmament regime, but the treaty is having difficulty keeping up with changing threats due to its decision-making process and geopolitics. Fundamentally flawed, the BWC is “crippled by key compromises made by the great powers in pursuit of various self interested security objectives in the context of the Cold War.”5 In November 2022, over two years after the widescale emergence of COVID-19, the international community met to review the BWC for the ninth time. In early 2022, the prospects for strengthening the BWC were the best they had been in years as China, Russia, and the United States had articulated individual plans that reflected enough common ground to craft a workable compromise.6 This cautious optimism around the BWC’s improvement prospects were spoiled by Russia’s invasion of Ukraine in February of 2022. The illegal aggression of Russia undermined the rules-based international order that the BWC is intertwined with. As part of the invasion, Russia also deliberately fabricated allegations levied against Ukraine, the United States, and other partners7 which “stigmatizes and politicizes biosafety, biosecurity, and cooperative public health and life sciences research to the detriment of not just Ukraine, but global health security overall.”8 Efforts to misrepresent or undermine legitimate biosafety and biosecurity research and capacity building weaken the BWC and undermine international cooperation for peaceful purposes.”

“Bringing New Technologies to Bear for Biosurveillance”

Biodefense PhD program alumnus and Schar School adjunct faculty member Daniel M. Gerstein recently coauthored this piece for Food Safety Magazine, which explains in its introduction “Public health, agriculture, the environment, and the food supply could be severely affected by the presence of infectious agents that occur naturally, are the result of accidents, or are intentionally introduced. Yet today, the capability to detect these biological pathogens effectively and rapidly is lacking. This shortfall continues, despite recent key technological advances that could alter the biosurveillance landscape…The foundations of biosurveillance lie in the One Health concept, which the World Health Organization defines as “an integrated, unifying approach that aims to sustainably balance and optimize the health of people, animals, and ecosystems.”1 This approach acknowledges the direct relationship between the health outcomes of people, animals, and ecosystems. What affects one, affects all.”

“Teetering on the Edge: Retaliatory Strikes Between Iran and Israel”

Schar School faculty member Mahmut Cengiz recently published this article with Homeland Security Today, writing in his introduction “Once again, tensions are rising in the Middle East, and the continuous cycle of retaliatory strikes between Iran and Israel could lead to unintended consequences and jeopardize security in the region. The Hamas terrorist attacks on October 7, 2023, marked a significant turning point in the history of terrorism and its impact on regional dynamics in the Middle East. These attacks resulted in the deaths of more than 1,300 Israelis, prompting severe retaliatory measures from Israeli forces. However, Israel’s counterterrorism efforts have faced strong criticism due to the casualties of over 33,000 Palestinians and the destruction of thousands of buildings in Gaza. The disproportionate number of civilian casualties, particularly women and children, has sparked debate regarding the legitimacy of terrorist operations in the region. The Tehran regime has promptly engaged in the conflict to pursue regional and global opportunities.”

“Statement of the G7 Non-Proliferation Directors Group, G7 Italy 2024”

The G7 Non-Proliferation Directors Group recently released their statement ahead of the G7 meeting in Italy this June. Their statement covers numerous areas, including nuclear safeguards, conventional weapons, AI and emerging technologies, and more. On biological and chemical weapons, they explain in part “The G7 reaffirms its strongest commitment to effective multilateral actions against the proliferation of all weapons of mass destruction and their means of delivery. As such, we continue to stress the centrality of the Chemical Weapons Convention (CWC) and the Biological and Toxin Weapons Convention (BTWC), and the importance of ensuring their full and effective implementation and universalization.”

Read the entire statement here.

“Strengthening Global Biosecurity and Biosafety Efforts: The Role of the BWC National Implementation Database in Informing and Guiding National Policies”

Jaroslav Krasny recently authored this blog post for the National University of Singapore’s Centre for International Law, explaining in part “The Biological Weapons Convention National Implementation Database (“BWC Database”), developed collaboratively by the United Nations Institute for Disarmament Research (UNIDIR) and the Verification Research, Training and Information Centre or VERTIC, serves as a resource for understanding and supporting the implementation of the Biological Weapons Convention (BWC). This new database compiles information on how State Parties meet their obligations under the BWC. It is designed to assist a wide range of stakeholders, such as government officials, legal professionals, researchers, non-governmental organizations, international bodies, and the private sector, by providing access to detailed information on national implementation practices. The objective is to support compliance with the BWC and contribute to global efforts in biosecurity and biosafety by making relevant information accessible to all interested parties.”

“NTI Convenes the First International AI-bio Forum”

From the Nuclear Threat Initiative: “NTI | bio convened more than 25 high-level biosecurity professionals, AI experts, and policymakers for the inaugural meeting of the International AI-Bio Forum. Participants included representatives from industry, such as Anthropic and Google DeepMind, experts from China, India, Nigeria, the U.K., the U.S., and representatives from multilateral institutions. The virtual meeting was held on April 10-11 and focused on defining the scope, institutional structure, and initial priorities of the International AI-Bio Forum to position it for success in reducing risks associated with rapidly advancing AI-enabled capabilities to engineering living systems.”

Read more here.

“Fighting ‘Smart’ Pandemics: Mitigating Risks and Harnessing the Potential of AI for Biosecurity”

This report was produced by Foreign Policy Analytics with support from the Coalition for Epidemic Preparedness Innovations (CEPI): “Each year, FP Analytics (FPA) invites practitioners, experts, and thought leaders to participate in interactive, scenario-based simulations that foster dialogue and seek innovative solutions to pressing global issues. In February 2024, FPA partnered with the Coalition for Epidemic Preparedness Innovations (CEPI) and the Munich Security Conference (MSC) to produce a simulation, “Fighting ‘Smart’ Pandemics.” The simulation built upon a multistakeholder roundtable discussion that FPA and CEPI co-hosted on the sidelines of the 2023 UN General Assembly, which highlighted the intersection of AI and biosecurity as a key priority area warranting deeper and sustained engagement from global leaders. CEPI, alongside the International Pandemic Preparedness Secretariat, has led a “100 Days Mission” to enable the design, testing, and development of pandemic countermeasures within 100 days of an epidemic or pandemic threat’s emergence, a goal supported by the G7 but not yet realized.”

“A National Security Insider Does the Math on the Dangers of AI”

This Wired piece covers an interview with Jason Matheny, CEO of the RAND Corporation, and his thoughts on AI advancement making it easier to create biological and other weapons. In it, he explains his transition from working in public health to focusing on national security and how this has shaped his thinking, saying in part “When I first started getting interested in biosecurity in 2002, it cost many millions of dollars to construct a poliovirus, a very, very small virus. It would’ve cost close to $1 billion to synthesize a pox virus, a very large virus. Today, the cost is less than $100,000, so it’s a 10,000-fold decrease over that period. Meanwhile, vaccines have actually tripled in cost over that period. The defense-offense asymmetry is moving in the wrong direction.”

“Strengthening Biosecurity in Southeast Asia”

DTRA’s Andrea Chaney recently authored this piece that covers the recently-concluded Southeast Asia Strategic Biosecurity Dialogue. She explains in part, “In the context of Southeast Asia’s increasingly complex biosecurity landscape, dialogue participants engaged in several roundtable discussions covering a range of biosafety and biosecurity topics. Participants brought a broad scope of expertise, including health, defense and law enforcement, biology and biotechnology, international relations, and non-proliferation. The discussions encompassed Southeast Asia’s regional biosecurity priorities; building resilience to future threats; laboratory biosecurity and biosafety; the convergence of biology and emerging technologies; medical countermeasures development, production, and stockpiling strategies; and the role of the military in biosecurity.”

“Emerging Biotechnology Capacity and Emerging Biosecurity Threats in Colombia and Chile”

Steve S. Sin recently published this section in a report from the Army War College, “Emerging Technologies and Terrorism: An American Perspective”: “With the onset of the COVID-19 pandemic, countries around the world came to recognize the importance of maintaining a national stockpile of biologics (for example, vaccines) and, if possible, possessing domestic capabilities to produce the biologics required to fight the spread of communicable diseases. In South America, Colombia and Chile at one point possessed robust vaccine production capabilities but abandoned them decades ago.1 Although some within these countries called for a renewal of their vaccine production capabilities, the calls went unheard—that is, until the COVID-19 pandemic. As the world weathered the pandemic and countries scrambled to secure the vaccines needed to combat it, Colombia and Chile decided they would return to producing biologics domestically as well as double down on their already-active biotechnology policies that had been designed to encourage public-private partnerships and attract foreign investments.”

“Biotech Matters: Public-Private Coordination of Biotechnology”

Richard Danzig recently authored this piece for CNAS, writing in part “The U.S. successes and failings during the COVID-19 pandemic, combined with perceptions that China vigorously coordinates its public and private sectors, generated calls for an American industrial policy that would further orchestrate biotechnology work in the United States. In this context, the natural tendency is to regard improved coordination as straightforwardly achievable through improved processes and enlightened leadership…The nation would be well advised, however, to recognize that the difficulties are more deeply rooted than simply failures of will, imagination, or efficiency. Three deep-seated problems impede progress.”

APIC Emerging Infectious Diseases HPAI Playbook

The Association for Professionals in Infection Control and Epidemiology regularly publishes playbooks for specific diseases, including a new one for Highly Pathogenic Avian Influenza: “To help infection preventionists quickly activate Highly Pathogenic Avian Influenza (HPAI) prevention efforts, APIC’s Emerging Infectious Diseases Task Force has created an HPAI Playbook that IPs can download and customize for use in their facilities. The Playbook is a concise workflow document that is designed to be user-friendly and operational for busy IPs.”

“The Viral Most Wanted: The Hantaviruses”

CEPI’s Kate Kelland recently authored this latest entry in CEPI’s Viral Most Wanted focused on the hantaviruses, writing in the work’s introduction: “The Albuquerque Journal, a newspaper in the U.S. state of New Mexico, ran an alarming headline in its May 27th edition in 1993: “MYSTERY FLU KILLS 6 IN TRIBAL AREA”. The article told a story that had first come to light two weeks earlier, when a 19-year-old man was rushed to the emergency department of the Indian Medical Centre in Gallup.”

“The man, a Native American from the Navajo tribe, had been travelling with his family to his fiancée’s funeral when he began struggling to breathe in the car’s back seat. The family veered off the road to call for an ambulance. Both the first responders and, later, the emergency room doctors tried to revive the victim with cardiopulmonary resuscitation, but their efforts were in vain. The young man’s lungs were flooded with fluid. He had effectively drowned.”

“The ER doctors were shocked, not only at the speed and dramatic nature of the man’s death, but by the similarity of the case to that of a young woman a few weeks earlier who had suffered the same symptoms and also died.” 

“Over the next few weeks, more than a dozen more people in the area contracted the deadly disease, many of them young Navajos.”  

“During the same period, doctors and public health officials tried desperately to identify what was causing the outbreak. On June 11th, 1993, the weekly Morbidity And Mortality report from the U.S. Centers for Disease Prevention and Control (CDC) revealed that the mystery pathogen was “a previously unrecognized Hantavirus”.” 

“The novel viral villain belonged to the Hantavirus family—a group of viruses normally carried by rats, mice and other rodents and known to cause severe disease in people. The Hantavirus family is one of The Viral Most Wanted.“

“Public Health Preparedness: Mpox Response Highlights Need for HHS to Address Recurring Challenges”

The Government Accountability Office recently published this report on HHS’ response to the mpox outbreak in the United States: “Health and Human Services was initially charged with coordinating the federal response to a 2022 global outbreak of mpox—a smallpox-related virus.”

“State and local jurisdictions cited challenges in the federal response such as difficulty accessing and using vaccines and tests, which may have led to unnecessary suffering. We added HHS’s leadership and coordination of public health emergencies to our High Risk List earlier in 2022 due to similar issues in past responses.”

“We recommended that HHS adopt a coordinated, department-wide program that incorporates input from external stakeholders to identify and resolve challenges.”

“Deadly Diseases and Inflatable Suits: How I Found My Niche in Virology Research”

Nikki Forrester recently authored this spotlight piece for Nature covering the career of  Hulda Jónsdóttir: “Virologist Hulda Jónsdóttir studies some of the world’s most pathogenic viruses at the Spiez Laboratory in Spiez, Switzerland. For her, highly pathogenic viruses are more often a source of curiosity than of concern. Jónsdóttir, who runs a research group at the Spiez Laboratory, regularly dons a giant, inflatable protective suit to research disinfectants and antiviral compounds to combat several lethal viruses, including Ebola virus and Lassa virus. Jónsdóttir spoke to Nature about carving her own path in virology research and why she chose to pursue a career in Switzerland and at the Spiez Laboratory, which is owned and funded by the Swiss government.”

What We’re Watching 🍿

IR Thinker, Chemical and Biological Weapons – Brett Edwards | 2024 Episode 7

“In this enlightening interview, Dr. Brett Edwards, an expert in chemical and biological weapons, describes the history, current capabilities, and future challenges associated with these formidable weapons systems. Dr. Edwards discusses the evolution of chemical and biological warfare, the verification processes for weapon destruction, and how these weapons integrate into national military strategies. He also addresses the ethical debates surrounding their use, international efforts to control such weapons, and the specific challenges posed by conflicts like the ongoing war in Ukraine.”

Watch here.

ICYMI-Oppenheimer: The Rest of the Story

Middlebury’s James Martin Center for Nonproliferation Studies recently hosted this event with Siegfried Hecker: “Christopher Nolan’s biopic Oppenheimer has captured the interest of nearly 100 million people around the world. Dr. Hecker will provide the back story to some key elements of the film and share his views on the legacy of Oppenheimer and the Manhattan Project, based on his more than five-decades associated with the laboratory Oppenheimer led.”

The event recording is available here.

3rd International Biosecurity Virtual Symposium

From ABSA: “The Symposium will bring together biosecurity professionals from a wide range of disciplines with varying expertise to share their experiences and knowledge on diverse biosecurity topics. The Symposium will offer attendees an opportunity to learn the latest in biosecurity and have thought-provoking conversations about real-world biosecurity issues, concerns, and scenarios.”

This symposium will take place May 7-8. Learn more and register here.

Addressing the Challenges Posed by Chemical and Biological Weapons: Intensive Online Introductory Course for Students of Technical Disciplines

“SIPRI and the European Union Non-Proliferation and Disarmament Consortium (EUNPDC) invite graduate and postgraduate students of the technical or natural science disciplines to apply for an intensive online introductory course on chemical and biological weapons—their proliferation, the efforts to eliminate them, the various mechanisms used to control their spread—and endeavours underway to reduce the risk of chemical or biological agents in terrorist attacks. The course will take place online, during four half-days on 28–31 May 2024, 14:00 to 18:00 Central European Summer Time (CEST).”

“The course will cover the fundamentals of chemical and biological weapons as well as of missiles and other means of delivery; the history of chemical and biological warfare; the evolution of international norms against these weapons; the threats associated with potential terrorist uses of chemical and biological material; bioweapons and other related scientific advances; the current challenges posed by chemical weapons; arms control treaties; and mechanisms to curb the spread of dangerous substances, including export controls.”

“The course will also discuss the role of the EU institutions and industry to address the challenges mentioned above. The course will be instructed by renowned experts on non-proliferation, arms control, disarmament, export controls, verification and related subjects from SIPRI, other European research centres, think tanks and international organizations.”

Learn more and apply here.

Registration for GHS 2024 Now Open

Registration is now open for the Global Health Security 2024 conference in Sydney, Australia. This iteration will take place 18-21 June, 2024. The call for abstracts is also still open. “The mission of the Global Health Security conference is to provide a forum where leaders, researchers, policy-makers, and representatives from government, international organisations, civil society, and private industry from around the world can engage with each other, review the latest research and policy innovations, and agree solutions for making the world safer and healthier. To that end, our mission is to help foster a genuinely multidisciplinary community of practice that is committed to working collaboratively to enhance global health security and eliminate disease, irrespective of its origin or source.”

SBA.3 International Synthetic Biology, and Biosecurity Conference in Africa

“Join us for the SBA.3 International Synthetic Biology and Biosecurity Conference in Africa, a groundbreaking event that brings together experts, researchers, and enthusiasts in the field of synthetic biology. This in-person conference will take place at the Laico Regency Hotel from Wed, Jul 17, 2024 to Friday, Jul 19, 2024.”

“Get ready to dive into the exciting world of synthetic biology and explore its potential applications in Africa. From cutting-edge research to innovative solutions, this conference offers a unique opportunity to learn, network, and collaborate with like-minded individuals.”

“Discover the latest advancements, trends, and challenges in synthetic biology through engaging keynote speeches, interactive workshops, and thought-provoking panel discussions. Immerse yourself in a vibrant atmosphere where ideas flow freely and new connections are made.”

“Whether you’re a seasoned professional or just starting your journey in synthetic biology, this conference provides a platform to expand your knowledge, exchange ideas, and contribute to the growth of the field in Africa.”

“Don’t miss out on this extraordinary event that promises to shape the future of synthetic biology and biosecurity in Africa. Mark your calendars and join us at the SBA.3 International Synthetic Biology and Biosecurity Conference in Africa!”

Learn more and register here.

Applied Biosafety Call for Papers, Special Issue: Biosafety and Biosecurity for Potential Pandemic Pathogens and Dual Use Research of Concern

“The fields of biosafety and biosecurity are crucial to managing risks associated with Potential Pandemic Pathogens (PPPs) and Dual Use Research of Concern (DURC), particularly as novel and reemerging pathogens increasingly impact global health. The Editors of Applied Biosafety are pleased to announce a forthcoming Special Issue focused on the myriad of risks associated with handling, transporting, and researching PPPs and DURC, as well as the measures needed to mitigate these risks effectively. This special issue aims to review and scrutinize existing and forthcoming government policies and regulations to identify gaps in addressing these concerns. It will also explore the integral role played by biosafety and biosecurity professionals in shaping policy and guidance.”

Learn more here.

Job Openings at the Institute for Progress

Senior Biotechnology Fellow

“Our biotechnology portfolio explores how we can advance policies that improve U.S. state capacity to accelerate and shape promising innovations in biotechnology and biotechnology governance. Innovations in biology may finally deliver cures to HIV, malaria, influenza, and some cancers. New AI models are unfolding the secrets of the molecular world before our eyes. Spurred by the urgency of the pandemic, we are now closer than ever before to developing technologies to prevent future such outbreaks.”

“Biotechnology fellows are expected to have a keen interest in these issues. Under the guidance of the IFP team, they will explore and become experts in specific biotechnology topics, both from a technology and policy perspective. Fellows will interact with policymakers, write articles and white-papers, and more. We encourage fellows to pursue creative routes that they think might have significant counterfactual policy impact.”

Biotechnology Fellow

“Biotechnology fellows are expected to have a keen interest in these issues and the ways the U.S. government supports and oversees them. Under the guidance of the IFP team, they will explore and become experts in specific biotechnology topics, both from a technical and policy perspective. Fellows will interact with policymakers, write articles and white papers, and more – we encourage fellows to pursue creative routes that they think might have significant counterfactual policy impact.”

Learn more and apply to these positions here.

Job Opening at Blueprint Biosecurity

“Blueprint Biosecurity is seeking a full-time Program Director to build and lead our portfolio of work on personal protective equipment (PPE). We are seeking a proactive leader who thrives in a dynamic and evolving environment. You will have a high degree of autonomy to design and steer a pioneering program that aims to advance the state of PPE for pandemic prevention. This effort will build on the roadmap for Pandemic Proof PPE, developing goals and objectives to translate our ambitious vision into tangible outcomes. A successful candidate will be excited about building an effort from the ground up and willing to pivot and iterate to find ways to succeed.”

“In this role, you will be working collaboratively with other teams within and external to Blueprint Biosecurity. The ideal candidate will have excellent interpersonal abilities and strong skills in project management, strategic prioritization, research, and analysis.”

Learn more and apply here.

Pandora Report 3.22.2024

Happy Friday! This week’s Pandora Report covers progress on the ninth round of negotiations on a Pandemic Accord and proposed amendments to the International Health Regulations, Murthy v. Missouri and the evolving threat of health and medical misinformation, a recently launched Senate biodefense and life science research investigation, EPA’s warnings about cyberattacks against the United States’ water infrastructure and more.

Global Leaders Call for Urgent Agreement on a Pandemic Accord

More than 100 global leaders have made a call “to press for an urgent agreement from international negotiators on a Pandemic Accord, under the Constitution of the World Health Organization, to bolster the world’s collective preparedness and response to future pandemics,” according to a recent WHO press release. It comes as member states of the WHO look to finalize an agreement that would amend the 2005 International Health Regulations (IHR), which will be considered by the World Health Assembly in May. David P. Fidler explains what is at stake during this ninth round of deliberations in a recent piece for CFR’s Think Global Health, writing in part “WHO documents on the negotiations, along with commentary parsing the talks, indicate that WHO member states have much to do in a short period to deliver final drafts of a pandemic agreement and amended IHR to the World Health Assembly. Unresolved issues include problems that have long confounded global health governance, including equitable access to pharmaceutical products, financing for public health capacity-building, and government accountability. Even if the negotiations achieve breakthroughs on those problems, the task of turning reforms on paper into reality in practice confronts a world in which solidarity is increasingly in short supply.”

The letter challenges those who argue such amendments will harm national sovereignty, reading in part, “A new pandemic threat will emerge; there is no excuse not to be ready for it. It is thus imperative to build an effective, multisectoral, and multilateral approach to pandemic prevention, preparedness, and response. Given the unpredictable nature of public-health risks, a global strategy must embody a spirit of openness and inclusiveness. There is no time to waste, which is why we are calling on all national leaders to redouble their efforts to complete the accord by the May deadline.”

“Beyond protecting countless lives and livelihoods, the timely delivery of a global pandemic accord would send a powerful message: even in our fractured and fragmented world, international cooperation can still deliver global solutions to global problems.”

SCOTUS Hears Case Concerning Social Media Platforms, Pandemic Misinformation

The Supreme Court heard arguments this week in Murthy v. Missouri, a case concerning the First Amendment and whether the Biden administration violated the right to freedom of expression in its communications with social media companies regarding COVID-19-related misinformation. The lawsuit, one of 26 filed against the administration by former Missouri Attorney General Eric Schmitt, alleges that the Biden administration was “…working with social media giants such as Meta, Twitter, and YouTube to censor and suppress free speech, including truthful information, related to COVID-19, election integrity, and other topics, under the guise of combating ‘misinformation.”

NYT‘s Dani Blum explains how this has refocused attention on misinformation and its evolving nature, writing in part “Health hacks not backed by science have spread widely on social media platforms. The same kinds of conspiracy theories that helped to fuel vaccine hesitancy during the Covid-19 pandemic are now undermining trust in vaccines against other diseases, including measles, as more people have lost confidence in public health experts and institutions. And rapid developments in artificial intelligence have made it even harder for people to tell what’s true and what’s false online.”

Blum continues, writing “Misinformation commonly includes “fake experts,” according to Sander van der Linden, a professor of social psychology in society at Cambridge who researches misinformation. These are either people making health claims who do not have any medical credentials, or doctors making statements about topics that they are not experts in. “You wouldn’t want to go to an ear and nose doctor to do a heart operation,” he said. “Is this a vaccine expert, or is this a doctor who actually does no research and has no expertise on vaccinations?”’

The effects of this are being keenly felt by healthcare providers. Amanda Johnson, a primary care physician in New York City, told USA Today about her approach to working with patients who have fallen victim to such information, saying “(Frustration) doesn’t get us anywhere. I think those conversations are more likely to go poorly if you take it as a personal affront.”

The same article explains further that “She has talked about misinformation with patients, some of whom have even asked her to review social media posts they’ve seen. The most animated responses come from patients who believe they’re losing control or having something forced on them, said Johnson, who also leads NYC Health + Hospitals’ AfterCare program for New Yorkers recovering from COVID-19 or living with long COVID.”

“Many people are disparaging or dismissive when talking about people who believe misinformation, but it can happen to anyone, said Sedona Chinn, an assistant professor in the life sciences communication department at the University of Wisconsin-Madison.”

Senate Homeland Security and Governmental Affairs Committee Announces Bipartisan Biodefense and Life Science Research Investigation

In a statement this week, the Senate Homeland Security and Governmental Affairs Committee announced, “U.S. Senators Gary Peters (D-MI) and Rand Paul (R-KY), Chairman and Ranking Member of the Homeland Security and Governmental Affairs Committee, announced a joint investigation of national security threats posed by high-risk biological research and technology in the U.S. and abroad. Peters and Paul plan to hold hearings and conduct government-wide oversight on areas including high-risk life science research, biodefense, synthetic biology, biosafety and biosecurity lapses, early warning capabilities for emerging outbreaks or possible attacks, and potential origins of the COVID-19 pandemic. This bipartisan oversight effort will assess and identify measures to mitigate longstanding and emerging risks and threats that may result in serious biological incidents – whether deliberate, accidental, or natural. The investigation will also seek to increase transparency and strengthen oversight of taxpayer-funded life sciences research, laboratories in the U.S. and abroad, and detection of biological threats.”

This is likely to add fire to efforts to impose new restrictions on contracted Chinese research firms like WuXi AppTec, as highlighted by Axios. At the same time, this will likely further reveal partisan divides on the topic, particularly given Paul’s emphasis on the Biden administration’s alleged efforts to conceal critical information about the COVID-19 pandemic.

EPA Confirms China- and Iran-Backed Hackers Are Targeting US Drinking Water Systems

“The country’s water systems are being hit with an increasing number of nation-state cyberattacks, according to the US Environmental Protection Agency (EPA),” explains a recent news article. In a recent letter to governors from EPA Administrator Michael Regan and National Security Adviser Jake Sullivan, the pair wrote ‘“We need your support to ensure that all water systems in your state comprehensively assess their current cybersecurity practices.”’ They also emphasized that, in many cases, “even basic cybersecurity precautions, are not present at water treatment facilities, urging that this “can mean the difference between business as usual and a disruptive cyberattack.”

CNN reports that “The EPA will also set up a “task force” to “identify the most significant vulnerabilities of water systems to cyberattacks,” among other pressing issues, Regan and Sullivan said in their letter. The Biden officials invited state homeland security and environmental officials to a meeting to discuss cybersecurity improvements needed in the water sector.”

This comes after industrial equipment at multiple water facilities in the US was hacked late last year, displaying an anti-Israel message, according to US officials. The administration blamed the Iranian government for these attacks. Hackers backed by the Chinese state have also recently infiltrated US water facilities, in “…a hacking campaign that the Biden administration worries Beijing could use to disrupt critical infrastructure in the event of a conflict with the US. China denies the allegations.”

US Hosts Launch for New Foreign Ministry Channel for Global Health Security

Recently, the US Department of State announced that Ambassador John Nkengasong – U.S. Global AIDS Coordinator and Senior Bureau Official for Global Health Security and Diplomacy, overseeing the Department’s Bureau for Global Health Security and Diplomacy – hosted a day-long discussion program to help plan priorities and review lines of efforts for the recently created Foreign Ministry Channel for Global Health Security.

The Department’s press statement explains that “The Channel builds on the 2022-2023 COVID-19 Pandemic Prioritized Global Action Plan for Enhanced Engagement (GAP).  The meeting is the first in a series of regular engagements between senior officials within Ministries of Foreign Affairs to focus diplomatic attention and action on critical global health security priorities.  The foreign ministries, and participants from other ministries, will build on progress in this first meeting to elevate global health security issues as a national security imperative, enhance pandemic preparedness, and advance concrete global health security deliverables.  Participants will collaborate on global efforts to:

  • Strengthen pandemic prevention and early-warning capacities
  • Address misinformation and disinformation on health issues, and leverage emerging technologies to strengthen global health security
  • Mitigate the human health impacts of climate change utilizing the One Health approach, which recognizes the interconnectedness of human, animal, and environmental health
  • Enable sustainable medical countermeasures for health emergencies
  • Enhance diplomatic workforce capacity on health security.”

“‘Lab Leak’ Proponents at Rutgers Accused of Defaming and Intimidating COVID-19 Origin Researchers”

Jocelyn Kaiser covers a recent formal complaint filed with Rutgers University regarding the conduct of molecular biologist Richard Ebright and microbiologist Bryce Nickels, both employed by the university. Kaiser explains in the news piece for Science, “But now, their targets have had enough. A dozen scientists filed a formal complaint with Rutgers yesterday alleging that the two faculty members have violated the university’s policies on free expression by posting “provably false” comments that are often defamatory, and that some of their actions could even threaten scientists’ safety.”

Read more here.

“How to Better Research the Possible Threats Posed by AI-Driven Misuse of Biology”

Matthew E. Walsh recently authored this piece for The Bulletin of the Atomic Scientists, writing in part “Nonetheless, researchers have conducted experiments that aim to evaluate sub-components of biological threats—such as the ability to develop a plan for or obtain information that could enable misuse. Two recent efforts—by RAND Corporation and OpenAI—to understand how artificial intelligence could lower barriers to the development of biological weapons concluded that access to a large language model chatbot did not give users an edge in developing plans to misuse biology. But those findings are just one part of the story and should not be considered conclusive.”

“An Action Plan to Increase the Safety and Security of Advanced AI”

This action plan from Gladstone AI was completed following the release of an October 2022 State Department assessment of proliferation and security risks posed by weaponized and misaligned AI. The plan-“Defense in Depth: An Action Plan to Increase the Safety and Security of Advanced AI“-explains in part of its introduction that “This action plan is a blueprint for that intervention. Its aim is to increase the safety and security of advanced AI by countering catastrophic national security risks from AI weaponization and loss of control. It was developed over thirteen months, and informed by conversations with over two hundred stakeholders from across the U.S., U.K., and Canadian governments; major cloud providers; AI safety organizations; security and computing experts; and formal and informal contacts at the frontier AI labs themselves. The actions we propose follow a sequence that:
● Begins by establishing interim safeguards to stabilize advanced AI development,
including export controls on the advanced AI supply chain;
● Leverages the time gained to develop basic regulatory oversight and strengthen
U.S. government capacity for later stages;
● Transitions into a domestic legal regime of responsible AI development and
adoption, safeguarded by a new U.S. regulatory agency; and
● Extends that regime to the multilateral and international domains.”

“Government Commissioned Report: AI is Creating New Categories of Weapons of Mass Destruction”

This recent article in the Claims Journal covers the aforementioned report from the State Department focused on WMD threats and AI: “A U.S. State Department-commissioned report asserts that advanced artificial intelligence is creating entirely new categories of weapons of mass destruction-like (WMD-like) and WMD-enabling catastrophic…The risks associated with these developments are global, have deeply technical origins and are quickly evolving, leaving policymakers with diminishing opportunities to introduce safeguards to balance these considerations and ensure advanced AI is developed and adopted responsibly.”

Read more here.

“Why Are Large AI Models Being Red Teamed?”

Natasha Bajema covers AI red teaming in this piece for IEEE Spectrum, writing in part “In February, OpenAI announced the arrival of Sora, a stunning “text-to-video” tool. Simply enter a prompt, and Sora generates a realistic video within seconds. But it wasn’t immediately available to the public. Some of the delay is because OpenAI reportedly has a set of experts called a red team who, the company has said, will probe the model to understand its capacity for deepfake videos, misinformation, bias, and hateful content.”

“Red teaming, while having proved useful for cybersecurity applications, is a military tool that was never intended for widespread adoption by the private sector.”

‘“Done well, red teaming can identify and help address vulnerabilities in AI,” says Brian Chen, director of policy from the New York–based think tank Data & Society. “What it does not do is address the structural gap in regulating the technology in the public interest.”’

“Biodefense in the FY25 President’s Budget Request”

Lillian Parr and Dan Regan recently published this blog post with CSR’s Nolan Center in which they compare the FY25 budget request to the FY24 Continuing Resolution. They explain “On Monday, March 11, the Biden Administration released the President’s Budget Request (PBR) for Fiscal Year 2025. While the final budget appropriations bills enacted by Congress will likely differ substantially from this request, the PBR provides useful insight into the Administration’s priorities. This blog post will highlight a few notable funding lines and trends for biodefense-focused programs…The initial tranche of the PBR documents, namely the Budget of the United States Government and the budget-in-briefs from each agency, state the priority budget items and highlight significant changes in funding. This analysis is largely based on these highlights and the topline budget numbers available. Over the next several weeks the agencies will complete the release of their budget justification books, which contain the highest level of detail on budgetary resourcing. Once all of the final justification books are released, we’ll announce our updated CSR Biodefense Budget Breakdown.”

“Public Health Emergency Medical Countermeasures Enterprise Multiyear Budget: Fiscal Years 2023-2027”

ASPR recently released the Public Health Emergency Medical Countermeasure Enterprise (PHEMCE) Multiyear Budget (MYB) for fiscal years 2023-2027. “The report assesses funding needs to support medical countermeasure priorities, which would allow the U.S. Government to prepare for the next public health threat. The MYB projects an estimated overall funding need of $79.5 billion over the five-year period, an increase of $15.5 billion over the 2022-2026 report. The MYB is not a budget request and does not replace funding levels requested in the President’s Budget or accompanying documents.”

“The MYB forecasts to Congress and external stakeholders the funding required to fully prepare the country for a range of chemical, biological, radiological, and nuclear threats, without regard to the competing priorities considered in the President’s Budget. The MYB also illustrates the support needed for other key priorities — such as supporting innovative approaches to medical countermeasure (MCM) development and fostering clear, scientifically supported regulatory pathways for MCMs.”

“Ready or Not 2024: Protecting the Public’s Health from Diseases, Disasters, and Bioterrorism”

From Trust for America’s Health: “As the nation experiences an increasing number of infectious disease outbreaks and extreme weather events, TFAH’s Ready or Not 2024: Protecting the Public’s Health from Diseases, Disasters, and Bioterrorism report identifies key gaps in national and state preparedness to protect residents’ health during emergencies and makes recommendations to strengthen the nation’s public health system and improve emergency readiness.”

“Op-Ed: Proposed LDTs Rule Threatens Outbreak Containment”

Linoj Samuel and Erin Graf, Chair and Vice Chair of the American Society for Microbiology’s Clinical and Public Health Microbiology Committee respectively, recently authored this opinion piece discussing how federal regulations currently under consideration might harm the effectiveness of of laboratory-developed tests for fast-moving outbreaks. They write in part, “The Food and Drug Administration (FDA) recently proposed a rule that would require the same premarket approval for LDTs as it does for medical devices, such as prosthetic joints or pacemakers. The potential rule could bring significant harm to patients by limiting the clinical microbiology and public health laboratories that serve them. The medical device pathway under consideration is designed for commercially developed medical devices. It’s ill-suited to regulate LDTs, and it’s especially at odds with the realities of infectious disease testing. If adopted, the FDA’s rule will disincentivize clinical and public health labs from developing and deploying essential LDTs. It will create gaps in diagnosis and care, and it could potentially impact underserved communities the most.”

“Clinical, Biomarker, and Research Tests Among US Government Personnel and Their Family Members Involved in Anomalous Health Incidents”

Chan, Hallett, and Zalewski recently published this article in JAMA: “Questions  Do US government officials and their family members involved in anomalous health incidents (AHIs) differ from control participants with respect to clinical, biomarker, and research assessments?”

“Findings  In this exploratory study that included 86 participants reporting AHIs and 30 vocationally matched control participants, there were no significant differences in most tests of auditory, vestibular, cognitive, visual function, or blood biomarkers between the groups. Participants with AHIs performed significantly worse on self-reported and objective measures of balance, and had significantly increased symptoms of fatigue, posttraumatic stress disorder, and depression compared with the control participants; 24 participants (28%) with AHIs presented with functional neurological disorders.”

“Meaning  In this exploratory study, there were no significant differences between individuals reporting AHIs and matched control participants with respect to most clinical, research, and biomarker measures, except for self-reported and objective measures of imbalance; symptoms of fatigue, posttraumatic stress, and depression; and the development of functional neurological disorders in some.”

“Russia Appears to Be Using Chemical Weapons in Ukraine. And Admitting It.”

Matt Field covers the debate over the validity of Ukraine’s claims that Russia is using CW in the ongoing war in Ukraine for The Bulletin of the Atomic Scientists, writing in part “For Lennie Phillips, a former inspector for the Organisation for the Prohibition of Chemical Weapons (OPCW), which implements the Chemical Weapons Convention, some of Ukraine’s claims appear credible, including a segment on Russian state-controlled TV that included an interview with a man the US embassy in The Hague reports is a Russian soldier discussing the effectiveness of chemicals as weapons. “The piece on Russia’s Channel [One] alone makes the use of tear gas by the [Russian Federation] very credible,” Phillips, now a research fellow at the UK defense think tank RUSI, said.”

“The Centre for Chemistry and Technology and the Future of the OPCW”

Ian Anthony recently published this paper with the Stockholm International Peace Research Institute: “With the destruction of the final remaining stockpiles of declared chemical weapons in 2023, the Organisation for the Prohibition of Chemical Weapons (OPCW) must adjust to a new role. The inauguration of the OPCW’s Centre for Chemistry and Technology (CCT) in 2023 provides a new resource to assist the organization and the international community in reducing and eliminating the threat from chemical weapons.”

“Now that the CCT is operational, it is important to build momentum behind a substantive programme of work. Projects for the programme could be grouped into four thematic categories: understanding technological developments; chemical forensics; broadening geographical representation; and tailored training programmes.”

“The CCT should be led by a director, who should work with a newly established Office of Science and Technology to develop the centre’s strategic direction. To provide the CCT with stable and secure financing, a trust fund for the CCT should be established.”

Report Release Webinar: Future State of Smallpox Medical Countermeasures

From National Academies of Science and Medicine: “Join the Committee on Current State of Research, Development, and Stockpiling of Smallpox Medical Countermeasures as it discusses its newly released report Future State of Smallpox Medical Countermeasures on Tuesday, March 26, 2024.”

Learn more and join the discussion here.

Artificial Intelligence and Automated Laboratories for Biotechnology: Leveraging Opportunities and Mitigating Risks

From the National Academies’ Board on Life Sciences: “Please join us April 3-4, 2024 for a hybrid workshop on the opportunities and mitigation of risks of the use of artificial intelligence and automated laboratories (i.e., self-driving labs) for biotechnology.”

“The workshop will consider opportunities to leverage AI and laboratory automation capabilities for discovery and development, explore methods and approaches to identify, track, and forecast the domestic and international development of such technologies, and convene experts across sectors to highlight recent advances and explore implications for the development and use of these technologies.”

Learn more and register here.

Launch of the 2024 National Blueprint on Biodefense

From the Bipartisan Commission on Biodefense: “On the 10th anniversary of its inception, the Bipartisan Commission on Biodefense will release its 2024 National Blueprint on Biodefense: Immediate Action Needed to Defend Against Biological Threats.”

“Please join us for this momentous event at the Congressional Auditorium, Capitol Visitor Center, on April 17th at 4:30pm.”

“The Bipartisan Commission on Biodefense (formerly the Blue Ribbon Study Panel on Biodefense) was established in 2014 to provide a comprehensive assessment of the state of United States biodefense efforts and to issue recommendations that foster change.  Subsequently, the Commission has briefed White House Administrations (including then Vice President Biden); testified before Congress; convened numerous meetings with experts; released 12 reports; produced the graphic novel Germ Warfare; and mobilized biodefense conversations and actions in the private and public sectors.”

Learn more and register here.

Addressing the Challenges Posed by Chemical and Biological Weapons: Intensive Online Introductory Course for Students of Technical Disciplines

“SIPRI and the European Union Non-Proliferation and Disarmament Consortium (EUNPDC) invite graduate and postgraduate students of the technical or natural science disciplines to apply for an intensive online introductory course on chemical and biological weapons—their proliferation, the efforts to eliminate them, the various mechanisms used to control their spread—and endeavours underway to reduce the risk of chemical or biological agents in terrorist attacks. The course will take place online, during four half-days on 28–31 May 2024, 14:00 to 18:00 Central European Summer Time (CEST).”

“The course will cover the fundamentals of chemical and biological weapons as well as of missiles and other means of delivery; the history of chemical and biological warfare; the evolution of international norms against these weapons; the threats associated with potential terrorist uses of chemical and biological material; bioweapons and other related scientific advances; the current challenges posed by chemical weapons; arms control treaties; and mechanisms to curb the spread of dangerous substances, including export controls.”

“The course will also discuss the role of the EU institutions and industry to address the challenges mentioned above. The course will be instructed by renowned experts on non-proliferation, arms control, disarmament, export controls, verification and related subjects from SIPRI, other European research centres, think tanks and international organizations.”

Learn more and apply here.

Registration for GHS 2024 Now Open

Registration is now open for the Global Health Security 2024 conference in Sydney, Australia. This iteration will take place 18-21 June, 2024. The call for abstracts is also still open. “The mission of the Global Health Security conference is to provide a forum where leaders, researchers, policy-makers, and representatives from government, international organisations, civil society, and private industry from around the world can engage with each other, review the latest research and policy innovations, and agree solutions for making the world safer and healthier. To that end, our mission is to help foster a genuinely multidisciplinary community of practice that is committed to working collaboratively to enhance global health security and eliminate disease, irrespective of its origin or source.”

SBA.3 International Synthetic Biology, and Biosecurity Conference in Africa

“Join us for the SBA.3 International Synthetic Biology and Biosecurity Conference in Africa, a groundbreaking event that brings together experts, researchers, and enthusiasts in the field of synthetic biology. This in-person conference will take place at the Laico Regency Hotel from Wed, Jul 17, 2024 to Friday, Jul 19, 2024.”

“Get ready to dive into the exciting world of synthetic biology and explore its potential applications in Africa. From cutting-edge research to innovative solutions, this conference offers a unique opportunity to learn, network, and collaborate with like-minded individuals.”

“Discover the latest advancements, trends, and challenges in synthetic biology through engaging keynote speeches, interactive workshops, and thought-provoking panel discussions. Immerse yourself in a vibrant atmosphere where ideas flow freely and new connections are made.”

“Whether you’re a seasoned professional or just starting your journey in synthetic biology, this conference provides a platform to expand your knowledge, exchange ideas, and contribute to the growth of the field in Africa.”

“Don’t miss out on this extraordinary event that promises to shape the future of synthetic biology and biosecurity in Africa. Mark your calendars and join us at the SBA.3 International Synthetic Biology and Biosecurity Conference in Africa!”

Learn more and register here.

Eighth Annual Next Generation for Biosecurity Competition Open for Applications

“The Eighth Annual Next Generation for Biosecurity Competition is now open. NTI | bio hosts this competition to provide a platform for the next generation of global leaders in biosecurity to develop original concepts and share them with the wider biosecurity community. This year’s co-sponsors include 80,000 Hours, the Global Health Security Network, the iGEM Foundation, the International Federation of Biosafety Associations, the Next Generation Global Health Security Network, Pandemic Action Network, SynBio Africa, and Women of Color Advancing Peace, Security, and Conflict Transformation.“

“This year, the competition invites innovative and creative papers focused on how investments in biosecurity can both contribute to a more equitable society and reduce biological risks. The full prompt is provided below.”

“Winners of the Biosecurity Competition will be awarded the following:

  • Online publication of their paper on the NTI website
  • The opportunity to attend a high-profile international biosecurity event, such as the Biological Weapons Convention, and present their paper at a prestigious side event.”

Learn more here.

Nonproliferation Review and CNS Announce McElvany Award Winners

“The Nonproliferation Review and the James Martin Center for Nonproliferation Studies (CNS) are pleased to announce that an article examining the George W. Bush administration’s policies toward the nuclear programs of Iran and South Korea, “A tale of two fuel cycles: defining enrichment and reprocessing in the nonproliferation regime” by Sidra Hamidi and Chantell Murphy, has won the Doreen and Jim McElvany Nonproliferation Award’s grand prize.”

“In examining the Bush administration’s policies toward two states with advanced nuclear fuel cycles, Hamidi and Murphy’s article also explores the various US and international definitions of uranium enrichment and spent-fuel reprocessing. Its analysis draws on the concept of “technopolitics,” the study of the mutually reinforcing processes by which political priorities shape technological systems while technology also limits and creates new kinds of politics.”

Read more here.

Pandora Report 2.2.2024

This week’s Pandora Report covers newly introduced legislation that could ban foreign biotech companies like BGI Group from doing business in the US, OpenAI’s evaluation of large language model-aided biological risks, interesting new publications, upcoming events, and multiple announcements.

BGI Group, Other Foreign Biotech Companies Targeted by New US Bills

Recently, members of the House Select Committee on the CCP and the Senate Homeland Security and Governmental Affairs Committee introduced legislation that would ban foreign adversary bioetchnology companies from doing business in the United States, including BGI Group. This follows years of warnings from the Intelligence Community that Chinese companies are amassing American genetic information, threatening national security. As we discussed in 2022, “Early in the pandemic, as the US struggled to build testing capacity and states could not run their own tests in their state labs, BGI Group (formerly known as Beijing Genomics Institute) targeted US state governments with cheap tests that promised to rapidly increase their capacity. The problem, however, was that BGI is known to have used its NIFTY test, a prenatal test used by pregnant people globally, to collect data in collaboration with the People’s Liberation Army, the military wing of the CCP.”

The Pentagon explicitly acknowledged BGI Group’s collaboration with the PLA in 2021, and five subsidiaries and affiliates of the company have since been sanctioned by the US Department of Commerce. However, according to NBC News, “The U.S. National Counterintelligence and Security Center reacted to the Reuters report by warning that “non-invasive prenatal testing kits marketed by Chinese biotech firms serve an important medical function, but they can also provide another mechanism for the People’s Republic of China and Chinese biotech companies to collect genetic and genomic data from around the globe,” the center said.”

BGI Group responded, stating in part “BGI fully embraces the bill’s premise of protecting Americans’ personal data. Unfortunately, this legislation will succeed only in driving BGI out of the US and will not accomplish its stated goal. Rather, the bill will further strengthen the effective market monopoly held by one company that controls more than 90 percent of the market, resulting in increased healthcare costs and limited access to technologies and services.”

The company further denied that it is controlled by the PRC government, CCP, or PLA, emphasizing that it is a privately owned company. However, PRC data security laws implemented in recent years ensure the government is able to access data collected by private Chinese companies and those doing business with Chinese citizens.

Check out our March 2023 reporting on the US Department of Commerce’s addition of three BGI Group subsidiaries to the Entity List.

Open AI Announces Blueprint for LLM-Aided Biological Threat Creation

OpenAI, the organization responsible for ChatGPT, announced this week that it is developing a blueprint for “evaluating the risk that a large language model (LLM) could aid someone in creating a biological threat,” following recent concerns that the platform and others like it could aid potential bioterrorists.

The company explained in a statement that “In an evaluation involving both biology experts and students, we found that GPT-4 provides at most a mild uplift in biological threat creation accuracy. While this uplift is not large enough to be conclusive, our finding is a starting point for continued research and community deliberation.”

Read more about OpenAI’s evaluation and blueprint here.

“Who Are Iran-Backed Militia Groups Targeting U.S. Bases in the Middle East?”

Schar School faculty member Mahmut Cengiz for Homeland Security Today: “Iran-backed militia groups have increasingly targeted the United States (U.S.) military bases and facilities in the Middle East after Hamas’s October 7th terrorist attacks. The U.S. airstrikes continuously retaliate from these groups and target their facilities. The most recent one took place on January 24th and targeted the facilities of Kataib-s Hezbollah in Iraq. However, these militia groups used an uncrewed aerial system and attacked the Tower 22 U.S. military outpost in Jordan on January 27, 2023, killing three U.S. service members and wounding 40 others. The Islamic Resistance in Iraq (IRI) claimed responsibility for this attack.”

“The operational capacity of Iran-backed militia groups has threatened U.S. interests in the region, given the fact that these groups recently seem to be more capable and organized than even jihadist terrorist groups in Iraq, Yemen, and Syria. This article uses the Global Terrorism Trends and Analysis Center (GTTAC) Records of Incidents Database (GRID) and examines active terror groups backed by Iran in the Middle East.”

Read more here.

“NTI Begins Scoping New International AI-Bio Forum”

From NTI: “Significant advances in artificial intelligence (AI) in recent years offer tremendous potential benefits for modern bioscience and bioengineering by supporting the rapid development of vaccines and therapeutics, enabling the development of new materials, fostering economic development, and helping fight climate change. However, AI-bio capabilities—AI tools and technologies that enable the engineering of living systems—also could be accidentally or deliberately misused to cause significant harm, with the potential to cause a global biological catastrophe.”

“To reduce biosecurity risks that arise at the intersection of AI and the life sciences, NTI | bio convened experts in the fields of synthetic biology, machine learning, bioinformatics, and international security policy on January 11, 2024 to outline steps toward establishing an international AI-Bio Forum.”

Read more here.

“Towards Risk Analysis of the Impact of AI on the Deliberate Biological Threat Landscape”

Matthew E. Walsh recently authored this article: “The perception that the convergence of biological engineering and artificial intelligence (AI) could enable increased biorisk has recently drawn attention to the governance of biotechnology and artificial intelligence. The 2023 Executive Order, Executive Order on the Safe, Secure, and Trustworthy Development and Use of Artificial Intelligence, requires an assessment of how artificial intelligence can increase biorisk. Within this perspective, we present a simplistic framework for evaluating biorisk and demonstrate how this framework falls short in achieving actionable outcomes for a biorisk manager. We then suggest a potential path forward that builds upon existing risk characterization work and justify why characterization efforts of AI-enabled tools for engineering biology is needed.”

“Lessons from Kazakhstan for 2024: On the Front Lines of Nuclear and Biological Risks”

From CSR: “The paper starts with a section on Kazakhstan’s past and current roles regarding nuclear risks, and continues with a section on its past and current roles regarding biological risks. Each section starts with a summary of the Soviet weapons of mass destruction legacy that Kazakhstan inherited upon independence. We then provide an overview of Kazakhstan’s decision to relinquish and eliminate these legacies, followed by a discussion of the nation’s unique current roles regarding the NPT and IABS. In each of these sections, we include pertinent background to show why progress in 2024 is central to the international community, remaining confident that existing norms and agreements will persist and be implemented as intended.”

“We then conclude the paper with brief recommendations on how Kazakhstan can leverage its past decisions and current leadership roles to drive such progress, summarized here. First, Kazakhstan and other nations playing key roles in the NPT process should elevate the urgency of reducing the role of nuclear weapons. There is also an opportunity to parse how this might be pursued, in particular in calling for an end to tactical nuclear weapons as one concrete step. Second, Kazakhstan should continue the push within the NPT forum for a nuclear weapons database and universal reporting template to encourage trust and mitigate miscalculation risks. Third, Kazakhstan should continue to pursue the IABS in the manner it has over the past year: driving dialogue on the most important ways such an entity could augment the existing international system and begin filling some of its gaps, and scoping what an achievable launch of the IABS would look like. Finally, while Kazakhstan is presently playing unique leadership roles, no single nation can make progress alone. We hope that all nations will cooperate in advancing concrete steps for the 2026 NPT Review Conference and help perpetuate positive discourse regarding a future IABS.”

“Addressing Misconceptions About Biological and Chemical Weapons and Related Legal Frameworks”

From VERTIC: “This webpage and the related report form the primary outputs of a project undertaken by VERTIC in 2022 and 2023, funded by the UK Chemical and Biological Weapons, Counter Proliferation and Arms Control Centre of the Foreign, Commonwealth and Development Office. The main purpose of this resource is to disprove misconceptions about chemical and biological weapons and related international instruments. It addresses misconceptions about biological and chemical weapons and related legal frameworks that VERTIC staff have identified through interactions with states over 20 years’ work on these treaties, and from other sources such as the media. Each misconception is broken down into an explanation of the misconception and its implications, and how to address it. The misconceptions are then disproved through factual and legal discussions, supported by expert commentary.”

Countering WMD Journal

From USANCA: “Published semi-annually, this edition of the Countering WMD Journal includes articles from authors across the CWMD community on a range of topics relevant to professionals in this field. We would like to publicly acknowledge all the effort put forth by the contributors to the 27th Edition.”
 
“Among the articles published in the 27th Edition are “The CWMD ‘Operational Void” by Mr. Paul Sigler and Maj. James Bowen, “Avoiding Strategic Miscalculation” by Maj. Kirk Shoemaker, and “A Unique Solution to Nuclear Reactor Parameter Centralization: Streamlining the Search and Analysis of WMD Reactors of Concern” by Cadet Aaron Calhoun and Cadet Matthew Eckert. New sections in this edition of the journal include book reviews and “Journal Article Watch” by Dr. Jeffrey Rolfes, which spotlights policy and scientific research of interest to the CWMD community.”

“Protein Design Meets Biosecurity”

From Science: “The power and accuracy of computational protein design have been increasing rapidly with the incorporation of artificial intelligence (AI) approaches. This promises to transform biotechnology, enabling advances across sustainability and medicine. DNA synthesis plays a critical role in materializing designed proteins. However, as with all major revolutionary changes, this technology is vulnerable to misuse and the production of dangerous biological agents. To enable the full benefits of this revolution while mitigating risks that may emerge, all synthetic gene sequence and synthesis data should be collected and stored in repositories that are only queried in emergencies to ensure that protein design proceeds in a safe, secure, and trustworthy manner.”

Read this editorial here.

WHO Releases Draft Decision on Strengthening Laboratory Biological Risk Management

The WHO recently uploaded this draft decision proposed by the EU and the US.

“Integrating Veterinary Diagnostic Laboratories for Emergency Use Testing during Pandemics”

Hodges et al. recently published this article in Emerging Infectious Diseases: “The SARS-CoV-2 pandemic showed limitations in human outbreak testing. Veterinary diagnostic laboratories (VDLs) possess capabilities to bolster emergency test capacity. Surveys from 26 participating VDLs found human SARS-CoV-2 testing was mutually beneficial, including One Health benefits. VDLs indicated testing >3.8 million human samples during the pandemic, which included some challenges.”

“ASPR TRACIE 2023 Year in Review”

From ASPR TRACIE: “In September 2023, ASPR TRACIE celebrated our eighth anniversary; by the end of 2023, we cumulatively tallied nearly 2 million visits to our website and responded to close to 12,000 TA requests (while maintaining a 99% user satisfaction rating). For close to four years, we have addressed a surge of COVID-19- specific TA requests (over 3,000 TA were related to COVID-19), maintained 20 COVID-19-specific resource collections, and created/refreshed nearly 100 resources to help our stakeholders make their way through this unprecedented challenge. As communities grappled with concurrent disasters and mass casualty incidents, our team worked hard to ensure our website remained available 24/7 and our materials were supportive and timely.”

Read more here.

“An Open Letter to World Leaders: Now Is the Time to Lead and Achieve an Ambitious, Legally-Binding Pandemic Accord”

A recently signed letter from “more than 40 senior representatives from The Elders, The Global Preparedness Monitoring Board, The Independent Panel, Pandemic Action Network, The Panel for a Global Public Health Convention and Spark Street Advisors”: “Therefore, our Chairs, leaders, and members of the Secretariat have come together for the first time to sign this open letter to world leaders.“

“They outline the need for leadership, urgency and commitment to conclude a pandemic accord that goes well beyond business as usual, and guarantees the equitable access, finance and accountability needed to make COVID-19 the last pandemic of such devastation.”
“Their call represents their ongoing commitment to continue to advocate for a world protected from pandemics, and their knowledge that business as usual will absolutely not do.”

Read more here.

“The Pipeline for Pandemic Products is Bare. Here’s Why It Matters”

Jenny Lei Ravelo recently published this article in Devex: “One of the key concepts born out of the COVID-19 pandemic is the 100 Days Mission, an initiative endorsed by the Group of Seven major economies and the Group of 20 industrialized and emerging-market nations whose goal is to have effective diagnostics, treatments, and vaccines within 100 days of a public health emergency declaration.”

“But a new report reveals serious gaps in the clinical pipeline for diseases with pandemic potential, and limited investments in their research and development over the years.”

“There are no approved treatments and very few in clinical trials for diseases with high fatality rates, such as Marburg and Nipah. There are also no diagnostics in late-stage clinical development for Zika and SARS.”

Read more here.

“Why Drug Resistance is Becoming One of Our Biggest Global Health Security Blind-Spots”

Manica Balasegaram recently authored this piece for the World Economic Forum, writing in part “Antimicrobial resistance (AMR) is already one of the biggest global killers, with nearly 5 million deaths a year. Yet, few people know what it is, let alone the threat it poses to them. One reason for this is its insidious nature. AMR likely won’t hit us hard and fast like a pandemic; instead we’ll see a steady rise in cases of treatable infections becoming once again untreatable, with even minor infections or medical procedures becoming life-threatening.”

“In time, the 23-year global increase in life expectancy we have experienced thanks to antibiotics could be steadily reversed. Given that all this could be prevented, perhaps one of the things that makes drug resistance now one of our greatest global health security threats is the very fact that too few people view it as one.”

“Knowledge Is Power in the Fight Against Synthetic Opioids”

From DHS S&T: “The Department of Homeland Security’s (DHS) Homeland Security Investigations recently announced in its Strategy for Combating Illicit Opioids that the agency has seized more than 54,000 pounds of fentanyl and interdicted over 2.2 million pounds of synthetic drug precursor chemicals over the last five years. Still, overdose deaths continue to rise, and the ways opioids reach users constantly evolve.”

“The Science and Technology Directorate (S&T) is working with partners at every government level on opioid detection and is curtailing the illicit flow of fentanyl into the country, both cornerstones of the Biden Administration’s Unity Agenda Strategy for defeating the overdose epidemic. S&T’s Chemical Security Analysis Center (CSAC), the preeminent national laboratory dedicated to identifying and assessing chemical threats, has been researching opioids since its establishment in 2006 and currently has a number of efforts focusing on combating the threat that synthetic opioids pose.”

Read more here.

What We’re Listening To 🎧

Poisons and Pestilence Bonus Episode: The French Connection with Etienne Aucouturier

“In this episode, we examine the development of the French CBW programme  post WW-2″.

NEW: Enhancing the Global Food System’s Resilience to Biological Threats

“This virtual event, hosted by the Scowcroft Institute of International Affairs at Texas A&M, will take place on February 20, 1:00-2:30 PM [CST].”

“A year after the Biden Administration’s National Security Memorandum on Strengthening the Security and Resilience of United States Food and Agriculture (NSM-16), Scowcroft is convening stakeholders from across industry, academia, and government to identify the policies and technologies needed to safeguard the world’s food system against biological threats. Planned topics include microbial food production, AI-enabled crop disease surveillance, and genomic engineering to improve plant disease resistance, among others.”

“For more details, find a draft agenda here. 

Speakers include:

  • David Stiefel, National Security Policy Analyst, National Security Division, USDA and former Director for Biodefense on the National Security Council
  • Nils Justen, Policy Analyst, National Security Commission on Emerging Biotechnology (NSCEB)
  • Shannon Nangle, CEO and Co-Founder, Circe Biosciences 
  • Seth Murray, Professor Butler Chair, Soil and Crop Sciences, Texas A&M University
  • Yiping Qi, Professor, Plant Sciences and Landscaping, University of Maryland”

Register here.

NEW: The Advancing Threat Agnostic Biodefense Webinar Series

From PNNL: “Join us as we welcome Dr. Tony Goldberg, professor in the School of Veterinary Medicine at the University of Wisconsin-Madison. His talk, titled “Assessing the Zoonotic Risk of Pre-emergent Viruses” will be Tuesday, February 20, at noon PT.“

“Exploration of the “virosphere” is in its golden age. The sheer number of new viruses discovered daily, and the fact that most cannot be cultured, creates enormous uncertainty about where to allocate attention and resources. It is not an intractable problem, however, to distinguish those few viruses that are likely to emerge as zoonoses from the many others that are not. This talk describes two diametric approaches to addressing this problem.”

Learn more and register here.

NEW: Introducing IBBIS: Safeguarding Bioscience and Biotechnology for a Safer Future

“The Nuclear Threat Initiative (NTI) is launching the International Biosecurity and Biosafety Initiative for Science (IBBIS) during an official side event at the 2024 Munich Security Conference. IBBIS is a new, independent organization based in Geneva that will work with global partners to strengthen biosecurity norms and develop innovative tools to uphold them. IBBIS will help reduce the risk of catastrophic events that could result from deliberate abuse or accidental misuse of bioscience and biotechnology so they can flourish, safely and responsibly.”

“NTI Co-Chair and CEO Ernest J. Moniz will moderate a senior-level panel discussion featuring: Weiwen Zhang, director, Center for Biosafety Research and Strategy, Tianjin University; James Diggans, head of biosecurity, Twist Bioscience; Luciana Borio, venture partner, ARCH Venture Partners and senior fellow for global health, Council on Foreign Relations; and Piers Millett, executive director, IBBIS. Amandeep Gill, UN Secretary General’s Envoy on Technology, will provide recorded remarks.”

This in-person event will take place at Literaturhaus München on Thursday, February 15. Learn more and RSVP here.

NEW: Presidential Advisory Council on Combating Antibiotic-Resistant Bacteria Public Meeting

“The 24th PACCARB public meeting will be held virtually on February 22, 2024. This will be the second of two meetings to address the task provided to the PACCARB by the Secretary of HHS to address antimicrobial resistance globally. The focus of the meeting will be on international implementers and the gaps, challenges, and opportunities they see to combat AMR globally – specifically focusing on low- and middle-income countries. Current times are tentative and subject to change.”

This event will take place on February 22, at 9 am. Submit public comments and register to attend here.

NEW: SBA.3 International Synthetic Biology, and Biosecurity Conference in Africa

“Join us for the SBA.3 International Synthetic Biology and Biosecurity Conference in Africa, a groundbreaking event that brings together experts, researchers, and enthusiasts in the field of synthetic biology. This in-person conference will take place at the Laico Regency Hotel from Wed, Jul 17, 2024 to Friday, Jul 19, 2024.”

“Get ready to dive into the exciting world of synthetic biology and explore its potential applications in Africa. From cutting-edge research to innovative solutions, this conference offers a unique opportunity to learn, network, and collaborate with like-minded individuals.”

“Discover the latest advancements, trends, and challenges in synthetic biology through engaging keynote speeches, interactive workshops, and thought-provoking panel discussions. Immerse yourself in a vibrant atmosphere where ideas flow freely and new connections are made.”

“Whether you’re a seasoned professional or just starting your journey in synthetic biology, this conference provides a platform to expand your knowledge, exchange ideas, and contribute to the growth of the field in Africa.”

“Don’t miss out on this extraordinary event that promises to shape the future of synthetic biology and biosecurity in Africa. Mark your calendars and join us at the SBA.3 International Synthetic Biology and Biosecurity Conference in Africa!”

Learn more and register here.

Policy Frontiers: Realizing the Benefits, Managing the Risks of Artificial Intelligence-Driven Biotechnology

From the Center for Health Security: “The conversation will delve into the impact and implementation of the President’s AI Executive Order related to the convergence of AI and biotechnology, challenges and opportunities that still need to be addressed, and Congress’ role in governance of these rapidly evolving technologies.”

“The panel, moderated by Dr. Inglesby, will examine AI in the life sciences and health security, both the potential for advances in pandemic preparedness as well as what needs to be done now to guard against potentially consequential risks of accidents or misuse.”

“A reception including hors d’oeuvres and beverages will follow the program. This is a great opportunity for you to network and engage in meaningful conversations on this timely topic.”

This event will take place on February 8 at 5 pm EST. RSVP here.

ICYMI: CNS Seminar on the Intersection of Artificial Intelligence and WMD Nonproliferation

From CNS: “On January 24, 2024, the James Martin Center for Nonproliferation Studies (CNS) convened a timely seminar to address the intersection of artificial intelligence (AI) and weapons of mass destruction (WMD) nonproliferation.”

“The seminar showcased the wide range of CNS expertise and its collaborative relationships with industry. Dr. Sarah Shoker from Open AI spoke about ongoing efforts to evaluate the potential exploitation of frontier models by nefarious actors seeking WMD capabilities. Dr. Ian Stewart, Head of the CNS DC office, demonstrated how one can leverage cutting-edge AI tools to streamline nonproliferation workflows while Steven de la Fuente discussed how AI approaches can enhance and expedite open-source data collection and imagery analysis. Pivoting to risks, Dr. Allison Berke, Director of the Chemical and Biological Weapons Nonproliferation Program, presented her research assessing the potential dangers of AI-enabled bio-design technologies, which could allow nefarious actors to engineer novel toxins. CNS Scientist-in-Residence Dr. Ferenc Dalnoki-Veress explored classroom applications of AI tools to enhance arms control pedagogy and research through AI agent-based simulations. Dr. Ian Stewart closed out the speaker session by examining emerging policy and governance challenges.”

Read more here.

WEBINAR: State Department 2023 Global Terrorism Data: Trends & Warnings

From Homeland Security Today: “Join HSToday for a Law Enforcement-only analysis of global terrorism trends from 2023 and threat forecasts for 2024. The Department of State’s yearly Annex of Statistical Information Reports uses The Global Terrorism Trends and Analysis Center (GTTAC) database.”

“Dr. Mahmut Cengiz, a senior data analyst at GTTAC since 2018, will discuss terrorism trends from 2023 and areas of concern for law enforcement in the United States (US). More specifically, his analyses will focus on HAMAS and Iran-backed terror groups targeting American facilities in the Middle East, Al Qaeda- and ISIS-affiliated organizations actively involved in terrorist attacks worldwide, increasing far-right terrorism and emerging lone actor threats in the US and Europe. The Terrorism, Transnational Crime and Corruption Center (TraCCC) is the first center in the United States devoted to understanding the links among terrorism, transnational crime and corruption, and to teach, research, train and help formulate policy on these critical issues. TraCCC is a research center within the Schar School of Policy and Government at George Mason University. TraCCC also houses the innovative and highly-respected Anti-Illicit Trade Institute (AITI).”

This event will take place on February 8 at 2 pm EST. Learn more and register here.

GP Nonproliferation and Strategic Trade Hub Virtual Launch & Demo  

“The Strategic Trade Research Institute (STRI) invites you to participate in the Global Partnership Nonproliferation and Strategic Trade Hub Virtual Launch and Demo event taking place on February 27, 2024, from 9:00-10:00 am EST.”

“Please join us to learn about the main features of the Hub, how to use it, and how it can be useful and impactful for nonproliferation and export control professionals. The event will feature Andrea Viski, Director of STRI, as well as introductory remarks from the Hub’s sponsor, the United Kingdom’s Counter-proliferation and Arms Control Center (CPACC).”

Learn more and register here.

International Conference, CBRNE Research & Innovation

“The last 40 years have demonstrated that both military and civilian populations could be exposed to highly hazardous CBRNE agents following conflicts, natural outbreaks and disasters, industrial incidents or terrorist attacks.”

“Worldwide, researchers, responders and industrial capacities have been commited to provide adapted response to these challenges.”

“Building on the success of the first 5 International Conferences « CBRNE Research and Innovation » which took place in Antibes (2015), Lyon (2017), Nantes (2019), on line (2021) and Lille (2022), we want to give you a new opportunity to build up or strengthen collaborative networks in Strabourg (March 19th – 21rst 2024).”

“The CBRNE R&I Conference is specifically devoted to scientific updates, responders’ feedbacks and expression of needs. It also includes workshops and demonstrations of innovative materials, technologies and procedures, according to the following themes: DETECTION – IDENTIFICATION, PROTECTION – DECONTAMINATION, MEDICAL COUNTERMEASURES, RISKS & CRISIS MANAGEMENT.”

“Looking forward to your proposals for communication and to welcoming you at Strasbourg in March 2024!”

Learn more here.

Registration for GHS 2024 Now Open

Registration is now open for the Global Health Security 2024 conference in Sydney, Australia. This iteration will take place 18-21 June, 2024. The call for abstracts is also still open. “The mission of the Global Health Security conference is to provide a forum where leaders, researchers, policy-makers, and representatives from government, international organisations, civil society, and private industry from around the world can engage with each other, review the latest research and policy innovations, and agree solutions for making the world safer and healthier. To that end, our mission is to help foster a genuinely multidisciplinary community of practice that is committed to working collaboratively to enhance global health security and eliminate disease, irrespective of its origin or source.”

High School and College Student Internship: Data Analytics for Elite Young Scholars – Biology and Medical Science Experience

“The Young Scholars Research Program is tailored for high-achieving high school and undergraduate students aspiring to delve into the realms of biology or medical science, with a strong focus on advanced data analytics. Participants will have the unique opportunity to collaborate with esteemed faculty members from GMU, forming interdisciplinary teams comprising 3 to 4 individuals encompassing both high school and undergraduate students.”

“At the outset of the program, students will be assigned to specific team projects based on their indicated preferences. Each team is expected to produce two significant outputs by the program’s conclusion. Firstly, a final paper showcasing their research findings will be published on the Center for Biomedical Science & Policy (CBSP) website and the Schar School Young Scholars Journals Webpage. Secondly, teams will present their projects at a conference where students have the chance to compete for prizes.”

“Throughout the program, participants will engage in hands-on research projects employing a variety of methodologies. This may include but is not limited to, biostatistics utilizing R or Stata, data visualization employing QGIS or ArcGIS, and network visualization using tools like Gephi. The comprehensive nature of the program ensures a rich and immersive experience for students passionate about advancing their understanding and skills in the fields of biology and medical science.”

Learn more here.

Agricultural Bioterrorism Protection Act of 2002; Biennial Review and Republication of the Select Agent and Toxin List

“In accordance with the Agricultural Bioterrorism Protection Act of 2002, we are proposing to amend and republish the list of select agents and toxins that have the potential to pose a severe threat to animal or plant health, or to animal or plant products. This Act requires the biennial review and republication of the list of select agents and toxins and the revision of the list as necessary. This action would implement findings from the biennial review for the list. The biennial review was initiated within 2 years of the completion of the previous biennial review. In addition, we are proposing to add definitions for several terms; codify policies regarding the role of responsible officials and alternate responsible officials, conclusion of patient care, and annual internal inspections; and revise or clarify provisions related to validated inactivation procedures and viable select agent removal methods, recordkeeping, non-possession of select agents and toxins, electronic Federal Select Agent Programs, registration, Tier 1 enhancements, and exclusion of naturally infected animals. We are also proposing to add requirements for reporting discoveries of select agents and toxins, provisions regarding effluent decontamination system, biosafety provisions for facility verification requirements for registered biosafety level 3 and animal biosafety level 3 laboratories, a new requirement related to restricted experiments, and to correct editorial errors. These proposed changes would economically benefit producers, research and reference laboratories, and State and Federal oversight agencies, while also maintaining adequate program oversight of select agents and toxins.”

Read more and submit comments here.

Pandora Report 12.22.2023

Happy first day of winter! This week we are covering updates on Russia’s actions in Ukraine, anthrax outbreaks in parts of Africa, efforts to get the Pandemic and All-Hazards Preparedness Act reauthorized, and OpenAI’s plan to manage threats posed by its AI platforms. This is the last issue of the Pandora Report for 2023. We will see you next year but, until then, have a happy rest of the holiday season!

Russia Tear Gases Ukrainian Forces

Recent reporting from CNN explained that, in addition to using wave after wave of convicts-turned-recruits, Russia has increasingly begun to use CS gas on Ukrainian forces: “Those fighting in besieged Ukrainian trenches say they now face another threat: the use of gas as a weapon. Nine incidents have been recorded in recent weeks in this area, one Ukrainian combat medic told CNN, in which a caustic and flammable gas had been dropped by drones onto Ukrainian lines, causing one fatality. The gas is used to cause panic and followed by conventional shelling or drone attacks, soldiers impacted said…A Ukrainian intelligence official told CNN the substance deployed by the Russians was a form of CS gas.”

CS (chlorobenzylidenemalononitrile) gas, commonly referred to colloquially as tear gas, is used as a riot control agent. According to the CDC, these agents “…are chemical compounds that temporarily make people unable to function by causing irritation to the eyes, mouth, throat, lungs, and skin.” Use of these agents in war is prohibited under the Chemical Weapons Convention.

The same CNN report later explained that “Two soldiers who survived a gas attack showed CNN medical reports indicating they had been poisoned. “At first I saw smoke,” one told CNN. “We ran out from the trench and the gas suddenly caught fire. The trench was in flames. This gas burns, blinds you, you can’t breathe, shoots down your throat immediately. We didn’t even have a second.”‘

“The alleged use of chemical agents on the battlefield marks another sign of the brutality and mendacity of Russia’s renewed fight for the terrain it lost. Ukraine had hoped for greater advances during the summer toward the Azov Sea, yet now must defend its minor gains.”

Russian Troops Reportedly Dying from “Mouse Fever”

Russian troops in Ukraine’s Kharkiv region are reportedly suffering an outbreak of “mouse fever,” a hemorrhagic fever. Ukraine’s Main Directorate of Intelligence of the Ministry of Defence of Ukraine (HUR) recently reported that “dissatisfaction is growing in the units of the Russian occupation army due to inadequate provision of winter clothing and a complete lack of medical care,” likely contributing to the rapid spread of this disease.

The Kyiv Post also explained that HUR reports that complaints about the outbreak on the front lines fell on deaf ears, with Russian leadership viewing them as “…another manifestation of attempts to avoid combat operations.” HUR has also reported that the disease initially presents with flu-like symptoms, and that it is a viral disease transmitted to humans from rodents via contact with bodily fluids. As the same Kyiv Post article explains, “Symptoms of mouse fever include severe headache, fever up to 40 degrees, rashes and redness, low blood pressure, hemorrhages in the eyes, nausea, and vomiting several times a day. The disease also affects the kidneys, a person infected with mouse fever experiences intense low back pain and will have serious difficulty urinating.”

HUR’s reporting on the outbreak did not identify a specific pathogen, though it did suggest this could be hemorrhagic fever with renal syndrome (HFRS), driving online speculation that this outbreak was caused by a hantavirus despite some outlets reporting it was caused by the bacterial rat-bite fever. The WHO explains that HFRS is “…an acute interstitial nephropathy characterized by high fever and varying degrees of renal insufficiency and hemorrhage. HFRS is caused by viruses belonging to the old world lineage of the Hantavirus genus of the family Bunyaviridae.”

The WHO further explains that “Various haemorrhagic fevers with a very similar syndrome have been reported throughout Europe and Asia, notably HFRS in the former Soviet Union, Songo fever in China, epidemic nephritis or epidemic haemorrhagic fever in Eastern Europe and Japan, and Hantaan virus in Korea. Several rodents and other small mammals harbor hantaviruses, and in urban areas, where rodent control is feasible, efforts can be made to reduce contact between humans and rodent excreta.”

Regardless of what is causing this outbreak, this is a tale as old as time. War and disease go hand-in-hand, highlighting the importance of maintaining sanitary practices, particularly when turning to trench warfare. Russia’s military has historically struggled with maintaining sanitary conditions, as noted by Amnesty International in the late 1990s and Russia’s own inspectors in the early 2010s, all of which has conicided with persistent challenges in professionalizing the military and maintaining supply lines during the current conflict.

Five African Countries Report Anthrax Outbreaks

The WHO has confirmed that five countries in eastern and southern Africa are experiencing outbreaks of anthrax, with at least 20 related deaths reported since the start of 2023. There are currently over 1,160 presumed anthrax cases in Kenya, Malawi, Uganda, Zambia, and Zimbabwe, though only 35 have been confirmed by laboratory testing. Zambia is currently fighting its largest anthrax outbreak since 2011, with nine of its ten provinces impacted. Though experts say this all is not unusual nor unreasonable, it is notable that, in Uganda, many of the presumed cases have tested negative for anthrax, potentially indicating a different disease is circulating.

The WHO explained in its December 11 press release on the matter that, “The outbreaks are presenting varied patterns in the affected countries. In Kenya, three deaths have been reported this year compared with zero fatalities from over 200 suspected cases in 2022. While the disease is endemic in animals in Malawi, the country reported its first ever human case this year. Human anthrax cases have been reported in three districts in Uganda, with 13 deaths compared with two deaths in 2022. The high case fatality ratio is due to patients reporting late to health facilities. In Zimbabwe, human cases have been reported every year since 2019, underscoring the need for stronger preventive actions.”

“Joint multidisciplinary teams have deployed at country level to support assessments, identify gaps and take measures to strengthen the outbreak response. WHO is also working closely with the Food and Agriculture Organization of the United Nations (FAO), United Nations Environment Programme and World Organisation for Animal Health to coordinate response in the affected countries leveraging the One Health Platforms…The outbreaks are likely being driven by multiple factors, including climatic shocks, food insecurity, low risk perception and exposure to the disease through handling the meat of infected animals.”

115 Organizations Urge Congress to Reauthorize PAHPA

A list of 115 organizations is formally calling on Congress to reauthorize the bipartisan Pandemic and All-Hazards Preparedness Act (PAHPA), according to a press release from the Senate Health, Education, Labor and Pensions (HELP) Committee. PAHPA expired on September 30 and has yet to be reauthorized by Congress, though the HELP Committee did pass legislation to reauthorize it in a 17-3 vote this summer.

The HELP Committee explained in its statement “Congress first enacted PAHPA in 2006, largely to address the failures of the federal response following Hurricane Katrina. The legislation sought to support states, local governments, and hospitals so they would be better prepared for future emergencies. It established the Office of the Assistant Secretary for Preparedness and Response (ASPR) and the Biomedical Advanced Research and Development Authority (BARDA). It also made improvements to the National Disaster Medical System and other resources to improve medical surge capacity during an emergency. PAHPA was previously reauthorized on a bipartisan basis in 2013 and 2019.”

A list of the 115 organizations involved is available at the link above.

OpenAI Unveils Plan for Managing AI Dangers

OpenAI, the company perhaps most famous for its ChatGPT chatbot, recently announced how it plans to prepare for what it believes to be potential threats posed by the technology it develops. A recent article from The Washington Post explains the plan, reading “OpenAI’s “Preparedness” team, led by MIT AI professor Aleksander Madry, will hire AI researchers, computer scientists, national security experts and policy professionals to monitor the tech, continually test it and warn the company if it believes any of its AI capabilities are becoming dangerous. The team sits between OpenAI’s “Safety Systems” team, which works on such existing problems as infusing racist biases intoAI, and the company’s “Superalignment” team, which researches how to ensure AI doesn’t harm humans in an imagined future where the tech has outstripped human intelligence completely.”

“The preparedness team is hiring national security experts from outside the AI world who can help OpenAI understand how to deal with big risks. It is beginning discussions with organizations, including the National Nuclear Security Administration, which oversees nuclear technology in the United States, to ensure the company can appropriately study the risks of AI, Madry said.”

“The team will monitor how and when OpenAI’s tech can instruct people to hack computers or build dangerous chemical, biological and nuclear weapons, beyond what people can find online through regular research. Madry is looking for people who “really think, ‘How can I mess with this set of rules? How can I be most ingenious in my evilness?’”

“Dr. Jomana Musmar, MS, PhD – Designated Federal Officer and Executive Director – PACCARB”

Check out this conversation with Biodefense PhD Program alumna Jomana Musmar on the Progress, Potential, and Possibilities YouTube channel: “Dr. Jomana Musmar, MS, PhD, is the Designated Federal Officer and Executive Director of the Presidential Advisory Council on Combating Antibiotic Resistant Bacteria ( https://www.hhs.gov/ash/advisory-comm… ), and Senior Public Health Advisor within the Office of Infectious Diseases and HIV/AIDS Policy ( https://www.hhs.gov/oidp/index.html ), at the U.S. Department of Health and Human Services (HHS).”

“The Presidential Advisory Council on Combating Antibiotic-Resistant Bacteria ( PACCARB – https://www.hhs.gov/ash/advisory-comm… ) is a US federal advisory committee that provides advice, information, and recommendations to the U.S. Secretary of Health and Human Services (HHS Secretary). The council supports and evaluates U.S. government activities focused on fighting antimicrobial resistance (AMR) in human health, animal health, and environmental health. Using this One Health approach, members of the PACCARB have expertise from a range of backgrounds, including academia, industry, public health, advocacy, veterinary, and agricultural production.”

“Dr. Musmar has been managing the PACCARB since its establishment in 2015, during which time she has hosted 24 public meetings and overseen the development of seven reports providing recommendations on a range of issues related to antimicrobial-resistance (AMR) for both human and animal health.”

“Dr. Musmar has over 10 years of Federal Advisory Committee experience, with a focus on the areas of public health, biodefense, and AMR. Her graduate degrees include a Master’s in Biomedical Science Policy from Georgetown University School of Medicine and a Doctorate in Biodefense and Homeland Security from George Mason University.”

“The Health Security Outcomes of APEC and the Biden-Xi Dialogue”

Recent Biodefense MS grad Sophie Hirshfield just published this piece for CSIS, addressing key global health questions following the APEC summit and Biden-Xi meeting. She explains in her introduction, “From November 14 to 16, leaders from the 21-member Asia-Pacific Economic Cooperation (APEC) group met in San Francisco to discuss promoting trade and economic growth across the Pacific region. On the sidelines of the forum, Presidents Joe Biden and Xi Jinping convened for their first in-person meeting in a year. While the meetings provided an opportunity to keep public health priorities on the diplomatic agenda, they led to few meaningful new commitments on U.S.-China health security cooperation.”

“Public Health Agencies Are Using AI Chatbots to Ease Workloads. Is It a Good Idea?”

Biodefense PhD Student Kimberly Ma recently published this piece with The Bulletin of the Atomic Scientists. In it, she explains in part, “There’s a real risk that large-language models like ChatGPT contribute to online disinformation and misinformation. In a call earlier this year for the safe and ethical use of AI, the World Health Organization (WHO) worried that AI responses “can appear authoritative and plausible to an end user” but be “completely incorrect or contain serious errors, especially for health-related” matters. Similarly, the organization warned AI may be “misused to generate and disseminate highly convincing disinformation in the form of text, audio or video content that is difficult for the public to differentiate from reliable health content.” Just as media organizations have been caught publishing AI-generated content riddled with inaccuracies, public health workers need to ensure they are not accidentally producing well-intentioned deliverables with critical errors. And in an environment when adversarial countries, antivaxxers, and politicians operate individually or in networks to spread disinformation online, public health agencies will be up against bad actors with the same technology they have.”

“Preparing for the Next Pandemic Response Through Strengthened Collaboration”

Donnel Harvin, a member of the Schar School faculty, recently co-authored this white paper for NEMA: “This report synthesizes the insights from the National Emergency Management Association (NEMA) Pandemic Workshop hosted in June of 2023. The Centers for Disease Control and Prevention (CDC) funded the project. The workshop brought together emergency management directors and state public health officers from eight states to discuss their collaborative response to the COVID-19 pandemic in the very early phases of the response, January 2020 – January 2022. The particular focus was on the identification of friction points, successes, and opportunities for increased collaboration. Federal partners were invited to discuss issues with federal integration into state COVID-19 response efforts. The discussions highlighted a range of complex issues encompassing roles and authorities, data collection and sharing, equity concerns, and communication, with an emphasis on state and local levels as well as rural and urban experiences.”

“Advancing Governance Models for Frontier for AIxBIO: Key Takeaways and Action Items from the Johns Hopkins Center for Health Security Metting with Industry, Government, and NGOs, 29 November 2023”

Johns Hopkins Center for Health Security recently published a “…summary of high-level findings that identify concrete next steps needed following its recent convening of leading AI labs, executive branch officials, and biosecurity experts…” that “was informed by discussions during a not-for-attribution meeting hosted by the Center. The meeting was attended by around 50 participants, including those from 6 different leading AI companies as well as government officials from the White House and several government agencies with responsibility for managing potential AIxBio risks.”

The report calls for “…the creation of an ongoing public-private forum to facilitate the sharing of important information related to biosecurity risks; a regulatory framework that defines mandatory practices, reporting, and oversight of highly capable AI models; and a legal accountability framework to incentivize developers and deployers of models to adequately address emergent risks.”

“Generative AI and Weapons of Mass Destruction: Will AI Lead to Proliferation?”

Ian Stewart unpacks potential proliferation threats posed by LLMs in this Medium post, writing in part “Large Language Models (LLMs) caught popular attention in 2023 through their ability to generate text based on prompts entered by the user. LLMs have also proven capable of generating code, summarizing text, and adding structure to unstructured text, among others. There remain questions around the real-world usefulness of LLMs in many domains, particularly given some of the difficulties in solving limitations of LLMs such as hallucination. Nonetheless, some have raised concerns about the ability of LLMs to contribute to nuclear, chemical and biological weapons proliferation (CBRN). Put simply, could a person learn enough through an interaction with an LLM to produce a weapon? And if so, would this differ from what the individual could learn by scouring the internet?”

“Poll: Voters Support Bringing EU-Style AI Regulations to the US, Prioritizing Safety Over Speed in Research”

New from the Artificial Intelligence Policy Institute: “A new poll conducted by the Artificial Intelligence Policy Institute (AIPI) shows that the American public supports the passage of the European Union’s AI Act by nearly a 4:1 margin, and 64% support similar regulation in the United States.”

“The survey showed strong public support for a slowdown of AI research and skepticism of tech companies; respondents decisively back federal regulation that curbs rapid AI research and development by private companies. By a 2:1 margin, respondents agree that it is the role of the government to make sure companies don’t go too fast when developing AI models. 75% say the government should restrict what private companies can do when training AI models.”

“AIPI also surveyed public opinion on risky research initiatives across AI development and dangerous virus research—particularly relevant as scientists and the federal government look to revise guidelines on potential pandemic pathogens. 83% of the public is in agreement that the federal government should implement renewed oversight protocols on research experiments using dangerous viruses. When prompted about AI being in such research, 68% say that we should be concerned that bad actors could use AI to create biological weapons.”

“Shaping the Future US Bioeconomy Through Safety, Security, Sustainability, and Social Responsibility”

Attal-Juncqua et al. recently published this article in Trends in Biotechnology: “Biomanufacturing practitioners and researchers describe the norms that should govern the growing, global field, to include safety, security, sustainability, and social responsibility. These ‘4S Principles’ should be broadly adopted so that the future of the field may provide the greatest benefits to society.”

“Stability of Pathogens on Banknotes and Coins: A Narrative Review”

Meister et al. recently published this article in the Journal of Medical Virology: “For the prevention of infectious diseases, knowledge about potential transmission routes is essential. Pathogens can be transmitted directly (i.e. respiratory droplets, hand-to-hand contact) or indirectly via contaminated surfaces (fomites). In particular, frequently touched objects/surfaces may serve as transmission vehicles for different clinically relevant bacterial, fungal, and viral pathogens. Banknotes and coins offer ample surface area and are frequently exchanged between individuals. Consequently, many concerns have been raised in the recent past, that banknotes and coins could serve as vectors for the transmission of disease-causing microorganisms. This review summarizes the latest research on the potential of paper currency and coins to serve as sources of pathogenic viral, bacterial, and fungal agents. In contrast to the current perception of banknotes and coins as important transmission vehicles, current evidence suggests, that banknotes and coins do not pose a particular risk of pathogen infection for the public.”

What We’re Watching 🍿

The Biological Weapons Convention and the Need for a Compliance and Verification Mechanism

New from the Geneva Center for Security Policy: “The GCSP’s Head of Arms Control and Disarmament speaks to three experts on biological security from King’s College London about the start of discussions by the States Parties to the Biological Weapons Convention (BWC) on compliance and verification. They discuss why a compliance and verification mechanism is needed, what can be learned from the previous verification efforts in other contexts, and what has changed in how verification is done since this was last discussed in the BWC framework over 20 years ago. The experts also discuss what the key elements of any mechanism will need to be, what are the most important bio security incidents, and how countries are working on their preparedness to respond to such incidents. The GCSP will be following the discussions in the BWC closely and stands ready to be a platform to bring together all stakeholders to generate new thinking to strengthen the BWC to respond to today’s bio security challenges.”

What We’re Listening To 🎧

PODCAST | Rethinking Our Defense Against Unknown Biothreats

“Dr. Harshini Mukundan, Program Manager and Scientist for Chemical and Biological Technologies at the Office of National and Homeland Security, Lawrence Berkeley National Laboratory, and visiting Scientist at Los Alamos National Laboratory sat down with host and AAAS STPF fellow Adejare (Jay) Atanda to discuss her research on pathogen agnostic disease detection and diagnostics, why this is important for biodefense against unknown biothreats, the role of technological innovations in pathogen agnostic detection and diagnostics, limitations of existing technological tools, and the vital importance of public-private partnerships in transforming this field. This conversation also covered the challenges women, people of color and immigrants face as scientists, the importance of mentorship in mitigating these challenges and her own mentorship and advocacy work to educate young girls about STEM careers as a AAAS IF/THEN STEM Ambassador and guest on CBS’s “Mission Unstoppable” among other efforts.”

Listen here.

Poisons and Pestilence: 20 Bonus Episode: No Fire No Thunder with Alastair Hay

Check out this episode with Alastair Hay, discussing his work as a toxicologist as it relates to the prohibition of chemical weapons.

61st ISODARCO Course: Nuclear Order and International Security after Ukraine

“The war in Ukraine has had an enormous impact on global security, reviving nuclear fears, undermining the prospects for arms control, and shattering many of the norms and constraints that were the foundation of European security.  ISODARCO 2024 will examine the global nuclear order in light of the Ukraine war, focusing on the states, the policies and the technologies that will shape the future in a much more difficult environment.  How will we cope with this more dangerous world?”

This course will take place January 7-14, 2024, at the University of Trento. Learn more and register here.

International Conference, CBRNE Research & Innovation

“The last 40 years have demonstrated that both military and civilian populations could be exposed to highly hazardous CBRNE agents following conflicts, natural outbreaks and disasters, industrial incidents or terrorist attacks.”

“Worldwide, researchers, responders and industrial capacities have been commited to provide adapted response to these challenges.”

“Building on the success of the first 5 International Conferences « CBRNE Research and Innovation » which took place in Antibes (2015), Lyon (2017), Nantes (2019), on line (2021) and Lille (2022), we want to give you a new opportunity to build up or strengthen collaborative networks in Strabourg (March 19th – 21rst 2024).”

“The CBRNE R&I Conference is specifically devoted to scientific updates, responders’ feedbacks and expression of needs. It also includes workshops and demonstrations of innovative materials, technologies and procedures, according to the following themes: DETECTION – IDENTIFICATION, PROTECTION – DECONTAMINATION, MEDICAL COUNTERMEASURES, RISKS & CRISIS MANAGEMENT.”

“Looking forward to your proposals for communication and to welcoming you at Strasbourg in March 2024!”

Learn more here.

Registration for GHS 2024 Now Open

Registration is now open for the Global Health Security 2024 conference in Sydney, Australia. This iteration will take place 18-21 June, 2024. The call for abstracts is also still open. “The mission of the Global Health Security conference is to provide a forum where leaders, researchers, policy-makers, and representatives from government, international organisations, civil society, and private industry from around the world can engage with each other, review the latest research and policy innovations, and agree solutions for making the world safer and healthier. To that end, our mission is to help foster a genuinely multidisciplinary community of practice that is committed to working collaboratively to enhance global health security and eliminate disease, irrespective of its origin or source.”

Vote: 2023 Arms Control Person(s) of the Year Nominees

“Since 2007, the independent, nongovernmental Arms Control Association has nominated individuals and institutions that have, in the previous 12 months, advanced effective arms control, nonproliferation, and disarmament solutions and raised awareness of the threats posed by mass casualty weapons.”

“In a field that is often focused on grave threats and negative developments, the Arms Control Person(s) of the Year contest aims to highlight several positive initiatives—some at the grassroots level, some on the international scale—designed to advance disarmament, nuclear security, and international peace, security, and justice.”

“Voting will take place between Dec. 8, 2023, and Jan. 11, 2024. The results will be announced on Jan. 12, 2024. Follow the discussion on social media using the hashtag #ACPOY2023.”

Learn about the nominees and vote here.

Pandora Report 12.15.2023

This week covers the FDA’s ongoing investigation into contaminated applesauce, the passing of Gao Yaojie-an activist responsible for bringing to light the extent of China’s AIDS epidemic-, and more.

Biodefense MS Graduates Riley Flynn and Sophie Hirshfield at GMU’s 2023 Winter Commencement Ceremony

FDA Leadership Says Tainted Applesauce Pouches May Have Been Intentionally Contaminated

Cinnamon applesauce pouches available Weis, WanaBanana, and Schnucks have been pulled from shelves after they were found to be contaminated with lead. Dozens of children in the United States have been sickened by the tainted products. Now, the FDA’s Deputy Commissioner for Human Foods, Jim Jones, says they may have been intentionally contaminated.

In an interview with Politico, Jones said “We’re still in the midst of our investigation. But so far all of the signals we’re getting lead to an intentional act on the part of someone in the supply chain and we’re trying to sort of figure that out.” All of the pouches in question were linked to a manufacturing facility in Ecuador that the FDA is currently inspecting.

‘“My instinct is they didn’t think this product was going to end up in a country with a robust regulatory process,” Jones said. “They thought it was going to end up in places that did not have the ability to detect something like this.”’

Politico further explained that “The FDA continues to investigate a number of theories for how the pouches became contaminated, and has not drawn any conclusions about the way the lead was added, why or by whom. The FDA says it currently believes the adulteration is “economically motivated.” That generally refers to ingredients being altered in order to make products appear higher in value, often so companies can produce a cheaper item and sell it at an elevated price.”

“The agency and the Centers for Disease Control and Prevention have collaborated with state and local health authorities as well as Ecuadorian authorities to trace the origin of the cinnamon in the applesauce pouches, which is believed to be the source of the lead contamination. More than 60 U.S. children under the age of 6 have tested positive for lead poisoning after consuming the pouches — some at levels more than 500 times the acceptable threshold for lead, according to The Washington Post.”

Gao Yaojie, Chinese Physician and Self-Exiled AIDS Activist, Dead at 95

Gao Yaojie, a gynecologist and well-known AIDS activist, died on December 10 in New York City. Gao, formerly based in China’s Henan province, was famous for her work to expose the outbreak of HIV/AIDS in the country in the 1990s and 2000s. The outbreak was large in scale and primarily driven by the country’s Plasma Economy, which arose because of restrictions on foreign imports of blood products in the 1990s. This resulted in blood plasma donation becoming a way for rural populations to make money in government-supported plasma donation centers. However, unsafe practices like repeated use of unsterilized needles and pooling multiple donors’ blood during the plasmapheresis allowed HIV to spread widely.

Because of the Chinese government’s efforts to suppress reporting on this epidemic, poor rural populations were left largely unaware of the dangers of plasma donation and the public in general was unaware of the severity of the crisis. Gao was one of the first to speak publicly about the outbreak, helping draw the attention of media outlets. She later told documentary filmmakers about her motivations for doing this, saying, “My driving thought is: how can I save more people from dying of this disease? We each only live one life.”

It is estimated that at least one million Chinese were infected with HIV during this epidemic, highlighting the importance of Gao’s and others’ bravery. For this, she garnered praise from the United Nations, several Western organizations, and even Hillary Clinton. This rising fame led to her being placed under house arrest in 2007, with about 50 police preventing her from traveling to the United States to accept an award recognizing her work. In response to this, she told NPR “I think they feel I got in the way of their political achievements and their official careers…Otherwise, why would they put me under house arrest? What law did I break to warrant mobilizing all these police?”

NPR further explained her activities later in life in their article on her passing, writing: “Despite pressure from Henan provincial authorities to stop publicizing the AIDS crisis, she continued her work, using all the proceeds from her books and pamphlets to support AIDS families, especially children orphaned by the disease or the many suicides that it caused.”

“Restrictions on her movement began hindering in work in China, however, and in 2009, she abruptly fled to the US, after fearing she would be put under house arrest again. Many admirers continued to visit her apartment in West Harlem, including a group of young Chinese students who kept her company in the loneliness of exile.”

‘”Many Chinese regarded her as a hero, and when they came to New York, if they didn’t know how to contact her , [sic] they would ask me. I would ask them for an email written in Chinese and would forward it to her. So far as I know, she always wrote back to those people and welcomed them to come visit,” remembers Andrew Nathan, a political science professor at Columbia University who handled much of Gao’s affairs in New York.”

“The Biological and Toxin Weapons Convention in 2023: Glimmers of Progress Set Against a Troubled Geopolitical Landscape”

Experts at CSR’s Nolan Center, including Biodefense PhD Program alumna and current faculty member Saskia Popescu, recently authored this blog post focused on the BWC’s potential for success in verification, universalization and effective implementation in Africa, and the creation of an International Agency for Biological Safety. They explain in their introduction: “For nearly two decades, efforts to strengthen the Biological and Toxin Weapons Convention (BWC) were in stasis, with opportunities missed and States Parties unable to agree to definite action. States Parties arrived at the Review Conference last year facing a growing biological weapons threat—augmented by rapidly converging complimentary technologies—coupled with a status quo in the BWC that was insufficient for the task. Yet nations drove a breakthrough: the consensus achieved at last year’s Review Conference proved that action is still possible despite the challenging international security environment.”

“In a world in which biological threats and vulnerabilities are exceedingly complex, there is a critical need to reinforce relationships among global experts, national governments, and civil society. Over the past two weeks, these stakeholders have met to identify, examine, and develop specific and effective measures to strengthen the Convention. An unwavering theme throughout the Meeting of States Parties underscored that preparedness and resilience are investments, rather than costs, reinforcing the deterrence by denial efforts CSR continues to promote. Although the challenging international security environment continues to hinder progress there are glimmers of genuine progress across several fronts…”

“Biosecurity in the Americas: Regional Threat Assessment”

A new from UMD’s START, co-authored by Biodefense MS Program alumna Alexandra Williams: “This publication, currently available in Spanish, provides a breadth and depth of focuses as a high-level assessment of the Central and South America regions and introduction to key topics as:

  1. The needed expansion of understanding of the differences and areas of collaboration between the concepts of biosafety and biosecurity,
  2. Existing international obligations to biosecurity through the BWC and UNSC Resolution 1540,
  3. How biosecurity applies to and may differ in application across a variety of facility types that engage in biological research or production, whether private or public laboratories, agricultural or university-based facilities,
  4. Biosecurity risks that include proliferation, bioterrorism, agroterrorism, and biocrime,
  5. The five pillars and mechanisms of biosecurity,
  6. Lastly, the application of biosecurity in the Central and South American regions.”

“NTI|Bio Convenes Workshop on Disincentivizing State Bioweapons Development and Use”

From NTI: “A week ahead of the Biological Weapons Convention (BWC) Working Group meetings in Geneva, Switzerland, NTI | bio convened a workshop on “Disincentivizing State Bioweapons Development and Use.” This two-day workshop on November 29 and 30 brought together academics, diplomats, biosecurity experts, and government policy makers to begin developing a cross-disciplinary thought and practice community to explore and develop potential disincentivizing solutions. Current thinking and policy on disincentivizing bioweapons acquisition and use is underdeveloped—especially by comparison with the nuclear security field.”

‘“We launched this effort because we see the need for more rigorous thinking on effective approaches to making bioweapons unattractive to nation-states,” said NTI | bio Vice President Jaime Yassif. “NTI’s goal is to bridge theory and practical policy-relevant approaches to develop new ideas that can invigorate international efforts to reduce biological threats.”’

Biodefense Graduate Program Director Gregory Koblentz and Associate Professor Sonia Ben Ouagrham-Gormley both participated in this workshop. Read more about it here.

“Great Powers and the Norms of the BW Prohibition Regime”

A new working paper from CBWNet: “The United States of America and the Soviet Union were instrumental in creating the biological weapons prohibition regime more than 50 years ago. This has left the regime with a big gap in its normative structure related to the verification of treaty compliance. The working paper by Alexander Kelle and Eva Siegmann analyses great power involvement in several areas of regime implementation and concludes that none of the great powers, including China, has supported the addition of declaration and inspection norms. While recent US and Chinese initiatives could still lead to a strengthening of the regime in different areas, Russian policies, most notably false accusations against the US and others, threaten to undermine the regime.”

“AI and Biorisk: An Explainer”

A new explainer from Georgetown’s CSET: “Recent government directives, international conferences, and media headlines reflect growing concern that artificial intelligence could exacerbate biological threats. When it comes to biorisk, AI tools are cited as enablers that lower information barriers, enhance novel biothreat design, or otherwise increase a malicious actor’s capabilities. In this explainer, CSET Biorisk Research Fellow Steph Batalis summarizes the state of the biorisk landscape with and without AI.”

“Bio X AI: Policy Recommendations For A New Frontier”

Jeffrey et al. discuss the work of the Federation of American Scientists’ Bio x AI Policy Development Sprint in this piece, explaining in their introduction: “Artificial intelligence (AI) is likely to yield tremendous advances in our basic understanding of biological systems, as well as significant benefits for health, agriculture, and the broader bioeconomy. However, AI tools, if misused or developed irresponsibly, can also pose risks to biosecurity. The landscape of biosecurity risks related to AI is complex and rapidly changing, and understanding the range of issues requires diverse perspectives and expertise. To better understand and address these challenges, FAS initiated the Bio x AI Policy Development Sprint to solicit creative recommendations from subject matter experts in the life sciences, biosecurity, and governance of emerging technologies. Through a competitive selection process, FAS identified six promising ideas and, over the course of seven weeks, worked closely with the authors to develop them into the recommendations included here. These recommendations cover a diverse range of topics to match the diversity of challenges that AI poses in the life sciences. We believe that these will help inform policy development on these topics, including the work of the National Security Commission on Emerging Biotechnologies.”

“Push to Improve Biosecurity in the Age of Genetic Engineering”

Wilmot James recently authored this opinion piece for Business Day, explaining in part “The possibility of using AI to develop bioweapons raises additional concerns, and remains uncharted territory. While the intersection of AI and biotechnology holds immense potential for positive applications in healthcare, research and diagnostics, it also poses risks if misused. AI algorithms could be employed to analyse vast genetic data sets and identify specific sequences for manipulation. This could accelerate the process of genetic engineering, allowing for the creation of more efficient and potentially harmful pathogens…To safeguard against such threats, multilateral and public-private sector agreements and regulations to govern the ethical use of AI in science, emphasising the prohibition of bioweapon development, should be established, with strong oversight committees responsible for assessing the ethical implications at the intersection of AI and biotechnology. These committees should include experts in AI, virology, bioethics and global health security.”

“Sounding the Alarm on Anti-Science”

Margaret Winchester provides background and overview of Peter Hotez’s latest book-The Deadly Rise of Anti-Science-in this piece for Health Affairs: “In his book, The Deadly Rise of Anti-Science, Hotez, professor and dean of the National School of Tropical Medicine at Baylor College of Medicine, and co-director of the Center for Vaccine Development at Texas Children’s Hospital, paints a bleak picture of public science denial during the pandemic, embedded in historic context. He tells the story of systematic anti-science efforts from his view in the trenches—and as a personal target for anti-science activists. This book, and his commentary in our December issue of Health Affairs on global lessons from COVID-19, highlight the very real effects of this movement, including lives lost, undermined public health efforts, foregone vaccinations, social schisms, and more, that will be felt for generations to come. As he writes, “anti-science now kills more Americans than global terrorism, or other deadly societal forces and social determinants.” Drawing from multiple sources, he estimates that approximately 200,000 people needlessly died in the US after COVID-19 vaccines became widely available.”

EU vs Disinfo Disinformation Review

The most recent edition of EU vs Disinfo’s Disinformation Review is now available and features multiple sections focused on Russia’s continued use of alleged US biological weapons laboratories as a bogeyman. Be sure to check it out for fantastic lines such as “If the only tool that you have is a hammer, everything looks like a biolab,” and “At a staged event, Putin mumbled out an announcement to veterans and the wider public that his regime would continue to rule over Russia after an orchestrated ritual not to be confused with an event known as an ‘election’ in the free world.”

2023 State of the Bioeconomy

From BIOISAC: “We have a lot to celebrate as we close 2023 and just over 12 months since the Executive Order calling for a safe, secure bioeconomy. Join us as we recap the activity, publications, outcomes, and – we will of course share a glimpse of the “behind the scenes” conversations from our 3 regional events and our one-day “Closing the Knowledge Gaps” event, our two-day table top training and the resulting “Going Viral: Bioeconomy Defense TTX” report, and, of course, the industry-demanded outputs from our hardware/software device security workgroup report and supplements, “Fortifying the Bioeconomy” as well as the Bioeconomy Security Questionnaire and Instrument Disposal Guide. We also have a lot left to do! We plan to share a few of our goals for 2024 and our upcoming regional events schedule.”

“Join us December 19th at 2pm Eastern-US for a live discussion.” Register here.

Presidential Advisory Council on Combating Antibiotic-Resistant Bacteria (PACCARB) Virtual Meeting

“The Presidential Advisory Council on Combating Antibiotic-Resistant Bacteria (PACCARB) provides advice, information, and recommendations to the U.S. Secretary of Health and Human Services (HHS Secretary). The council supports and evaluates U.S. government activities focused on fighting antimicrobial resistance (AMR) in human health, animal health, and environmental health. Using this One Health approach, members of the PACCARB have expertise from a range of backgrounds, including academia, industry, public health, advocacy, veterinary, and agricultural production.”

“The PACCARB was established under Executive Order 13676 and included in the Pandemic and All-Hazards Preparedness and Advancing Innovation Act of 2019 (PAHPAIA). Since 2019, the President has given authority to the HHS Secretary as the primary recipient of PACCARB recommendations. Additional information on the authority and activities of the PACCARB can be found on the About Us page in the charter.”

“As a federal advisory committee, the PACCARB looks to engage with the public and all AMR stakeholders. The council holds several public meetings every year both in-person and live streamed on the HHS.gov website. These meetings are open to anyone with an interest in combating AMR. See how to get involved!”

This virtual meeting will take place on December 20 from 9-4 EST. Learn more here.

61st ISODARCO Course: Nuclear Order and International Security after Ukraine

“The war in Ukraine has had an enormous impact on global security, reviving nuclear fears, undermining the prospects for arms control, and shattering many of the norms and constraints that were the foundation of European security.  ISODARCO 2024 will examine the global nuclear order in light of the Ukraine war, focusing on the states, the policies and the technologies that will shape the future in a much more difficult environment.  How will we cope with this more dangerous world?”

This course will take place January 7-14, 2024, at the University of Trento. Learn more and register here.

International Conference, CBRNE Research & Innovation

“The last 40 years have demonstrated that both military and civilian populations could be exposed to highly hazardous CBRNE agents following conflicts, natural outbreaks and disasters, industrial incidents or terrorist attacks.”

“Worldwide, researchers, responders and industrial capacities have been commited to provide adapted response to these challenges.”

“Building on the success of the first 5 International Conferences « CBRNE Research and Innovation » which took place in Antibes (2015), Lyon (2017), Nantes (2019), on line (2021) and Lille (2022), we want to give you a new opportunity to build up or strengthen collaborative networks in Strabourg (March 19th – 21rst 2024).”

“The CBRNE R&I Conference is specifically devoted to scientific updates, responders’ feedbacks and expression of needs. It also includes workshops and demonstrations of innovative materials, technologies and procedures, according to the following themes: DETECTION – IDENTIFICATION, PROTECTION – DECONTAMINATION, MEDICAL COUNTERMEASURES, RISKS & CRISIS MANAGEMENT.”

“Looking forward to your proposals for communication and to welcoming you at Strasbourg in March 2024!”

Learn more here.

Registration for GHS 2024 Now Open

Registration is now open for the Global Health Security 2024 conference in Sydney, Australia. This iteration will take place 18-21 June, 2024. The call for abstracts is also still open. “The mission of the Global Health Security conference is to provide a forum where leaders, researchers, policy-makers, and representatives from government, international organisations, civil society, and private industry from around the world can engage with each other, review the latest research and policy innovations, and agree solutions for making the world safer and healthier. To that end, our mission is to help foster a genuinely multidisciplinary community of practice that is committed to working collaboratively to enhance global health security and eliminate disease, irrespective of its origin or source.”

WHO Announces Proposed Members of Technical Advisory Group on Response Use of the Life Sciences and Dual-Use Research

The WHO recently announced its proposed membership of its Technical Advisory Group on Responsible use of the life sciences and dual-use research (TAG-RULS DUR). According to WHO, “As per WHO processes, there will be now a two-week public consultation period for WHO to receive feedback on the proposed TAG-RULS DUR members and set in place the modalities for the TAG-RULS DUR’s first meeting, which is planned to take place following this consultation period…The final membership to the TAG-RULS DUR is subject to the above-mentioned public consultation period and relevant WHO practices and procedures.”

The proposed membership and instructions for providing commentary on the individuals included are both available here.

Vote: 2023 Arms Control Person(s) of the Year Nominees

“Since 2007, the independent, nongovernmental Arms Control Association has nominated individuals and institutions that have, in the previous 12 months, advanced effective arms control, nonproliferation, and disarmament solutions and raised awareness of the threats posed by mass casualty weapons.”

“In a field that is often focused on grave threats and negative developments, the Arms Control Person(s) of the Year contest aims to highlight several positive initiatives—some at the grassroots level, some on the international scale—designed to advance disarmament, nuclear security, and international peace, security, and justice.”

“Voting will take place between Dec. 8, 2023, and Jan. 11, 2024. The results will be announced on Jan. 12, 2024. Follow the discussion on social media using the hashtag #ACPOY2023.”

Learn about the nominees and vote here.

Pandora Report 12.08.2023

This week includes coverage of updates to Japan’s End User List, the Taliban’s newly declared war on polio, Biomemory’s $1k DNA storage cards, new publications, upcoming events, and more.

Japan Revises End User List, Includes 101 Chinese Organizations and Institutions

Japan’s Ministry of Economy, Trade, and Industry has revised the country’s End User List, which provides “…exporters with information on foreign entities for which concern cannot be eliminated regarding involvement in activities such as the development of weapons of mass destruction (WMDs) and other items, for the purpose of enhancing the effectiveness of the catch-all control on cargos and other loads relating to WMDs and other items.”

The updated list, which takes effect on Monday, now includes 706 organizations in 15 countries and regions, according to Nikkei. This is an increase of 36 over last year’s list and, notably, it includes the China Academy of Engineering Physics (CAEP)-the main center for Chinese research on and manufacturing of nuclear weapons. Seven total Chinese entities were added to the list, about 90% of which are thought to be involved in missile development. Nikkei notes that “Many universities, academies and research institutes are also listed, which reveals the extent of Xi Jinping’s Military-Civilian Fusion policy. Machine tools produced by Japanese companies and others are suspected of being used by the CAEP, according to a Nikkei investigation.”

223 Iranian organizations and institutions are on the list, in addition to 153 North Korean ones, and 101 each from China and Pakistan. Nikkei further explains that “Japan aims to prevent the outflow of civilian technology that could be diverted to military use. Exporters are required to get approval from the Minister of Economy, Trade and Industry to export products to the listed organizations unless it is clear that the materials will not be used to develop WMDs such as nuclear weapons or missiles.”

“The economy ministry makes the list to enhance the effectiveness of its “catch-all” control system, which obliges exporters to apply for an export license for goods that may be used for the development of WMDs even if the goods are not subject to export restrictions under international agreements. The list has been issued since catch-all controls were introduced in April 2002 and is revised about once a year. It is not an embargo list.”

Taliban Announces Polio Eradication Campaign

Naturally acquired polio remains endemic in just two countries today- Afghanistan and Pakistan- in part because, as Radio Azadi explains, “Islamic militants often target polio-vaccination teams, falsely claiming the vaccination campaigns are a Western conspiracy to sterilize children.” During its 20-year struggle to regain power, the Taliban often banned door-to-door vaccination efforts. In 2021, nationwide door-to-door polio vaccinations were allowed to resume after the Taliban and the United Nations/World Health Organization reached an agreement.

Now, as explained by a recent article in The Washington Post, the Taliban is “declaring war” on polio in an apparent complete reversal of its previous stance. The article explains “Vaccinators in the country’s northeast, the center of the poliovirus outbreak, search cars for unvaccinated children at roadside checkpoints manned by Taliban soldiers. With no deadly attacks on public health campaigners reported in Afghanistan this year, they also feel increasingly comfortable venturing into remote virus hot spots that were previously far beyond their reach.”

The country’s health ministry announced the continuation of its annual polio vaccination campaign in March of this year, marking the second year the program has continued to operate under the Taliban’s rule. The ministry indicated it aimed to reach approximately 9 million children with the campaign, as Afghanistan and neighboring Pakistan continue to struggle with endemic polio due in large part to accessibility difficulties, displacement, regional instability, and concerns about external interference. Pakistan suspended its anti-polio drive in multiple districts this year after police escorting vaccination teams were repeatedly attacked.

French Start-Up Announces Sales of DNA Storage Cards, BIO-ISAC Joins DNA Data Storage Alliance Amid Growing Interest, Concerns

Multiple news outlets have covered the French start-up Biomemory‘s release of $1,000 pairs of DNA cards that promise a “minimum” 150-year lifespan of data storage. The Verge’s Emma Roth explains “DNA has emerged as a theoretical alternative to hard drives, SSDs, and other forms of digital data storage, namely because of its impressive lifespan. Science estimates the technology could potentially last hundreds of thousands of years if stored in a cool, dry environment. That’s a heck of a lot longer than the lifespan of your average hard drive, which typically tops out at around five years.”

However, Biomemory’s cards currently offer just one kilobyte of storage, or about one email according to Wired. The data stored on the card is retrieved by mailing the cards to Eurofins Genomics, who then return the stored information using strings of DNA’s nucleotide bases-adenine (A), cytosine (C), guanine (G) and thymine (T). Users can then use Biomemory’s DNA translation feature to decode the stored information. The card is not returned afterward. The company expects to begin shipping orders from its waitlist in January.

‘”The launch of our DNA Cards represents a significant milestone in the evolution of data storage technology,” Erfane Arwani, CEO of Biomemory, said about the pioneering development. “After years of talk about the potential of molecular computing, we are incredibly proud to bring the first DNA data storage product to market, that not only pushes the boundaries of innovation but also aligns with our commitment to environmental sustainability and efficiency.”‘

This news has coincided with the announcement that the Bioeconomy Information Sharing and Analysis Center, an international organization that aims to address threats unique to the bioeconomy, has joined the DNA Data Storage Alliance. The organization explained in a statement: “This year BIO-ISAC created the Genomic Data Workgroup, informing the National Cybersecurity Center of Excellence at National Institute of Standards and Technology efforts to launch the Cybersecurity Framework Profile for Genomic Data and the forthcoming text on the Privacy Framework Profile for Genomic Data. Prioritizing workgroup efforts to apply and implement this work, BIO-ISAC pursued membership and presentation opportunities with aligned organizations and audiences.”

“Today, BIO-ISAC joins more than 40 members of the DNA Data Storage Alliance, in hopes of creating a future with safe, secure data storage systems and processes for genetic data at all stages of its lifecycle.”

“Founded in 2020, the DNA Data Storage Alliance was built to create and promote an interoperable storage ecosystem based on DNA as a data storage medium. The organization seeks to educate the public and raise awareness about this emerging technology and its vast power to preserve our digital legacy. As the methods of commercially viable DNA storage become better understood, the Alliance will consider recommending the creation of specifications and standards (e.g., encoding, reliability, retention, file systems) which enable end-users to add interoperable DNA-based storage solutions to their existing storage hierarchies.”

On a more fun note, Biomemory’s homepage does include a DNA Translate feature at the bottom which shows users how lines of text may be converted to strings of As, Cs, Gs, and Ts, so we tested it out: AGAGAGACAGTCTCACAGTCAGAGACTCACACAGAGACACAGTCACAGAGTCTGTCAGTCAGACAGTCTGTGAGTGACTCAGTCACAGACTCACACAGAGACTCAGTCAGAGAGTGACACAGTCTGTGAGTGACTCAGTGAGACACTCACACAGTCTCAGAGTGACTGACTCACACAGTGAGACAGTCTCACAGTCAGAGACTCACACAGTCACTCAGTCAGAGAGTGACTGAGTGAGACACTCACACAGTCTGTCAGTCAGAGAGTGCCGAAGTGACTGAGTCTGACAGTCAGAGAGTGAGACAGTGAGACAGTCAGAGAGTGACTCCCGAACAG

The page lacks a feature allowing users to translate their string of nucleotide bases back to regular text, so take our word for it: The Pandora Report is the best newsletter!

WHO Weekly Epidemiological Record One Health-Focused Issue

“The Weekly Epidemiological Record (WER) serves as an essential instrument for the rapid and accurate dissemination of epidemiological information on cases and outbreaks of diseases under the International Health Regulations and on other communicable diseases of public health importance, including emerging or re-emerging infections.”

The most recent issue is focused on One Health and includes pieces on incorporating One Health into the international political agenda, the Collaboration on One Health between WHO, FAO, WOAH, and UNEP, and more.

“Henry Kissinger Supported Wars and Coups. He Also Played a Little-Known Role in Eliminating Bioweapons”

Matt Field recently authored this piece about the late Henry Kissinger in The Bulletin of the Atomic Scientists, writing in part: “By the late 1960s, incidents with chemical weapons—including an accident with VX nerve agent in Utah that killed some 6,000 sheep—had focused Congress’s attention on the US chemical and biological warfare operation. Internationally, there were efforts to begin arms control negotiations around these weapons of mass destruction. And Kissinger led internal government deliberations over what to do with the US program. At one point, according to Tucker and Mahan, Kissinger, unhappy with a policy paper that contained both arguments in favor and against retaining biological weapons, produced his own paper that cut the points in favor of the offensive program. He included his personal recommendation to restrict the US program to biological defense, which involves the development of countermeasures such as vaccines.”

“Insights from BARDA Industry Day 2023”

Tanima Sinha, Director of Life Science Product Development and Government Contracts at the Biomedical Advanced Research and Development Authority (BARDA), recently authored this post covering BARDA Industry Day 2023 and upcoming insights from the conference that will be made available. She explains in part, “Here we will take a quick glimpse at ASPR (Administration for Strategic Preparedness and Response) and BARDA’s programs to enhance the nation’s biomedical industrial base and supply chain capacity. The COVID-19 pandemic brought to light the inadequate availability of essential medical needs. In response to these deficiencies, the USG/ HHS (Health and Human Services) (Health and Human Services) is expanding the public health industrial base through innovative solutions.”

Fortifying the Bioeconomy

From BIO-ISAC: “Standardizing tools for assessing, remediating, and disposing of hardware and software instruments has been a recurring problem in our sector, reducing our ability to operate in a safe, secure way. Earlier this year, BIO-ISAC took action to address this need.”
“Fortifying the Bioeconomy, an in-depth resource about shared responsibility in hardware and software lifecycle management, is now available. This resource includes additional materials including a standardized vendor questionnaire and  an instrument disposal guide.”

“We hope these materials guide industry and offer us a safe, secure path forward for our nation’s labs, biomanufacturers, growers, and innovators.”

Access here.

“Country Reports on Terrorism 2022”

“Country Reports on Terrorism 2022 is submitted in compliance with Title 22 of the United States Code, Section 2656f (the “Act”), which requires the Department of State to provide to Congress a full and complete annual report on terrorism for those countries and groups meeting the criteria of the Act.”

This report includes “Chapter 3 — The Global Challenge of Chemical, Biological, Radiological, or Nuclear Terrorism,” explaining the status of CBRN materials and expertise as terrorist threats and the United States’ efforts to counter them in 2022.

“New Information Tool on Nuclear Weapons Seeks to Identify the Next Arms Control Strategies”

Andrew Facini recently authored this piece for The Bulletin of the Atomic Scientists discussing the Council on Strategic Risks’ recently-launched Nuclear Weapons System Project. He explains, “For those of us seeking to cultivate nuclear policies geared toward enhancing strategic stability, the current trend reflects a worrying loss of perspective—a forgetting of the hard-earned lessons of the Cold War. To help put today’s trends in their historical context, a team of the Council on Strategic Risks (CSR) developed a new visualization tool and information system that maps every type of nuclear weapon fielded by the five nuclear weapons states (P5) under the Nuclear Non-Proliferation Treaty (NPT)—China, France, Russia, the United Kingdom, and the United States—from their inception to present day.”

What We’re Listening To 🎧

Technologically Speaking Podcast Ep. 6, Science is Messy

New from the Department of Homeland Security: “Host John Verrico sits down with Dr. Nick Bergman, director of S&T’s National Biodefense Analysis and Countermeasures Center (NBACC). Dr. Bergman is a bit of a germaphobe, but it’s hard not to be when you run a Biosecurity Level 4 lab that studies pathogens for which no vaccine or treatment exists. Hear an insider’s perspective of the COVID pandemic, find out how NBACC regularly helps the FBI, and meet a guy living a “pretty typical life” of helping save us all from superbugs.”

Listen here.

What We’re Watching🍿

Biosecurity

New from the Dutch Ministry of Health, Welfare and Sport: “This film provides an introduction into eight pillars of good practice for biosecurity, that are important when implementing biosecurity control measures.”

“These control measures are necessary to protect high-risk biological materials against theft or misuse by malicious parties.”

“The biosecurity aspects in these eight pillars of good practice are explained, which can help you to implement biosecurity within your organisation. This film is focussed on organisations that work with high risk biological materials.”

The short film is available in Dutch, English, and English with Russian subtitles.

Mitigating Arboviral Threats and Strengthening Public Health Preparedness

“Arboviruses are a broad group of viruses that are spread by arthropods, such as ticks and mosquitoes. Diseases caused by arboviruses, like dengue, chikungunya, Zika, and yellow fever, present a significant public health burden and threaten billions of people worldwide. Despite the global recognition of the devastating health and economic impacts of these diseases, the need persists for improved integration of mitigation efforts into public health systems and environmental and urban planning.”

“The National Academies Forum on Microbial Threats will conduct a two-day workshop that will identify lessons learned from previous outbreaks, outline current arbovirus surveillance capacities, and describe novel approaches to arbovirus mitigation. The workshop will include perspectives from researchers, public health practitioners, and environmental management experts from across the globe.”

This event will take place on December 12 and 13. Learn more here.

Presidential Advisory Council on Combating Antibiotic-Resistant Bacteria (PACCARB) Virtual Meeting

“The Presidential Advisory Council on Combating Antibiotic-Resistant Bacteria (PACCARB) provides advice, information, and recommendations to the U.S. Secretary of Health and Human Services (HHS Secretary). The council supports and evaluates U.S. government activities focused on fighting antimicrobial resistance (AMR) in human health, animal health, and environmental health. Using this One Health approach, members of the PACCARB have expertise from a range of backgrounds, including academia, industry, public health, advocacy, veterinary, and agricultural production.”

“The PACCARB was established under Executive Order 13676 and included in the Pandemic and All-Hazards Preparedness and Advancing Innovation Act of 2019 (PAHPAIA). Since 2019, the President has given authority to the HHS Secretary as the primary recipient of PACCARB recommendations. Additional information on the authority and activities of the PACCARB can be found on the About Us page in the charter.”

“As a federal advisory committee, the PACCARB looks to engage with the public and all AMR stakeholders. The council holds several public meetings every year both in-person and live streamed on the HHS.gov website. These meetings are open to anyone with an interest in combating AMR. See how to get involved!”

This virtual meeting will take place on December 20 from 9-4 EST. Learn more here.

61st ISODARCO Course: Nuclear Order and International Security after Ukraine

“The war in Ukraine has had an enormous impact on global security, reviving nuclear fears, undermining the prospects for arms control, and shattering many of the norms and constraints that were the foundation of European security.  ISODARCO 2024 will examine the global nuclear order in light of the Ukraine war, focusing on the states, the policies and the technologies that will shape the future in a much more difficult environment.  How will we cope with this more dangerous world?”

This course will take place January 7-14, 2024, at the University of Trento. Learn more and register here.

International Conference, CBRNE Research & Innovation

“The last 40 years have demonstrated that both military and civilian populations could be exposed to highly hazardous CBRNE agents following conflicts, natural outbreaks and disasters, industrial incidents or terrorist attacks.”

“Worldwide, researchers, responders and industrial capacities have been commited to provide adapted response to these challenges.”

“Building on the success of the first 5 International Conferences « CBRNE Research and Innovation » which took place in Antibes (2015), Lyon (2017), Nantes (2019), on line (2021) and Lille (2022), we want to give you a new opportunity to build up or strengthen collaborative networks in Strabourg (March 19th – 21rst 2024).”

“The CBRNE R&I Conference is specifically devoted to scientific updates, responders’ feedbacks and expression of needs. It also includes workshops and demonstrations of innovative materials, technologies and procedures, according to the following themes: DETECTION – IDENTIFICATION, PROTECTION – DECONTAMINATION, MEDICAL COUNTERMEASURES, RISKS & CRISIS MANAGEMENT.”

“Looking forward to your proposals for communication and to welcoming you at Strasbourg in March 2024!”

Learn more here.

Registration for GHS 2024 Now Open

Registration is now open for the Global Health Security 2024 conference in Sydney, Australia. This iteration will take place 18-21 June, 2024. The call for abstracts is also still open. “The mission of the Global Health Security conference is to provide a forum where leaders, researchers, policy-makers, and representatives from government, international organisations, civil society, and private industry from around the world can engage with each other, review the latest research and policy innovations, and agree solutions for making the world safer and healthier. To that end, our mission is to help foster a genuinely multidisciplinary community of practice that is committed to working collaboratively to enhance global health security and eliminate disease, irrespective of its origin or source.”

“Biodefense Budget Breakdown: Data Visualization of U.S. Biodefense Investments”

New from Council on Strategic Risks: “In recent years, U.S. strategies and policies have advanced greatly in addressing biological risks from all sources. We at CSR have marked several areas of progress through writings and analysis: the beginning of a pivot toward pathogen-agnostic approaches, requiring annual exercises on biological risks, and the creation of the Biodefense Council within the Department of Defense, and more…In September, CSR launched a scorecard process to track signs of implementation of stronger U.S. biodefense and biosecurity policies. CSR’s Biodefense Budget Breakdown will accompany the scorecard, tracking trends in resources and investments.”

“Before the launch of this tool, no publicly-accessible resource provided a detailed analysis of the total budget across the federal biodefense enterprise. By creating the Biodefense Budget Breakdown, we hope to provide a robust and user-friendly resource for the government, key stakeholders, and the general public.”

“This tool is intended to provide focused analyses of the biodefense budget, with multiple interfaces to understand and analyze the federal biodefense portfolio. This tool starts with the cumulative U.S. biodefense totals for each fiscal year dating back to 2019, progresses to agency-specific drill-downs, and culminates with a detailed line item index for biodefense budgets across key agencies. This tool reports biodefense investments across three steps in the budget cycle: requested (R), enacted (E), and actual (A) levels of funding.”

Call for Applications: Ecological Security Fellowship

“The Council on Strategic Risks is pleased to announce a call for applications for its Ecological Security Fellowship, a key part of its broader Ecological Security Program.”

“Tackling complex, converging risks arising from ecological degradation requires the development of resilient leaders spanning international, national, state, and local levels. This program will familiarize participants with novel ways of conceptualizing the security risks posed by ecological disruption driven by human activities, climate change, and other stressors. Participants will acquire expertise and build professional development through networking with experts and practitioners in different areas of ecological security.”

Learn more and apply here.

Pandora Report 12.01.2023

This week covers a wide range of topics, including chemical weapons, indictments for those involved in running the illegal laboratory in Reedley, CA, and more. Several new publications follow, as well new upcoming events and newly-available resources in the announcement section.

George Mason University’s Biomedical Laboratory Receives $12 Million in Funding from NIH

From GMU: “Farhang Alem, Interim Director of the Biomedical Research Laboratory, Institute for Biohealth Innovation, and Aarthi Narayanan, Professor, Biology, will receive more than $12 million from the National Institute for Health to support development of Mason’s Biomedical Research Laboratory, advancing the university’s research capabilities for infectious diseases.”

“George Mason University’s Biomedical Laboratory (BRL) is one of 12 Regional Biocontainment Laboratories (RBLs) established through the National Institute of Allergy and Infectious Diseases. The BRL offers Biosafety Level 3 (BSL-3) facilities that conduct cutting edge pathogen research and serve as resources to rapidly address emerging infectious disease outbreaks.”

“Funding will support a number of facility improvements including the implementation of a comprehensive BSL-3 facilities preventative maintenance and upgrade plan to ensure continuity of operations, compliance with federal regulations, and a safe and secure facility. Funding will also enhance safety and quality of BSL-3 laboratory practices and create two new research cores in high containment.”

Read more here.

DOD Chemical and Biological Defense Program Celebrates 30th Anniversary

The Department of Defense recently reached the 30-year anniversary of the formation of its Chemical and Biological Defense Program. “Congress created the DOD wide chemical and biological defense program in November 1993, after a government report noted U.S. forces were not sufficiently prepared to address Iraq’s chemical and biological warfare capabilities…Prior to the creation of the program under the Office of the Secretary of Defense, the military services were each responsible for developing their own chemical and biological defense capabilities.” 

Read more about the program here.

OPCW Adopts Measures Aimed at Ensuring Compliance with CW Ban in Syria and Elsewhere

The OPCW announced the adoption of new measures aimed at addressing non-compliance with the CWC yesterday, the Day of Remembrance for all Victims of Chemical Warfare. In a statement, the OPCW explained: “The Twenty-Eighth Session of the Conference of the States Parties to the Chemical Weapons Convention (CWC) today adopted a decision titled “Addressing the Threat from Chemical Weapons Use and the Threat of Future Use”, brought forward by 48 countries.”

“The Conference decided that the continued possession and use of chemical weapons by the Syrian Arab Republic, and its failures to submit an accurate and complete declaration and to destroy all its undeclared chemical weapons and production facilities, have caused serious damage to the object and purpose of the Chemical Weapons Convention.”

“In adopting the decision, States Parties condemned “in the strongest possible terms the use of chemical weapons by anyone, under any circumstances, emphasising that any use of chemical weapons anywhere, at any time, by anyone, and under any circumstances is unacceptable and contravenes international norms and standards”. States Parties reaffirmed their determination to continue to take action to address threats related to chemical weapons in Syria and elsewhere.”

“Today’s decision seeks to implement for the first time Paragraph 3 of Article XII of the Convention, which refers to measures States Parties can take in order to ensure compliance.”

Read more here.

Syrian Network for Human Rights Statement On the Day of Remembrance For All Victims of Chemical Warfare

The Syrian Network for Human Rights released its statement yesterday on the Day of Remembrance for all Victims of Chemical Warfare, highlighting CW attacks perpetrated by the Assad regime and the ongoing struggle for victims to hold the regime accountable. The statement is available below.

2023 OPCW-The Hague Award Recipients Announced

OPCW Director-General Amb. Fernando Arias and the Mayor of the Municipality of The Hague, Mr. Jan van Zanen, announced last week the three recipients of the 2023 OPCW-The Hague Award. These recipients are the Spiez Laboratory in Switzerland, Dr. Syeda Sultana Razia at the Bangladesh University of Engineering and Technology, and Mr. Hubert K. Foy at the African Centre for Science and International Security in Ghana.

‘“All three of these recipients have demonstrated that everyone has a role to play in ridding the world of chemical weapons and preventing their re-emergence,” said OPCW Director-General, Ambassador Fernando Arias. “We must together strive to continue to ensure that toxic chemicals are never used as instruments of harm and that our populations are protected.”’

Read more about the recipients and their work here.

NTI, NextGen, iGEM, SynBio Africa, GHSN, and 80,000 Hours Announce Winners of 7th Annual Next Generation for Biosecurity Competition

The winners of the Seventh Annual Next Generation for Biosecurity Competition were recently announced. They are Gupreet Dhaliwal, Ph.D. candidate in Synthetic Biology and Immunology at the University of Cambridge, Askar Kleefeldt, Ph.D. candidate in Synthetic Biology at the MRC Laboratory of Molecular Biology and the University of Cambridge, and Alexandra Klein, Ph.D. candidate in Science, Technology, Engineering and Public Policy at the University College London and research assistant at the Centre for the Study of Existential Risk, University of Cambridge.

“In their winning paper, Biosecurity-By-Design to Safeguard Emerging Bioeconomies: Integrating Biosecurity Considerations into the Full Biotechnology Innovation and Development Pipeline, the team proposes a ‘biosecurity-by-design’ approach to ensure that biosecurity is integrated into every stage of the life science research and development pipeline, especially project conceptualization. The three authors outline a set of recommendations to achieve this goal, including fostering a culture of responsibility among scientific communities through the adoption of the Tianjin Biosecurity Guidelines for Codes of Conduct for Scientists as a global standard in emerging bioeconomies. The authors emphasize the importance of engaging with the private sector and encourage governments to incentivize biosecurity in product design by using levers such as market access regulations or reputational rewards through seals of approval. The authors also propose that States Parties at the Biological Weapons Convention adopt a systematic review mechanism for science and technology to raise awareness of emerging biotechnology risks. Overall, these recommendations aim to make biosecurity an integral part of biotechnology innovation while allowing the bioeconomy to flourish.”

Read more here.

No Cost COVID-19 Tests Available in United States Again

The US Government is once more offering four at-home viral tests delivered via the US Postal Service. Those who did not order any in September can order up to eight of them during this round. Order tests at COVIDtests.gov.

ICYMI: Select Committee on the CCP Releases Report on Reedley Lab, DOJ Announces Indictment of Operator

Last month “Chairman Mike Gallagher (R-WI) of the House Select Committee on the Chinese Communist Party unveiled a report on its investigation into the illegal People’s Republic of China-tied biolab discovered in Reedley, CA. The members were joined by Rep. Jim Costa (D-CA), whose district includes Reedley, CA, Former Speaker Kevin McCarthy (R-CA), Rep. Dan Newhouse (R-WA), and Rep. Neal Dunn (R-FL).”

According to the report, the Committee’s main findings were:

  • “The illegal biolab was run by a PRC citizen who is a wanted fugitive from Canada with a $330 million Canadian dollar judgment against him for stealing American intellectual property.
  • This PRC citizen was a top official at a PRC-state-controlled company and had links to military-civil fusion entities.
  • The illegal biolab received millions of dollars in unexplained payments from PRC banks while running the illegal biolab.
  • The illegal biolab contained thousands of samples of labeled, unlabeled, and encoded potential pathogens, including HIV, malaria, tuberculosis, and Covid.
  • The illegal biolab also contained a freezer labeled “Ebola,” which contained unlabeled, sealed silver bags consistent with how the lab stored high risk biological materials. Ebola is a Select Agent with a lethality rate between 25-90%.
  • The biolab contained nearly a thousand transgenic mice, genetically engineered to mimic the human immune system. Lab workers said that the mice were designed “to catch and carry the COVID-19 virus.”
  • After local officials who discovered the lab sought help from the CDC and others, the CDC refused to test any of the samples.” 

Meanwhile, the Department of Justice announced a three-count indictment against operators of the lab, saying in a press statement “A federal grand jury returned a three-count indictment today against Jia Bei Zhu, aka Jesse Zhu, Qiang He, and David He, 62, a citizen of China who formerly resided in Clovis, charging him with distributing adulterated and misbranded medical devices in violation of the federal Food, Drug, and Cosmetic Act and for making false statements to the Food and Drug Administration (FDA), U.S. Attorney Phillip A. Talbert announced.”

“According to court documents, between January 2020 and March 2023, through the companies Universal Meditech Incorporated (UMI) and Prestige Biotech Incorporated (PBI), Zhu sold hundreds of thousands of COVID-19 test kits to companies throughout the United States. UMI and PBI were based in Fresno and Reedley and did not obtain pre-market approval, pre-market clearance, emergency use authorization, or other applicable exemption from the FDA as was required. UMI and PBI received millions of dollars for the sales of the test kits.”

“When questioned by FDA officials, Zhu made several false statements to them, including that (1) his name was Qiang “David” He, (2) he was hired by UMI as a COVID-19 consultant in 2021, (3) he was hired by PBI just a couple of weeks prior to meeting with the FDA to communicate with government agencies on PBI’s behalf, and (4) he did not know anything about the manufacturing or distribution histories for UMI or PBI.”

“This case is the product of an investigation by the FDA Office of Criminal Investigations with assistance from the Federal Bureau of Investigation and the California Department of Public Health – Food and Drug Branch. Assistant U.S. Attorneys Joseph D. Barton, Arelis M. Clemente, and Henry Z. Carbajal III are prosecuting this case.”

“Why AI-Assisted Bioterrorism Became a Top Concern for Open AI and Anthropic”

Louise Matsakis covers the now constant concern about the potential for AI to aid in bioterrorism, explaining in her introduction “In the spring of 1995, U.S. lawmakers were becoming concerned that material uploaded to the nascent internet might pose a threat to national security. The Oklahoma City bombing had happened several weeks earlier, drawing attention to publications circulating online like The Big Book of Mischief, which included instructions on how to build homemade explosives.”

“Worried the information could be used to orchestrate another attack, then-Senator Dianne Feinstein pushed to make publishing bomb recipes on the internet illegal. The effort sparked a national debate about “Open Access vs. Censorship,” as one newspaper headline put it at the time.”

“Nearly 30 years later, a similar debate is now unfolding about artificial intelligence. Rather than DIY explosives, some U.S. officials and leading AI companies say they are increasingly worried that large language models could be used to develop biological weapons. The possibility has been repeatedly cited as one reason to be cautious about making AI systems open source.”

Matsakis interviewed George Mason’s Sonia Ben Ouagrham-Gormley as well in writing this piece, writing ‘“With new technologies, we tend to project in the future as though their development was linear and straightforward, and we never take into consideration the challenges and the contingencies of the people using them,” said Sonia Ben Ouagrham-Gormley, an associate professor at George Mason University who has interviewed former scientists in both the U.S. and Soviet Union’s now-defunct biological weapons programs.”

And later: “Ben Ouagrham-Gormley said her research has shown that achieving each of these steps requires employing different, highly-trained experts, including people who specialize in the exact type of pathogen being used. An AI model might be able to replace some of their work in the future, but she argued it can’t replicate the hands-on wisdom that comes from working in a laboratory.”

‘“This kind of tacit knowledge exists everywhere, but in the bio field, it’s really important because of the fragility of the raw material,” Ben Ouagrham-Gormley said.”

“Artificial Intelligence and Synthetic Biology Are Not Harbingers of Doom”

David Bray provides an optimistic outlook on the potential of AI and synthetic biology in this policy memo for the Stimson Center. Bray writes, “Contrary to many people’s fears, artificial intelligence (AI) can be a positive force in advancing biological research and biotechnology. The assumption that AI will super-empower the risks that already exist for the misuse of biotech to develop and spread pathogens and fuel bioterrorism misses three key points. First, the data must be out there for either an AI or a human to use it. Second, governments stop bad actors from using bio for nefarious purposes by focusing on the actors’ precursor behaviors. Third, given how wrong large language models (LLMs) often are and their risk of hallucinations, any would-be AI intended to provide advice on biotech will have to be checked by a human expert. In contrast, AI can be a positive force in advancing biological research and biotechnology — and insights from biology can power the next wave of AI for the benefit of humankind. Private and public-sector leaders need to make near-term decisions and actions to lay the foundation for maximizing the benefits of AI and biotech. National and international attention should focus on both new, collective approaches to data curation and ensuring the right training approaches for AI models of biological systems.”

“Going Viral: Bioeconomy Defense”

This report from Johns Hopkins’ Applied Physics Lab summarizes the findings of a May tabletop exercise:

“The May tabletop exercise at APL revealed four key areas of action to ensure a safe and secure bioeconomy.

Trust in lab equipment performance and data is foundational to the bioeconomy. Recommendations include developing digital security standards for lab equipment, hardening waypoints at each step in the data life cycle, and introducing a system of tiered levels of compliance.

Awareness of vulnerabilities, cyber and physical, and the steps for prevention and intervention are needed. Recommendations include additional exercises to strengthen intra-agency coordination and training and extending this activity to private sector companies.

Responsibility for responding to threats in the bioeconomy, and the roles for each team member, need to be defined with a process workflow, using a shared responsibility model, and teams need regular training opportunities to practice.

Preparedness is lacking, and threat-mitigation strategies specific to the bioeconomy need to be identified, tested and distributed. The exercise pushed the limits of participants’ traditional threat-mitigation strategies and identified the need for assessments of critical infrastructure and functions, cross-domain training, and the establishment of policies and procedures for an inter-agency group to rapidly respond to threats.”

“Security Considerations At the Intersection of Engineering Biology and Artificial Intelligence”

New from the Engineering Biology Research Consortium: “This white paper describes three areas at the intersection of engineering biology and artificial intelligence that may yield significant security concerns: de novo biological design, closed-loop autonomous laboratories, and natural language Large Language Models. It describes each area, identifies potential security concerns, and offers ideas for the potential mitigation of those concerns, ultimately calling for an international forum to continually address this evolving issue.”

“Pascale Ferrier and the Threat of Bioterror”

Markus K. Binder recently published this piece in NCT’s CBNW: “Drawing upon the START CBRN Data Suite and other research, Markus Binder considers the five ricin bio-attacks directed at the U.S. President and other officials that have taken place since 2013 to assess what, if anything, they can tell us about bioterrorism.”

“Americans’ Trust in Scientists, Positive Views of Science Continue to Decline”

New work from the Pew Research Center has found that “…the share of Americans who say science has had a mostly positive effect on society has fallen and there’s been a continued decline in public trust in scientists.”

“Overall, 57% of Americans say science has had a mostly positive effect on society. This share is down 8 percentage points since November 2021 and down 16 points since before the start of the coronavirus outbreak.”

“About a third (34%) now say the impact of science on society has been equally positive as negative. A small share (8%) think science has had a mostly negative impact on society.”

Read the report here.

“A Systematic Review Of COVID-19 Misinformation Interventions: Lessons Learned”

Smith et al. recently published this article with Health Affairs: “Governments, public health authorities, and social media platforms have employed various measures to counter misinformation that emerged during the COVID-19 pandemic. The effectiveness of those misinformation interventions is poorly understood. We analyzed fifty papers published between January 1, 2020, and February 24, 2023, to understand which interventions, if any, were helpful in mitigating COVID-19 misinformation. We found evidence supporting accuracy prompts, debunks, media literacy tips, warning labels, and overlays in mitigating either the spread of or belief in COVID-19 misinformation. However, by mapping the different characteristics of each study, we found levels of variation that weaken the current evidence base. For example, only 18 percent of studies included public health–related measures, such as intent to vaccinate, and the misinformation that interventions were tested against ranged considerably from conspiracy theories (vaccines include microchips) to unproven claims (gargling with saltwater prevents COVID-19). To more clearly discern the impact of various interventions and make evidence actionable for public health, the field urgently needs to include more public health experts in intervention design and to develop a health misinformation typology; agreed-upon outcome measures; and more global, more longitudinal, more video-based, and more platform-diverse studies.”

“Coffee As a Dietary Strategy to Prevent SARS-CoV-2 Infection”

Wu et al.‘s recent article in Cell & Bioscience offers further validation for coffee drinkers (as if we needed it): “Background: To date, most countries lifted the restriction requirement and coexisted with SARS-CoV-2. Thus, dietary behavior for preventing SARS-CoV-2 infection becomes an interesting issue on a daily basis. Coffee consumption is connected with reduced COVID-19 risk and correlated to COVID-19 severity. However, the mechanisms of coffee for the reduction of COVID-19 risk are still unclear.”

“Results: Here, we identified that coffee can inhibit multiple variants of the SARS-CoV-2 infection by restraining the binding of the SARS-CoV-2 spike protein to human angiotensin-converting enzyme 2 (ACE2), and reducing transmembrane serine protease 2 (TMPRSS2) and cathepsin L (CTSL) activity. Then, we used the method of “Here” (HRMS-exploring-recombination-examining) and found that isochlorogenic acid A, B, and C of coffee ingredients showed their potential to inhibit SARS-CoV-2 infection (inhibitory efficiency 43–54%). In addition, decaffeinated coffee still preserves inhibitory activity against SARS-CoV-2. Finally, in a human trial of 64 subjects, we identified that coffee consumption (approximately 1–2 cups/day) is sufficient to inhibit infection of multiple variants of SARS-CoV-2 entry, suggesting coffee could be a dietary strategy to prevent SARS-CoV2 infection.”

“Conclusions: This study verified moderate coffee consumption, including decaffeination, can provide a new guideline for the prevention of SARS-CoV-2. Based on the results, we also suggest a coffee-drinking plan for people to prevent infection in the post-COVID-19 era.”

“WHO: ‘Collective Action’ Needed to Effectively Reduce Antimicrobial Resistance”

CIDRAP’s Chris Dall covers WHO officials’ answers to questions about AMR in this piece written in recognition of World AMR Awareness Week. Dall explains “Encouraging the medical community, world leaders, and other stakeholders to do their part in staving off that grim future is one of the goals of World AMR Awareness Week, a global campaign of the World Health Organization (WHO) this week aimed at raising public awareness and promoting practices that help mitigate the threat posed by drug-resistant infections…CIDRAP News recently submitted a series of questions to WHO officials about the themes of this year’s World AMR Awareness Week, their assessment of the progress that countries have made in addressing AMR, and the challenges that lay ahead. Responses were provided by Sarah Sheppard, the WHO’s communications lead for Medicines, Health Products & AMR.”

“The World’s Chemical-Weapons Stockpiles Are Gone – But a New Challenge Looms”

Peter J. Hotchkiss, science policy adviser to the OPCW’s Scientific Advisory Board, recently published this World View piece with Nature. He explains in part, “In 2019, the OPCW’s 193 member states decided unanimously, for the first time in history, to add compounds to the schedules, the lists of chemicals that are regulated under the convention. The four entries comprise toxic nerve agents with no known civilian use: three cover phosphorus-based agents (in the ‘novichok family’), and the fourth is a family of carbamates, another kind of nerve agent. The convention already prohibited using these (or any chemical) to intentionally kill or harm people through toxicity. Now, their production, transfer and storage are subject to stringent verification by the OPCW, through declarations and on-site inspections.”

“Yet some states have been reticent to share data on these chemicals with the OPCW. The lack of information on the newly scheduled chemicals is in jarring contrast to what we have on other weapons listed in the convention and on their precursors. To ensure the health and safety of staff members during inspections, the OPCW needs the best understanding of these chemicals’ properties, the types of personal protective equipment and medical countermeasures that are effective against them and the analytical methods for detecting them. These data would also help us to provide the best information and training to all member states, ensuring that they are prepared in the event that any of these chemicals are used as a weapon.”

“29 Morally Bankrupt Governments, Headed by Russia, Voted Against the OPCW’s Resolutions”

The Syrian Network for Human Rights recently released this report “…emphasizing that many states worldwide must bring cases against the Syrian regime before the International Criminal Court (ICC) over the regime’s repeated violations of the Chemical Weapons Convention (CWC).”

“In the 15-page report, SNHR notes that the Syrian regime has carried out 184 chemical attacks since ratifying the Convention in September 2013. The report outlines the decisions adopted by the Organization for the Prohibition of Chemical Weapons (OPCW), identifying the states that voted against those decisions, or in other words the states that support the continuation of the Syrian regime’s chemical weapons program. Through this action, it notes, these states are, in effect, encouraging the regime to use weapons of mass destruction – chemical weapons – and emboldening it to carry out more chemical weapons attacks against the Syrian people.”

“Scientific Experts Provide Key Recommendations on Biotoxin Analysis to the OPCW”

“The Scientific Advisory Board (SAB) of the Organisation for the Prohibition of Chemical Weapons (OPCW) endorsed a report outlining key recommendations on biotoxin analysis and investigations of their alleged use as weapons submitted by a SAB Temporary Working Group (TWG) earlier this year.”

“Biotoxins are toxic chemicals produced by living organisms, which vary widely in properties such as structure, size, and mechanisms of toxicity. Some biotoxins can  be more toxic than traditional nerve agents. There are two biotoxins subject to stringent verification measures under the Chemical Weapons Convention – ricin and saxitoxin – with many others also posing safety and security concerns.” 

“The risk of misuse of biotoxins as weapons requires the OPCW to be prepared to conduct various investigations and missions related to their alleged use. To ensure the Organisation’s readiness to do so, the TWG’s report makes critical recommendations to the OPCW…”

Read more here.

“2023 Catalogue of Civil Society Activities Supporting the Chemical Weapons Convention”

The Stimson Center recently released its 2023 Catalogue of Civil Society Activities Supporting the Chemical Weapons Convention, “a catalogue of civil society capacity-building, assistance, and/or research programs supporting the Chemical Weapons Convention (CWC). The catalogue highlights all interested parties, including the CWC States Parties, the Organisation for the Prohibition of Chemical Weapons (OPCW), the Global Partnership Against the Spread of Weapons and Materials of Mass Destruction, international organizations, and industry stakeholders, civil society’s contributions to strengthen reducing the threat of chemical weapons and promoting the peaceful use of chemistry. By providing a uniform product, interested parties will be able to easily identify programs, experts, and organizations that support the CWC and related chemical weapons nonproliferation instruments.”

“Emerging and Re-Emerging Chemical Threats (Part 2)”

MRIGlobal continues their discussion of CW threats with “Chemical Threats on the Battlefield and Home Front” in this blog post, explaining in part “Today’s conflicts around the world highlight the current and pressing need for continued research to help ensure the safety of anyone in danger. And though we touched on “Emerging and Re-emerging Chemical Threats” earlier in the year, because emerging and re-emerging chemical threats pose an ever-present challenge to both warfighters and civilians, we are revisiting the topic to share additional expertise. To learn more, we visited with Cristina Youngren and Evan Durnal, subject matter experts in MRIGlobal’s Integrated Defense Solutions division.”

“What Does a French Arrest Warrant Mean for Normalization With Assad?”

Julia Neumann discusses what France’s arrest warrants for Bashar al-Assad and several associates mean in practice and for regional normalization in this piece for Syria Direct.

“Why Cheap Drones Pose a Significant Chemical Terrorism Threat”

Zachary Kallenborn recently published this piece with The Bulletin of the Atomic Scientists, writing in part “Relatively cheap drones are becoming a mainstay of conflicts, from the war in Ukraine to the Israel-Hamas conflict in Gaza. Though drones were once the purview of rich and powerful militaries, it’s now possible to use cheap consumer drones in battle. With a few tweaks, they can whistle past even sophisticated air defenses. As Al-Bared’s case highlights, they may also present a significant chemical terrorism threat. Drones can be equipped with sprayers to deliver chemical weapons, or they could be used in an attack on a chemical plant. They could also provide critical attack support, helping with reconnaissance to plan out and conduct an attack, monitor law enforcement response, and create propaganda to highlight terrorist activities.”

“Stanford Emerging Technology Review: Reporting on Key Technology Areas and Their Policy Implications”

“Emerging technologies are transforming societies, economies, and geopolitics. This moment brings unparalleled promise and novel risks. In every era, technological advances buoy nations that develop and scale them—helping to save lives, win wars, foster greater prosperity, and advance the human condition. At the same time, history is filled with examples where slow-moving governments stifled innovation in ways policymakers never intended, and nefarious actors used technological advances in ways that inventors never imagined. Technology is a tool. It is not inherently good or bad. But its use can amplify human talent or degrade it, uplift societies or repress them, solve vexing challenges or exacerbate them. These effects are sometimes deliberate but often accidental.”

“The stakes of technological developments today are especially high. Artificial intelligence (AI) is already revolutionizing industries, from music to medicine to the military, and its impact has been likened to the invention of electricity. Yet AI is just one among many technologies that are ushering in profound change. Fields like synthetic biology, materials science, and neuroscience hold potential to vastly improve health care, environmental sustainability, economic growth, and more. We have experienced moments of major technological change before. But we have never experienced the convergence of so many technologies with the potential to change so much, so fast.”

“The Stanford Emerging Technology Review (SETR) is the first product of a major new Stanford technology education initiative for policymakers. Our goal is to help both the public and private sectors better understand the technologies poised to transform our world so that the United States can seize opportunities, mitigate risks, and ensure that the American innovation ecosystem continues to thrive.”

ICYMI: FBI Director Statement Before the House Committee on Homeland Security

FBI Director Christopher Wray delivered this statement to the House Committee on Homeland Security last month, highlighting the work of his agency across several mission areas, including emerging technologies and counter WMD. Wray explained in part of this statement that, “In addition to fighting terrorism, countering the proliferation of weapons-of-mass-destruction materials, technologies, and expertise, preventing their use by any actor, and securing nuclear and radioactive materials of concern are also top national security priority missions for the FBI. The FBI considers preventing, mitigating, investigating, and responding to weapons of mass destruction (“WMD”) terrorism a “no-fail” mission because a WMD attack could result in substantial injuries, illness, or loss of lives, while yielding significant social, economic, political, and other national security consequences. In collaboration with federal, state, local, tribal, territorial, and other partners, the FBI integrates complementary efforts to counter WMD terrorism. An example of this collaboration is the FBI-led Weapons of Mass Destruction Strategic Group. This interagency crisis action team spans more than 15 departments and agencies to coordinate the federal government’s response to WMD threats and incidents. Alongside the FBI, the Department of Homeland Security maintains the largest footprint on the strategic group.”

Read the full statement here.

NEW: Looking Ahead in Ukraine: What Could Increase the Risk of Escalation?

“As U.S. lawmakers debate the question of continued defense and humanitarian aid to Ukraine, the Ukrainian fight to expel Russian invaders continues with no end in sight. The stalemate on the front lines in Ukraine masks continued intense fighting and demands for resources on both sides that may drive longer-term changes—on the battlefield, inside Russia, and beyond. This could lead to further escalation, including the potential to turn the conflict into a wider war. Understanding which circumstances and policies may risk escalation in Ukraine is paramount: not only are decisions about supporting Ukraine critical to the long-term trajectory of the conflict but also the United States confronts a broad set of challenges across the globe.”

“Please join RAND’s National Security Research Division on Tuesday, December 5, 2023, 9:30 – 11:00 am ET, for a moderated panel discussion about which circumstances or policies may risk escalation in Ukraine—either deliberate or inadvertent—and the potential triggers and restraining factors likely to shape Russian escalation decisions in particular.”

“Missy Ryan, a national security reporter at the Washington Post, will moderate the discussion.”

Learn more and register here.

NEW: Threat Agnostic Biodefense Webinar: Assessing the Zoonotic Risk of Pre-Emergent Viruses

From PNNL: “Exploration of the “virosphere” is in its golden age. The sheer number of new viruses discovered daily, and the fact that most cannot be cultured, creates enormous uncertainty about where to allocate attention and resources. It is not an intractable problem, however, to distinguish those few viruses that are likely to emerge as zoonoses from the many others that are not. This talk describes two diametric approaches to addressing this problem. The first approach involves a field-to-lab investigative methodology that, when combine with biologically informed predictive computational models, can assess the zoonotic risk of viruses that have not yet been identified in humans. The second approach relies on the power of modern methods in anthropology and ethnography to identify zoonotic transmission pathways, even before the identification of any pathogens that might traverse those pathways. A unifying example is simian hemorrhagic fever virus and its relatives in the family Arteriviridae, which cause important animal diseases but have never been documented to infect humans. Both approaches identify these viruses as high-risk pre-emergent zoonoses.”

Learn more and register for this December 6 event here.

NEW: Bio & Beer

“As a rising global leader in the bioeconomy, investments in the future STEM workforce are critical in order to secure the U.S.’s position as a world resource for biohealth technology and innovations. Join us and our three guest speakers as we discuss the importance of a diverse, skilled STEM workforce to address rapidly increasing industry demand. We will also talk about training and other opportunities designed to prepare individuals for STEM careers. Enjoy an evening of networking, drinks, and fun!”

Learn more and RSVP here.

Meeting the Moment: Biodefense Policy, Procurement, and Public Health

From the Bipartisan Commission on Biodefense: “As the Nation continues to endure the consequences of recent pandemics, and with continued interest in biological weapons by nation states and other enemies, the federal government has an opportunity to address vulnerabilities in the biodefense enterprise. At this meeting, titled Meeting the Moment: Biodefense Policy, Procurement, and Public Health, the Commission intends to further explore : (1) biodefense policies and activities at the Department of Defense; (2) federal stockpile evaluation and decision-making for smallpox medical countermeasures; (3) needed authorities of the Department of Health and Human Services, including the Centers for Disease Control and Prevention; and (4) biodefense leadership.”

This meeting will take place on December 5, from 10:30 am until 4 pm ET. Register here.

2023 EPA International Decontamination Research and Development Conference-“Advancing Preparedness through Science and Collaboration”

“The clean-up of chemical, biological, or radiological (CBR) contamination incidents and natural disasters is a critical challenge for the United States. Understanding how to characterize and remediate affected areas of environmental contamination and waste is necessary for daily life to return.”

“The Decon Conference is designed to facilitate presentation, discussion, and further collaboration of research and development topics focused on an all-hazards approach to remediate contaminated indoor and outdoor areas, critical infrastructure, water distribution systems, and other environmental areas/materials.”

“This conference is free and open to the public. Content and presentations are geared towards the emergency response community, including local and state emergency managers, homeland security officials, first responder coordinators, private sector industry, risk managers, educators in the field of emergency management, and others.”

This event will take place December 5-7 in Charleston, SC. Learn more and register here.

Mitigating Arboviral Threats and Strengthening Public Health Preparedness

“Arboviruses are a broad group of viruses that are spread by arthropods, such as ticks and mosquitoes. Diseases caused by arboviruses, like dengue, chikungunya, Zika, and yellow fever, present a significant public health burden and threaten billions of people worldwide. Despite the global recognition of the devastating health and economic impacts of these diseases, the need persists for improved integration of mitigation efforts into public health systems and environmental and urban planning.”

“The National Academies Forum on Microbial Threats will conduct a two-day workshop that will identify lessons learned from previous outbreaks, outline current arbovirus surveillance capacities, and describe novel approaches to arbovirus mitigation. The workshop will include perspectives from researchers, public health practitioners, and environmental management experts from across the globe.”

This event will take place on December 12 and 13. Learn more here.

Presidential Advisory Council on Combating Antibiotic-Resistant Bacteria (PACCARB) Virtual Meeting

“The Presidential Advisory Council on Combating Antibiotic-Resistant Bacteria (PACCARB) provides advice, information, and recommendations to the U.S. Secretary of Health and Human Services (HHS Secretary). The council supports and evaluates U.S. government activities focused on fighting antimicrobial resistance (AMR) in human health, animal health, and environmental health. Using this One Health approach, members of the PACCARB have expertise from a range of backgrounds, including academia, industry, public health, advocacy, veterinary, and agricultural production.”

“The PACCARB was established under Executive Order 13676 and included in the Pandemic and All-Hazards Preparedness and Advancing Innovation Act of 2019 (PAHPAIA). Since 2019, the President has given authority to the HHS Secretary as the primary recipient of PACCARB recommendations. Additional information on the authority and activities of the PACCARB can be found on the About Us page in the charter.”

“As a federal advisory committee, the PACCARB looks to engage with the public and all AMR stakeholders. The council holds several public meetings every year both in-person and live streamed on the HHS.gov website. These meetings are open to anyone with an interest in combating AMR. See how to get involved!”

This virtual meeting will take place on December 20 from 9-4 EST. Learn more here.

61st ISODARCO Course: Nuclear Order and International Security after Ukraine

“The war in Ukraine has had an enormous impact on global security, reviving nuclear fears, undermining the prospects for arms control, and shattering many of the norms and constraints that were the foundation of European security.  ISODARCO 2024 will examine the global nuclear order in light of the Ukraine war, focusing on the states, the policies and the technologies that will shape the future in a much more difficult environment.  How will we cope with this more dangerous world?”

This course will take place January 7-14, 2024, at the University of Trento. Learn more and register here.

International Conference, CBRNE Research & Innovation

“The last 40 years have demonstrated that both military and civilian populations could be exposed to highly hazardous CBRNE agents following conflicts, natural outbreaks and disasters, industrial incidents or terrorist attacks.”

“Worldwide, researchers, responders and industrial capacities have been commited to provide adapted response to these challenges.”

“Building on the success of the first 5 International Conferences « CBRNE Research and Innovation » which took place in Antibes (2015), Lyon (2017), Nantes (2019), on line (2021) and Lille (2022), we want to give you a new opportunity to build up or strengthen collaborative networks in Strabourg (March 19th – 21rst 2024).”

“The CBRNE R&I Conference is specifically devoted to scientific updates, responders’ feedbacks and expression of needs. It also includes workshops and demonstrations of innovative materials, technologies and procedures, according to the following themes: DETECTION – IDENTIFICATION, PROTECTION – DECONTAMINATION, MEDICAL COUNTERMEASURES, RISKS & CRISIS MANAGEMENT.”

“Looking forward to your proposals for communication and to welcoming you at Strasbourg in March 2024!”

Learn more here.

Registration for GHS 2024 Now Open

Registration is now open for the Global Health Security 2024 conference in Sydney, Australia. This iteration will take place 18-21 June, 2024. The call for abstracts is also still open. “The mission of the Global Health Security conference is to provide a forum where leaders, researchers, policy-makers, and representatives from government, international organisations, civil society, and private industry from around the world can engage with each other, review the latest research and policy innovations, and agree solutions for making the world safer and healthier. To that end, our mission is to help foster a genuinely multidisciplinary community of practice that is committed to working collaboratively to enhance global health security and eliminate disease, irrespective of its origin or source.”

Council on Strategic Risks Launches the Nuclear Weapon Systems Project

“How states view the roles and relevance of nuclear weapons is changing. While these perspectives have been dynamic since the dawn of the atomic age, the changes occurring today and drivers of these changes are particularly worrisome—in particular given that they seem to be on the cusp of reversing a period heavily characterized by arms control agreements, reductions in global arsenals, and advances in international cooperation to reduce nuclear weapons risks.” 

“CSR’s core nuclear policy work to address this challenging time has focused largely on qualitative approaches to reducing the risks of nuclear miscalculations, uses of these weapons, arms racing behavior, and other dangerous trends. Going beyond numbers of weapons—which has been a major policy focus given numerical limitations in past nuclear treaties—a qualitative view of the nuclear weapons landscape is done through the lens of the nuclear capabilities nations seek, and associated policies and postures. This can help to show where multiple nations might find areas for potential cooperation that would be mutually beneficial. It can also help to show where nations currently possess the capabilities they claim to need, and thereby in what ways cooperative or unilateral measures of restraint are the most appropriate.”

“In order to facilitate this work by CSR and by others, we are launching The Nuclear Weapon Systems Project to help visualize how the types of nuclear capabilities fielded in the world have evolved since the advent of these weapons.”

“This project seeks to document and characterize every deployed nuclear weapons system that NPT-recognized nuclear states have developed in history. More than just a list of bombs, missiles, and artillery shells, the resulting dataset illustrates a complex story of risks, strategies, and lessons learned—and lost. We consider this data to be a living resource, and encourage outside contributions and feedback.”

Read more here.

“Georgetown Global Health Center Launches First Open-Access Wildlife Disease Database”

Georgetown University Medical Center’s Center for Global Health Science and Security recently announced “the launch of a first-of-its-kind wildlife disease database — a system for collecting records of viruses, bacteria, fungi, parasites, etc. — designed to support an early warning system for potential viral emergence. The Pathogen Harmonized Observatory, or PHAROS, is open to the global community and free to access.”

“Scientists in GHSS’ Verena program, a collaborative institute comprising a global team of scientists, designed PHAROS to advance research and education around viral emergence — the process of viruses jumping from animals to humans. Verena co-founder and director Colin Carlson, PhD, says most platforms designed to track diseases in wild animals are very limited and are developed only in response to a major outbreak, such as birds dying off suddenly due to avian flu.”

‘“Our goal is to build a data sharing system that lets us eventually predict pandemics like the weather,” Carlson says. “When we collect data on wildlife viruses, it gets published in journals and then lost forever, because it isn’t ever standardized or compiled. After COVID, there’s no excuse to keep working that way.”’

Texas A&M Research Assistant Professor (Pandemic Preparedness/Biosecurity) Openings

Texas A&M University’s Scowcroft Institute of International Affairs is seeking up to two Research Assistant Professors with expertise in pandemic preparedness and/or biosecurity. The Research Assistant Professor will be in the Scowcroft Institute of International Affairs, Bush School of Government & Public Service, and will work with the Pandemic Preparedness & Biosecurity Policy Program. Responsibilities include teaching graduate courses, conducting research, and writing policy-relevant publications on biosecurity, global health security, bio and agro-defense, federal life sciences policy, one health, biotechnology, or related policy topics. 


Learn more and apply here.

Event Summary: Building Capacities for Addressing Future Biological Threats

Defining Convergence

By Geoffrey Mattoon, Biodefense MS Student

On Tuesday, 20 September, the Council on Strategic Risks (CSR) hosted the “Building Capacities for Addressing Future Biological Threats” webinar, which included keynote speaker Dr. David Christian (Chris) Hassell, Deputy Assistant Secretary for Preparedness and Response at ASPR, speakers Dr. Pardis Sabeti, Professor at the Center for Systems Biology at Harvard University, and Dr. Akhila Kosaraju, CEO and President of Phare Bio, and was moderated by Dr. Yong-Bee Lim, Deputy Director of the Janne E. Nolan Center on Strategic Weapons and George Mason Biodefense Program alumni. Together they discussed the evolving biological threats landscape and the means that exist to improve preparedness and response. This event follows the previous webinar “The American Pandemic Preparedness Plan: One Year of Progress & The Path Forward,” also hosted by CSR on 8 September, and focused heavily on the need for greater cooperation, collaboration, and innovation to prepare for the next pandemic.

             Dr. Hassell began the event by highlighting the misconceptions associated with the terms “convergence” and “bioconvergence” within the field. His concern was that these terms have become buzzwords within biodefense and their use implies that the different fields and disciplines necessary for biodefense are converging or cooperating organically. Such a misconception leads those within and outside of the field to assume that unity of effort is common and effortless, which is not the case. Barriers to convergence are prevalent and numerous, both in government and private sectors. Dr. Hassell provided an example from his previous experience in the Department of Defense developing chemical detectors, comparing a lack of higher-level convergence to the lack of standardized interfaces on different detectors preventing operators from gaining competency on all systems after mastering any single system. Such stove-piping of systems and efforts prevents convergence and is common across biodefense. The solution is a greater degree of crosstalk between disciplines working towards a unified solution or goal. Providing another example of this failure of convergence, Dr. Hassell highlighted the recent Pentagon appropriations for biodefense failing to account for the need for cyber funding to be successful against future threats as that discipline becomes more critical.

            Dr. Hassell also indicated that biological threats, in addition to the biodefense, are converging. As biotechnology and other life sciences continue to advance, the line between chemical and biological threats blurs. Previous research has demonstrated this growing convergence, from opioid-producing yeast conducted by Galanie et al. published in Nature to chemical synthesis of toxins conducted by Matinkhoo et al. in the Journal of the American Chemical Society. He urges a greater convergence of chemical and biodefense disciplines to effectively overcome these threats in the future. Such efforts would come at a substantial cost and require the reorganization of numerous government agencies, but it may be necessary to respond to the evolving threat landscape and enable more efficient use of future funding to unify efforts.

            Dr. Hassell then commented on the need for greater inclusion of data sciences, data technologies, and nanotechnologies in future biodefense efforts. The necessity of greater convergence between chemical and biodefense and the inclusion of these disciplines is a key requirement identified in Biodefense in the Age of Synthetic Biology, a report prepared by the National Academies for the Department of Defense in 2018. The addition of these technology-based disciplines is indicative of a greater requirement for technology convergence in chemical and biodefense efforts to combat the rising technology integration in the threat landscape. Modern biotechnology has created significant risk of dual use to create ever greater biological threats. Dr. Hassell pointed to the recent “Dual Use of Artificial-Intelligence-Powered Drug Discovery,” published by Urbina et al. in Nature Machine Learning, that indicated how easy it may be for a machine learning system designed with the best of intentions to identify new therapeutic disease inhibitors to be reprogrammed to instead identify novel toxin molecules. In that report, the MegaSyn system was able to generate 40,000 novel VX molecules in less than 6 hours. Dr. Sonia Ben Ouagrham-Gormley, Associate Professor at George Mason University and author of Barriers to Bioweapons, indicated such results do not directly equate to actionable threats on the Radiolab episode 40,000 Recipes for Murder that covered this journal article, but they still are indicative of the evolving chemical and biological threat landscape. Dr. Hassell also indicated the convergence of other disciplines critical to future biological threats, including climate change, which is enabling greater zoonotic spillover events, generating new and often novel biological threats.

            Dr. Pardis Sabeti underscored deadly infectious diseases as an existential threat to humanity during her remarks. She agreed with Dr. Hassell’s call for greater convergence and stated we must aspire to use technology to outpace the evolution of diseases so that we can be more anticipatory and less reactionary in the face of future outbreaks. She emphasized that COVID-19, though a recent a traumatic pandemic, is not the biggest threat we have faced or could face in the future. She argued we are on the precipice of cataclysm if we do not relentlessly pursue these efforts of convergence to enhance biodefense. Infectious disease is an existential threat that we can address because the tools necessary for biodefense are not bespoke or esoteric. Effective current and future biodefense tools, she argued, must be broad spectrum, offer daily value, contain transferrable benefits and knowledge, and be embraced at a cultural level to be effective. In line with the previous CSR webinar on COVID-19, Dr. Sabeti called for a greater commitment to community engagement as a key effort to combat future biological threats.

            Dr. Akhila Kosaraju then emphasized the need to take novel technologies required for biodefense out of the lab and into the field. She also supported the need for greater convergence, stating such efforts must be intentional to be successful. Her company, Phare Bio, exemplifies such efforts, employing AI and deep learning to enable rapid antibiotic discovery to overcome rising drug resistances. This approach provides Phare Bio a strategy to overcome the drug development “valley of death” where most current pharmaceutical development fails and presents an opportunity for other organizations like it across biodefense.  Modern biodefense efforts must emphasize biotechnology, relying on computational biologists, bioengineers, and other technical experts to maximize advances in the field.  She also indicated a need for organizations like The Audacious Project, a backer of Phare Bio, to effectively unify disciplines to solve intractable problems like drug resistance. The Audacious Project is a “collaborative funding initiative catalyzing social impact on a grand scale” across a broad range of disciplines that seeks to de-risk and encourage innovation. Injection of philanthropic, grant, or even government funding sources to adequately de-risk the “valley of death” and other obstacles is essential to future preventative and treatment therapeutics. Additionally, biodefense must strive to recognize small players in the field that often offer bespoke technologies and solutions that can accelerate efforts beyond that of the usual bigger players, as demonstrated throughout the COVID-19 pandemic. Efforts like Operation Warp Speed serve as foundational examples to the benefits such efforts can provide to the future of biodefense.