Pandora Report 3.7.2025

This week’s Pandora Report covers updates on the Trump administration’s response to the West Texas measles outbreak, challenges at NIH, possible budget cuts to DOD programs focused on WMDs and pandemic preparedness, and more.

Biodefense MS Information Session

“Prospective students are invited to attend a information session to hear more about the Biodefense M.S. program offered at the Schar School. The online session will provide an overview of the program, as well as the application process, student experience and graduate outcomes. This session admissions will be led by the Graduate Admissions team.”

This sessions will take place at 12 pm EDT on March 20. Learn more and register here.

Updates on the Trump Administration

Top HHS Officials Retire and Resign

Francis S. Collins, the well-known geneticist who ran the National Institutes of Health for 12 years, announced on Saturday that he has retired from the NIH and the federal government. Collins did not provide a reason for his departure, and he has refused to do any interviews. His parting statement offered a subtle yet pointed message to the Trump administration, with Collins writing in part “As I depart N.I.H., I want to express my gratitude and love for the men and women with whom I have worked side by side for so many years. They are individuals of extraordinary intellect and integrity, selfless and hard-working, generous and compassionate. They personify excellence in every way, and they deserve the utmost respect and support of all Americans.”

Tom Corry, Assistant Secretary of Public Affairs at HHS, also abruptly resigned from the department last Friday, just two weeks after starting his new role. Corry did not provide a reason for his departure either. He previously served as a senior advisor and Director of Communications at the Centers for Medicare & Medicaid Services during the first Trump administration.

Kennedy Embraces Unconventional Remedies as Measles Outbreak Grows

As the West Texas measles outbreak grows, HHS Secretary RFK Jr. has touted several unconventional remedies while continuing to not urge all Americans to get vaccinated against the disease. In an interview, Kennedy said the federal government is shipping doses of vitamin A to Gaines County, Texas, the epicenter of the outbreak, and helping to arrange ambulance rides. He also claimed that physicians in Texas have seen “very, very good results” treating measles with budesonide, clarithromycin, and cod liver oil. This has prompted strong backlash from many in the medical community.

As of March 6, 222 cases have been reported in Alaska, California, Florida, Georgia, Kentucky, New Jersey, New Mexico, New York City, Pennsylvania, Rhode Island, Texas, and Washington. The US eliminated measles in 2000. Today, an unvaccinated adult in New Mexico has been reported dead, a little over a week after the death of an unvaccinated child in Lubbock, Texas. The Pan American Health Organization issued an epidemiological alert in response to the outbreak earlier this week.

Bhattacharya Promises “Scientific Dissent” at NIH

Jay Bhattacharya, Donald Trump’s nominee for NIH director, said on Wednesday that NIH officials “oversaw a culture of coverup, obfuscation, and a lack of tolerance for ideas that differed from theirs” in recent years. He promised to, in response to this, “establish a culture of respect for free speech in science and and scientific dissent at the agency.”

Bhattacharya infamously co-authored the Great Barrington Declaration in October 2020, which argued for allowing people at lower risk of COVID-19 complications to go about life as normal, assuming that, if infected, they would experience mild disease and contribute to herd immunity. NPR explains that, “During the COVID pandemic, Bhattacharya clashed with the mainstream medical establishment, including the NIH, over lockdowns and other measures designed to control the spread of the virus. He says he was shunned and penalized for his views and he didn’t want anyone else to suffer the same fate.”

NIH Set to Terminate Active Research Grants

The NIH has begun mass terminations of research grants funding active scientific projects that no longer meet “agency priorities”. According to Nature News, “NIH staff members have been instructed to identify and potentially cancel grants for projects studying transgender populations, gender identity, diversity, equity and inclusion (DEI) in the scientific workforce, environmental justice and any other research that might be perceived to discriminate on the basis of race or ethnicity, according to documents and an audio recording that Nature has obtained. Grants that allot funding to universities in China and those related to climate change are also under scrutiny.”

This comes after a federal court temporarily blocked the administration’s proposed cut to NIH funding for universities’ indirect costs like facilities and administration. However, as Politico points out, the administration may pivot to renegotiating the payments with individual universities.

DOD Cuts Threaten Pandemic Preparedness, WMD Proliferation Prevention, and More

DOD agencies responsible for preventing WMD proliferation and building security capacity globally are at risk of intense budget cuts or outright abolition. According to a recent draft working paper, DOD is asking all agencies and services that oversee security cooperation programs to assess potential impacts of funding realignment. The paper was prepared in response to an RFI from Secretary of Defense Pete Hegseth that asked agencies to assess consequences of four levels of staff reduction, including 25%, 50%, 75%, and 100%. The authors of the working paper, according to WIRED, “…warn that the cuts could hobble the fight against organized crime in South America, impair the battle against the Islamic State, increase the likelihood of a rogue state producing and using chemical weapons, and defund pandemic surveillance measures.”

CDC Staff Now Prohibited from Co-Authoring Papers with WHO Personnel

Scientists at the CDC are now prohibited from co-authoring publications with WHO staff, according to reporting from HuffPost. An interim guidance document obtained by the news agency explained that “CDC staff should not be co-authors on manuscripts/abstracts with WHO staff,” while also adding that CDC staff should not author publications related to work that is “funded by WHO.” The guidance further instructs CDC staff who are lead authors on such publications to either pause all action on those publications, or to recuse themselves as authors if the publication process cannot be paused. It also says that manuscripts not in compliance with Trump’s executive orders that were submitted prior to January 20 should be withdrawn, or CDC staff should recuse themselves as authors.

US Funding Cuts Threaten Global Fight Against TB

The WHO issued a warning on Wednesday explaining that severe funding cuts (namely, those in the United States) threaten decades of progress in the global fight against tuberculosis. The agency explained that essential prevention, testing, and treatment services are collapsing, leaving millions at risk. The regions most affected include Africa, Southeast Asia, and the Western Pacific, where national TB programs depend on international support.

The TB Community Coordination Hub said in a statement about the funding cuts, “[We] strongly condemn this callous, abrupt and totally one-sided act that is unprecedented, and calls upon the US Administration to take immediate measures to restore funding and support projects globally that are crucial to contain and prevent a resurgence of this deadly disease.”

Further Reading:

CDC Monitoring Mysterious Disease in DRC

In a statement on Tuesday, the CDC said it is closely monitoring the outbreak of an unknown disease that has already killed dozens in the Democratic Republic of Congo. According to WHO, at least 1,318 people have exhibited symptoms of the disease, and 60 had died from it by February 27. A new mpox variant was also recently discovered in the country. The new variant has a mutation known as APOBEC3, which indicates it may be more easily transmissible than previously identified strains.

“WHO Technical Advisory Group on the Responsible Use of the Life Sciences and Dual-Use Research: Report of the Meeting, 30 October 2024”

From WHO: “The World Health Organization (WHO) Technical Advisory Group on the Responsible Use of the Life Sciences and Dual-Use Research (TAG-RULS DUR) was established to provide independent advice to WHO on the monitoring and mitigation of biorisks, the advances in the life sciences and related technologies, the governance of dual-use research and the responsible use of the life sciences. This report summarizes the meeting that was virtually held on 30 October 2024. Over the course of the meeting, participants discussed and provided feedback on activities to operationalize the framework and delivered updates on activities of the TAG-RULS DUR’s four working groups.”

“A WHO Global Framework to Guide Investigations Into Origins of Potentially Epidemic and Pandemic Pathogens”

The Scientific Advisory Committee for the Origins of Novel Pathogens (SAGO) and WHO SAGO Secretariat recently published this comment in Nature, writing in its introduction “In outbreak situations involving a novel pathogen timely and coordinated response is crucial. The WHO Scientific Advisory Group for the Origins of Novel Pathogens recently released a global framework to guide future scientific investigations into the origin of emerging pathogens.”

“Recent Virus Research Should Raise the Alarm”

W. Ian Lipkin and Ralph Baric recently published this opinion piece in The New York Times: “There’s a central question that many scientists face: How can scientific discoveries drive humanity’s progress without posing a dire risk to it? As virus experts, we’re committed to research that uncovers pandemic threats and helps protect people from them. But we are concerned about how some scientists are experimenting with viruses in ways that could put all of us in harm’s way.”

“From Inception to Fielding: Meeting the Challenges of Medical Countermeasure Development”

Sarah M. Wiles recently published this article in CBNW: “The U.S. Joint Program Executive Office for Chemical, Biological, Radiological and Nuclear Defense has a robust development process for new CBRN medical countermeasures. Sarah M. Wiles explains the process and its rationale.”

“Automated Grading for Efficiently Evaluating the Dual-Use Biological Capabilities of Large Language Models”

Bria Persaud, Ying-Chiang Jeffrey Lee, Jordan Despanie, Helin Hernandez, Henry Alexander Bradley, Sarah L. Gebauer, Greg McKelvey, Jr. recently published this RAND Corporation working paper: “The authors of this working paper developed a proof-of-concept automated grader and used it to assess large language models’ abilities to answer knowledge-based questions and generate protocols that explain how to perform common laboratory techniques that could be used in the creation of proxies for biological threats.”

“UNIDIR Empowers Emerging Leaders in Biological Disarmament and Biosecurity”

From UNIDIR: “As the world marks the 50th anniversary of the Biological Weapons Convention (BWC), UNIDIR alongside the DiploFoundation and the Fondation pour la Recherche Stratégique celebrates the successful completion of the inaugural BWC Advanced Education Course (BWCedu). This five-month advanced training programme – funded by the UK’s Foreign, Commonwealth & Development Office – brought together 25 emerging leaders from a diverse range of States, with a focus on participants from the Global South.”

Read here.

“Seven Years Since Salisbury Was Centre of Novichok Attack”

Isabella Holliday recently authored this news article about the anniversary of the Novichok attack targeting the Skripals in Salisbury, UK. Read it in the Salisbury Journal here.

“Syria’s Caretaker Foreign Minister Addresses OPCW’s Executive Council”

From OPCW: “In a landmark visit to OPCW’s Headquarters in The Hague, caretaker Foreign Minister al-Shaibani reaffirmed the commitment of the new Syrian authorities to cooperate with the OPCW to eliminate the chemical weapons programme of the former Syrian regime”.

Read here.

ICYMI: The Cost of Defunding PEPFAR and the Impact on the Fight Against HIV/AIDS

Brown’s Pandemic Center hosted this webinar in late February. Watch the recording here. Key topics included:

“Call for Action – How policymakers, philanthropists, and institutions can mobilize to address these urgent gaps.”

“PEPFAR Changes & Uncertainty – Concerns about funding gaps, particularly affecting pediatric HIV treatment, maternal health, and job losses in healthcare.”

“Impact on South Africa & Beyond – The success of PEPFAR in South Africa and the potential consequences of its reduction, including rising HIV cases and strain on health systems.”

“Future of Global Health Funding – Exploring alternative funding sources, the role of UNICEF, private sector involvement, and the need for governments to step up.”

NEW: Building Trust in the H5N1 Response: Perspectives from the Field

From NASEM: “Since avian influenza (H5N1) was first detected in dairy cattle in March 2024, H5N1 has resulted in human infections, diminished livestock production, and decimated wildlife populations. Uncoordinated policies at the national, state, and local levels have challenged mitigation efforts, and mistrust has hindered the urgent response needed for the rapidly evolving threat. The National Academies Forum on Microbial Threats will host a public webinar on March 27 where agricultural producers and workforce health specialists will explore strategies to build greater mutual trust and a coordinated One Health response.”

This webinar will take place on March 27 at 2 pm ET. Register here.

2025 Scowcroft Institute Pandemic Policy Summit

From the Scowcroft Institute: “The Scowcroft Institute of International Affairs at Texas A&M University invites you to attend the 2025 Scowcroft Institute Pandemic Policy Summit examining the ongoing H5N1 outbreak across the U.S. Dairy industry. This summit will bring together experts from government, academia, and industry to review the response efforts, discuss current challenges and opportunities, and identify options for moving forward. Listen to panels of subject matter experts, explore case studies from the field, and participate in networking opportunities.”

This event will take place on March 18 in Washington, DC. Learn more and RSVP here.

Sustainable Manufacturing: Building and Preserving a Resilient Medical Industrial Base

“Join industry and government partners for our second annual industry summit! During this event, leaders from IBMSC will share our strategic vision and organizational priorities. Speakers will also share potential opportunities for building and preserving the medical industrial base.  This event will be in-person only and space is limited!”

This event will take place March 11-12 in Washington, DC. Learn more and register here.

Gaming Weapons of Mass Destruction Course – From Policy to Practice

From MORS: “Gaming Weapons of Mass Destruction (WMD – defined as Nuclear, Chemical, and Biological agents) will be a three-day course focused on developing and executing games related to WMD in all its forms. While the basics of WMD capabilities and game design will be discussed, this will be a course focused on the intersection of WMD and gaming. It will not be either a WMD or gaming course; for those topics see other offerings.”

“No prior experience is required for this course, though a basic familiarity with various agents and their effects would be helpful, as would a basic understanding of professional gaming and how it is used.  The instructors will adapt in real time to class requirements (e.g., if the class is interested in animal and plant targets, the instructors have extensive experience in designing games on those subjects as well).”

This course will take place March 18-20 on Zoom. Learn more and register here.

NEW: Apply for the 2025 Youth for Biosecurity Fellowship

“The global norm against biological weapons cannot be maintained without the inclusion of youth voices in the multilateral discussions taking place in the framework of the Biological Weapons Convention (BWC). Youth perspectives are key to create innovative solutions and generate long-term engagement. There are benefits to including the perspectives of young people from developing countries, where over 90% of the world’s youth reside.”

“Organized by the United Nations Office for Disarmament Affairs in Geneva, in partnership with key international actors that empower youth in science diplomacy and global biosecurity, the Youth for Biosecurity Fellowship provides a unique learning and networking experience in the framework of the Biological Weapons Convention.”

“Launched in 2019 as a Biosecurity Diplomacy Workshop, the Youth for Biosecurity Initiative organized its first fellowship in 2023. For the third edition, the fellowship will provide the opportunity for 20 competitively selected young scientists from the Global South to join an online interactive training programme prior to a field visit during the meeting of the BWC Working Group on the Strengthening of the Convention in Geneva.”

Learn more and apply by April 7 here.

NASEM Has Questions 

The National Academy of Science, Engineering, and Medicine (NASEM) is hosting a workshop on Navigating the Benefits and Risks of Publishing Studies of In Silico Modeling and Computational Approaches of Biological Agents and Organisms on April 3-4 in Washington, DC. In preparation for the workshop, NASEM is soliciting input on how publishing computational models can support biological research while minimizing potential DURC/PEPP risks. The purpose of the questionnaire is to ascertain if organizations that publish or disseminate scientific knowledge have considered or created guidelines or policies to review, host or interact with in silico and computational models and tools, studies, datasets, etc. research that constitutes dual use, dual use research of concern (DURC) or pathogens with enhanced pandemic potential (PEPP). Have answers? Then fill out the In Silico Research Publications Pre-event Questionnaire. 

NOFO, Addressing Agricultural Biorisk Evidence Base Gaps with Applied Research
“There is a global recognition that the current evidence base to inform laboratory biological risk management has gaps, and that biosafety and biosecurity policies are not always based on evidence.1 This notice of funding will support the design and implementation of applied biorisk research to address evidence gaps in working with high-consequence veterinary and agricultural pathogens as identified during the RAV3N Biorisk and Biosafety Gap Assessment Workshop2 or similar gap analysis like the WOAH working group agent specific biorisk gap analysis.1  ERGP is seeking proposals that address one or more key focus area components listed below. Each proposal will go through an internal ERGP and external expert review. Successful proposals should address at least one of the three key focus areas and at least one component under that area.”

“This funding opportunity aims at the design and implementation of applied biorisk research to address evidence gaps in working with high-consequence veterinary and agricultural pathogens.”

“This work will contribute to recommended guidance on laboratory biosafety and agricultural biosecurity, using research techniques to evaluate the application and effectiveness in operational contexts. All proposals must make a clear experimental plan for how the applicant will test the application and outcomes of their focus area(s)/component(s) in their facility.”

Learn more and submit application by April 14 here.

Pandora Report 12.13.2024

This week’s Pandora Report covers the rush to find the former Assad regime’s hidden chemical weapons, a recent study on H5N1’s potential to become an efficient human pathogen, Nobel laureates’ call for the Senate to block RFK Jr. from becoming HHS Secretary, and more.

Assad Regime Falls

On Sunday, Syrian rebels continued their advance, taking the capital city of Damascus and forcing the country’s long-time leader, President Bashar al-Assad, to flee to Moscow. This ended the country’s 13-year-long civil war and toppled a brutal dictatorship known to have, among other things, used chemical weapons against its own civilians. Now, the country is strapped for cash and being led by opposition forces with limited experience in governance.

Adding to the chaos is the mad dash to locate the former Assad regime’s chemical weapons it hid from inspectors. Among the list of missing weapons are more than 360 tons of mustard gas that the Assad regime admitted to making, but never fully accounted for. There are also five missing tons of precursors for sarin that the Assad regime claimed were “Lost during transportation, due to traffic accidents.”

The OPCW said it is monitoring the situation, reaffirming its commitment to “clarifying gaps, discrepancies, and inconsistencies in Syrian chemical weapons declaration amidst political transition.” Rebels in the south of the country have reached out to the OPCW for support in safely disposing of a cache of CW they found. One US official told the press the US is working with other countries in the Middle East to prevent these weapons from falling into the wrong hands. Meanwhile, Israel reported that it has destroyed CW and other weapons caches while seizing areas along its shared border with the country it claims are part of a demilitarized buffer zone.

Further Reading and Listening:

New Study Finds Single Mutation in Bovine Influenza H5N1 Hemagglutinin Switches Specificity to Human Receptors

A recent study in Science found that a single glutamine to leucine mutation in clade 2.3.4.4b-an H5N1 virus widespread in US dairy cattle that has caused a few mild human cases-at residue 226 of the virus hemagglutinin “was sufficient to enact the change from avian to human specificity.” This means that this virus that currently cannot infect humans very easily could be just one mutation away from being able to do so much more effectively. This finding alone does not mean that this mutation in nature would be guaranteed to make this virus an efficient human pathogen, but it might mean that this version of the virus has a higher zoonotic potential than other H5N1 viruses.

Further Reading:

Investigation Launched into Queensland Lab Incident

An investigation has been launched by Australian authorities into the “major breach” of biosafety protocols that occurred at a state-run laboratory in Queensland in 2021. It was revealed that 323 virus samples-nearly 100 of which were live samples of Hendra virus-were missing. According to Health Minister Tim Nicholls, the incident was only discovered in August of 2023, and the lab is unable to confirm whether the materials were removed or destroyed, though there is no suggestion that they were taken or stolen from the lab.

Top Wuhan Virologist Says WIV Holds No Close Relatives to SARS-CoV-2

Shi Zhengli, the virologist leading coronavirus research at the Wuhan Institute of Virology (WIV) when the COVID-19 pandemic began, presented data on dozens of new coronaviruses collected from bats in southern China at a conference in Japan last week. Shi has said repeatedly that SARS-CoV-2 was never seen nor studied in her lab, but some have continued to insist that one of the bat coronaviruses collected by her team was closely related to it. As a result, Shi promised to sequence the genomes of the viruses stored in her freezers and release the resulting data.

The analysis presented at the conference has not been peer reviewed and includes data from the whole genomes of 56 new betacoronaviruses in addition to some partial sequences. All of these viruses were collected between 2004 and 2021. Shi explained at the conference that none of the viruses she has sequenced are the most recent ancestors of SARS-CoV-2 and that “We didn’t find any new sequences which are more closely related to SARS-CoV-1 and SARS-CoV-2.”

The known viruses that are closest to SARS-CoV-2 were found in bats in Laos and southern China. However, years (or decades) have passed since these viruses split from their common ancestor with SARS-CoV-2. Shi has long since collaborated with EcoHealth Alliance, which previously received US federal funding that was suspended because of inadequate oversight of research activities at the WIV. This collaboration has produced a larger analysis of more than 230 sequences that EcoHealth Alliance’s Peter Daszak says will be submitted for peer review and publication in the coming weeks.

Further Reading: “PLA Looks into China-US Collaboration in Biosecurity Research,” Stephen Chen, SCMP

75+ Nobel Laureates Urge Senate Not to Confirm RFK Jr.

77 winners of the Nobel Prize in Medicine, Chemistry, Physics, and Economics have signed a letter (below) urging the Senate not to confirm President-Elect Trump’s pick to lead HHS-Robert F. Kennedy Jr.. This is a rare example of Nobel laureates coming together against a US Cabinet choice, according to Sir Richard Roberts, winner of the 1993 Nobel Prize in Medicine and a drafter of the letter. The letter criticizes Kennedy’s lack of experience in public health in addition to his widely criticized opinions on topics like drinking water fluoridation and vaccines for measles and polio. The letter reads in part, “In view of his record, placing Mr. Kennedy in charge of DHHS would put the public’s health in jeopardy and undermine America’s global leadership in the health sciences, in both the public and commercial sectors…We strongly urge you to vote against the confirmation of his appointment as Secretary of the DHHS.”

Further Reading:

“2024 ABSA Conference Summary”

Biodefense MS Student Lena Kropke discusses her experience at the 67th Annual Biosafety and Biosecurity Conference in this Pandora Report event summary, writing in part “Attending this conference not only reaffirmed that biosafety and biosecurity are vital components of international security, but also showcased the incredible dedication of professionals who work tirelessly toward this mission. Moreover, it offered an introduction to an amazing network of biosafety and security professionals.”

Read more about Lena’s time attending the conference in Phoenix here.

“Disincentivizing Bioweapons: Theory and Policy Approaches”

This NTI essay collection is “…designed to encourage the exploration and identification of potential solutions to disincentivize states from developing or using biological weapons,” and aims to “bridge theory and practical policy-relevant approaches to develop new approaches to invigorate international efforts to reduce biological threats.” Its fifth essay, “Two Competing Bioweapons Nonproliferation Policies: Deterrence by Denial and Discussion,” was authored by Sonia Ben Ouagrham-Gormley, Associate Professor at the Schar School.

Mitigating Arboviral Threat and Strengthening Public Health Preparedness: Proceedings of a Workshop

From NASEM: “Arboviruses, or viruses carried by arthropods like mosquitoes or ticks, are responsible for hundreds of thousands of deaths worldwide each year. As the climate changes globally, the geographic distribution of these diseases, including Zika, dengue, chikungunya, West Nile, and yellow fever, are steadily expanding. The National Academies Forum on Microbial Threats hosted a public workshop in December 2023 to explore avenues of threat reduction from known and emerging arboviral diseases in the context of public health preparedness and capacity building. The workshop featured talks from experts in entomology, public health, ecology, virology, immunology, disease modeling, and urban planning.”

Read this Proceedings of a Workshop for free here.

“The Current Pathogenicity and Potential Risk Assessment of Nipah Virus as Potential Cause of “Disease X”: A Narrative Review”

Mehnaz et al. recently published this article in Health Science Reports: “Background and Aims…The World Health Organization (WHO) recognized the potential for a severe international epidemic and introduced the term “Disease X” to classify pathogens that not yet identified. The Nipah virus (NiV) is highly dangerous due to its zoonotic nature, high mortality rate, and ability to cause severe clinical symptoms in humans. In this review, we gather the latest information on the NiV and its potential to become a significant candidate for Disease X.”

“Methods…We performed a thorough review of articles published in PubMed, Scopus, and Google Scholar using appropriate MeSH terms and keywords. Studies reported NiV infection were considered for this review.”

“Results…The NiV exhibits different epidemiological patterns in different countries that calls for customized prevention and control strategies. Genetic analysis highlights NiV’s ability to mutate that alters possible treatment options. Transmission typically involves bats as the primary reservoir, with humans becoming infected either through intermediate hosts or food. This shows NiV’s complex nature, including its ability to reach the central nervous system through the olfactory nerve. Promising treatment options, such as monoclonal antibodies, antivirals, and ongoing vaccine research, provide hope. However, the virus’s adaptability, human-to-human transmission, and the lack of specific antiviral therapy raise concerns about its potential to cause a global pandemic. The interconnection between animals, humans, and the environment stresses the need for a One Health approach to tackle emerging infectious disease by NiV.”

“Conclusion…Global collaboration, surveillance, and research investments are imperative for the preparation of future pandemics. The ongoing COVID-19 challenges underscoring the critical need for sustained scientific endeavors, global leadership, and recognition of the prominence of NiV as a candidate for the potential Disease X.”

“Engineering Biology Public Trust Survey Findings”

From the UK’s Department for Science, Innovation and Technology, these findings are the result of a survey on public perceptions of engineering biology in relation to five application areas: health, agriculture and food, low carbon fuels, chemicals and materials, and waste and environment. Key findings from this survey include “The majority of respondents felt comfortable with using new and emerging technologies on a day-to-day basis, but relatively few could explain what engineering biology is,” “There was a strong belief amongst respondents that applications of engineering biology could be useful. Similarly, the majority were comfortable with each of the specific applications and believe that they will be positive for society,” “There was broad agreement that the government is well placed to make decisions about the use of engineering biology but the public should also be involved in decision making,” and more.

“CSR Biodefense Scorecard: Winter 2024 Update”

From the Council on Strategic Risks: “In the fall of 2023, we kicked off our Biodefense Scorecard series to help inform the public on the progress and implementation status of past CSR recommendations on reducing biological risks. This update captures several areas of sustained positive action across pathogen early warning, diplomacy, and biomanufacturing.”

“Ignoring the Real Biowarfare Threat”

David Heslop and Joel Keep discuss the potential implications of recent renovations at Sergiev Posad-6 in this piece from the Lowy Institute, writing in part “While much attention has been paid to nuclear arms, Washington and Moscow must also address biological weapons, which both nations claimed to renounce many years ago. The fate of such programs is not only a matter for Russia and the United States, but for global health security at large.”

“Instrumentalising Biological Weapons-Related Allegations: Russia’s Compliance Politics and the Norms Against Biological Weapons”

Una Jakob recently published this working paper with CBWNet discussing Russia’s use of BWC compliance procedures and their effect on norms against BW. Jakob explains in part of the paper’s executive summary, “Seen in this light, the Russian activities may counterintuitively have contributed to strengthening the norms against biological weapons at the discursive level, as no actor has called them into question and as their validity has been reaffirmed repeatedly in the process, including by Russia itself. This stands in contrast, however, to Russia’s policy which may contest biological weapons norms at the action level. This discrepancy between the discursive and practical level and its implications for norm strength merit further theoretical attention. On a policy level, it will be important to increase transparency, counter disinformation, and strengthen the means to demonstrate, verify and enhance confidence in compliance with the BWC. This would also strengthen the possibilities to address biological weapons-related allegations, including those made in bad faith, and help sustain the norms against biological weapons comprehensively and in the long term.”

“Workshop on S&T Developments with Relevance for the CWC and BWC”

Anna Krin and Gunnar Jeremias edited this CBWNet working paper detailing a workshop hosted in June at Hamburg University focused on challenges and opportunities facing biological and chemical arms control. Jeremias explains in the introduction, “Throughout the workshop, four panels delved into key topics: the general concept and application of scientific and technological advice in arms control in general and particularly in chemical and biological arms control; current developments in science and technology that may necessitate attention; potential frameworks for organizing verification under the CWC and the prospects for institution building for S&T advice and verification within the BWC; and the technologies and governance methods that could be employed to enhance the efficacy of arms control measures…The insights gathered during these discussions aim to contribute to the ongoing discourse on arms control, ensuring that both the BWC and CWC remain vital in a landscape marked by rapid scientific change. This compendium encapsulates the collaborative efforts and perspectives of workshop participants, reflecting a shared commitment to advancing arms control in an increasingly complex world.”

“High-Impact, Low-Probability: NATO-EUROPOL Cooperation in Countering the CBRN Terrorist Threat to Europe”

This JCBRN Defence COE report by Mathias Katsuya “…draws on secondary-source research and insights provided by JCBRN Defence COE personnel as well as Europol’s CBRN-E Team Leader. An initial threat assessment is followed by a review of Europol’s CBRN capabilities, centring on the role of its European Counter-Terrorism Centre and inhouse CBRN-E Team as key nodes in law enforcement information-sharing, capacity-building, and operational coordination. Having identified key doctrinal and capability overlaps with NATO in addition to a stated commitment by Europol’s CBRN-E Team to enhance its civil-military relations, the report outlines a three-pillar approach to deepening connections between NATO and Europol: short-term measures to foster staff-level contacts in both organisations, a formalised relationship between Europol’s CBRN-E Team and NATO’s JCBRN Defence COE, and deeper institutional linkages to effectively confront current and emerging CBRN threats.”

“Hybrid Threats in the CBRN Environment: Challenges and Implications”

This JCBRN Defence COE paper by Paulina Frederike Gogacz discusses hybrid CBRN threats and their use by actors like Russia. Gogacz explains in the paper’s summary that “An analysis of the six strategic enablers outlined in NATO’s Chemical, Biological, Radiological and Nuclear (CBRN) Defence Policy (2022) indicates important steps to ameliorate current defences and prepare NATO and its member states for future hybrid CBRN threats, thereby increasing overall resilience. They include important aspects: robust intelligence-sharing mechanisms to ensure timely and accurate threat information; comprehensive exercises to simulate and prepare for various CBRN scenarios; strong partnerships both within the alliance and with external entities to foster cooperation and resource sharing; effective strategic communication to manage information and public perception; collaborative scientific research to advance technological capabilities and countermeasures; and the resilience of medical infrastructure to ensure a rapid and effective response to CBRN incidents. These steps collectively aim to bolster NATO’s preparedness and adaptability in the face of evolving hybrid CBRN threats.”

“Securing a Strategic Advantage in Biosecurity for NATO”

Max Breet and Lauren Ross recently authored this commentary for RUSI, writing in their summary “NATO should recognise the importance of biosecurity by understanding it as a new domain. This would allow the Alliance to more effectively leverage existing structures to defend itself against hybrid biological threats.”

“The Rise of Mpox in a Post-Smallpox World”

McQuiston et al. recently published this article in Emerging Infectious Diseases: “Reports of mpox are rising in Africa where the disease is endemic and in new countries where the disease has not been previously seen. The 2022 global outbreak of clade II mpox and an ongoing outbreak of the more lethal clade I mpox highlight the pandemic potential for monkeypox virus. Waning population immunity after the cessation of routine immunization for smallpox plays a key role in the changing epidemiologic patterns of mpox. Sustained human-to-human transmission of mpox is occurring widely in the context of insufficient population immunity, fueling genetic mutations that affect the accuracy of some diagnostic tests and that could lead to changing virulence. Additional research should address complex challenges for control of mpox, including improved diagnostics and medical countermeasures. The availability of vaccines should be expanded not only for outbreak response but also for broader routine use for persons in mpox-endemic countries.”

“Confronting Risks of Mirror Life”

Adamala et al. recently published this Science Policy Forum piece, writing in part, “All known life is homochiral. DNA and RNA are made from “right-handed” nucleotides, and proteins are made from “left-handed” amino acids. Driven by curiosity and plausible applications, some researchers had begun work toward creating lifeforms composed entirely of mirror-image biological molecules. Such mirror organisms would constitute a radical departure from known life, and their creation warrants careful consideration. The capability to create mirror life is likely at least a decade away and would require large investments and major technical advances; we thus have an opportunity to consider and preempt risks before they are realized. Here, we draw on an in-depth analysis of current technical barriers, how they might be eroded by technological progress, and what we deem to be unprecedented and largely overlooked risks (1). We call for broader discussion among the global research community, policy-makers, research funders, industry, civil society, and the public to chart an appropriate path forward.”

Bonus: Read Carl Zimmer’s discussion of this warning in The New York Times here.

NEW: OneLab Network Webinar

“Clinical laboratories must be alert for unusual and potentially infectious agents and immediately notify their Laboratory Response Network (LRN) reference laboratory if routine diagnostic testing results in the potential identification of rare and unusual infectious agents that may be used in a bioterrorist attack or other bio-agent incident. This webinar will describe the LRN and highlight the clinical laboratory’s role and responsibilities in initiating contact with their LRN. Join us as we share an example of a response, new tools, and valuable resources to aid in the clinical laboratory’s response.”

This event will take place on December 17 at 12 pm ET. Register for this event here.

NEW: Understanding the Introduction of Pathogens into Humans- Preventing Patient Zero: A Workshop

“The past few decades have seen the emergence of several diseases with drastic public health and economic consequences. Understanding routes of pathogen emergence and transmission is critical to preventing and mitigating disease spillover and amplification. The National Academies Forum on Microbial Threats will host a hybrid public workshop to address gaps in understanding of disease emergence, with a focus on human-animal interaction and laboratory biosafety. The workshop will explore how applications of existing policy structures, emerging technologies, and actionable research can improve biosecurity measures and prevention of future disease emergence.”

This event will take place on January 15 and 16. Learn more and register here.

NEW: Rise of the Zombie Bugs: The Surprising Science of Parasitic Mind-Control

Johns Hopkins APL’s colloquium will feature Mindy Weisberger, author of the upcoming book Rise of the Zombie Bugs: The Surprising Science of Parasitic Mind-Control: “Zombies are all around us—insect zombies, that is. In Rise of the Zombie Bugs, Mindy Weisberger explores the eerie yet fascinating phenomenon of real-life zombification in the insect class and among other invertebrates. Zombifying parasites reproduce by rewriting their victims’ neurochemistry, transforming them into the “walking dead”: armies of cicadas, spiders, and other hosts that helplessly follow a zombifier’s commands, living only to serve the parasite’s needs until death’s sweet release (and often beyond).”

Learn more about this January 31 event here.

How to Avoid Human-Made Pandemics

From the Asia Centre for Health Security: “Studying viruses that could potentially cause outbreaks is one of the most effective ways to reduce the risk of pandemics. However, this type of research—especially when it involves collecting samples from the field and manipulating pathogens—can unintentionally lead to a pandemic if not managed carefully. Dr Lentzos will discuss her findings from the Pathogen Project, which brought together an international taskforce of scientists, biosecurity and public health experts, ethicists, and civil society leaders to seek consensus on this question: Can we agree on ways to manage research that carries pandemic risk as safely, securely and responsibly as possible?”

This event will take place on January 23 at 8 pm (GMT +8:00) via Zoom. RSVP here.

Preparedness in Rural Communities: National and State/Local Perspectives and Plans

From Penn State: “The COVID-19 pandemic and recent hurricanes have thrust the preparedness of rural communities into the national spotlight. At the federal level, the Administration for Strategic Preparedness and Response and the Centers for Disease Control and Prevention have recently released national goals and plans for preparedness of rural communities. The overall objective of this virtual, 2-day mini-symposium is to identify opportunities in public health and agricultural preparedness and response in rural communities. The mini-symposium will focus upon national perspectives on Thursday, January 30 and the state/local perspectives on Friday, January 31. Speakers include representatives of the Administration for Strategic Preparedness and Response, the Department of Homeland Security, US Department of Agriculture, the USA Center for Rural Public Health Preparedness, and state/local leaders.”

This event will take place on January 30 and 31, from 11 am to 2 pm ET each day. Learn more and register here.

Cyberbiosecurity Summit

From Johns Hopkins APL and Bio-ISAC: “Advancements in biomanufacturing and biotechnology drive the science we need to thrive, everything from apples to vaccines. The Cyberbiosecurity Summit 2025 convenes leading experts in biotechnology, biosecurity, and cybersecurity to explore the intersection of these fields and discuss the strategies to create a safe, secure future for us all.”
This event will take place February 25-26 in Laurel, MD. Register here and review the call for sessions here (closes 12/12).

NEW: The Independent Panel Solicits Views and Insights on Pandemic Prevention, and Response Efforts

“The Independent Panel for Pandemic Preparedness and Response, co-chaired by HE Ellen Johnson Sirleaf and RH Helen Clark, welcomes you to share your insights and expertise on the status of international and regional pandemic-related reform processes and initiatives, and how progress can be continued and accelerated in the months and years ahead.”

Learn more about this survey and submit by December 20 here.

Pandora Report 5.10.2024

This week’s Pandora Report covers a new interim staff report from the House Select Subcommittee on the Coronavirus Pandemic, the new United States Government Policy for Oversight of Dual Use Research of Concern and Pathogens with Enhanced Pandemic Potential, the OPCW’s statement on Russia’s alleged use of toxic chemicals as weapons in Ukraine, and more.

GMU Biodefense Students Visit National Museum of Health and Medicine

“Late last month a cadre of students from the Schar School of Policy and Government’s biodefense graduate program visited the National Museum of Health and Medicine in Silver Spring, Maryland, not far from the George Mason University campuses.”

“The 150-year-old museum is known for its collections that depict the human anatomy and everything that can befall it, in sometimes stark and gory detail. What else would you expect from a museum with a pathology guide with listings for “bilateral nephrolithiasis (kidney stones),” “liver, hydatid cyst from tape worm,” and an all-time-favorite, “trichobezoar (human hairball from stomach).”’

Read more about this visit here on the Schar School’s website.

GMU Biodefense students at the National Museum of Health and Medicine

Select Subcommittee on the Coronavirus Pandemic Interim Staff Report Calls for Daszak, EcoHealth Alliance Debarment

Earlier this month, the House Select Subcommittee on the Coronavirus Pandemic’s chairman, Rep. Brad Wenstrup (R-OH), released an interim staff report-“An Evaluation of the Evidence Surrounding EcoHealth Alliance, Inc.’s Research Activities”. The press release explains in part, “This report details the Select Subcommittee’s comprehensive investigation into the U.S. government’s funding and lack of oversight of gain-of-function research, EcoHealth Alliance (EcoHealth), and the Wuhan Institute of Virology (WIV). The report reveals serious, systemic weaknesses in the National Institute of Allergy and Infectious Diseases (NIAID) and National Institutes of Health’s (NIH) grant procedures and examines how these failures enabled EcoHealth President Dr. Peter Daszak to fund dangerous gain-of-function research in Wuhan, China without sufficient oversight.”

The select subcommittee’s recommendations include:

  • “The Select Subcommittee on the Coronavirus Pandemic recommends that EcoHealth Alliance and Dr. Peter Daszak are formally debarred and cut off from receiving any future U.S. taxpayer funding.”
  • “The Select Subcommittee also recommends that the U.S. Department of Justice conduct a formal investigation into Dr. Daszak.”
  • “Further, the Select Subcommittee recommends eight improvements to NIAID and NIH procedures that will improve grant compliance, increase biosafety and biosecurity of high-risk research, and advance transparency and accountability in America’s federal health agencies.”

Daszak testified before the select subcommittee on the day the report was released, which was covered by Matt Field in The Bulletin of the Atomic Scientists. Field explains in his coverage that Daszak was grilled by members of both major political parties during the subcommittee’s hearing on May 1, writing “On Wednesday, however, members of both US political parties came armed with blistering criticism for Peter Daszak, the head of the nonprofit EcoHealth Alliance, questioning his honesty in dealing with federal agencies and skewering his alleged conflicts of interests as he attempted to assume the role of a leading scientific voice on the pandemic’s origins. Beginning in 2014, EcoHealth ran a US-funded, multimillion-dollar project to identify hotspots where patterns of interaction between humans and animals could spark disease outbreaks.”

He later writes, “They hammered away on one of the plot points in the origins debate, EcoHealth’s transparency in reporting on its studies to the National Institutes of Health (NIH). Over the course of one five-year grant, EcoHealth was supposed to submit annual reports. One of those, covering 2018-2019, came two years late. Daszak claimed that EcoHealth had tried to submit the report, but the NIH had a problem with its computerized reporting platform. According to a report by the subcommittee’s Democrats, however, a forensic audit found no evidence for this assertion.”

Chairman Wenstrup said in a statement, ““EcoHealth Alliance President Dr. Peter Daszak is not a good steward of U.S. taxpayer dollars and should never again receive funding from the U.S. taxpayer. Dr. Daszak and his organization conducted dangerous gain-of-function research at the WIV, willfully violated the terms of a multi-million-dollar NIH grant, and placed U.S. national security at risk. This blatant contempt for the American people is reprehensible. It is imperative to establish higher standards of oversight at the NIH. The Select Subcommittee’s detailed and comprehensive report today holds Dr. Daszak and EcoHealth Alliance accountable and sheds light on severe shortcomings in our public health systems.”

US Agencies Set to Tighten Gain-of-Function Research Oversight

This White House announced this week the new United States Government Policy for Oversight of Dual Use Research of Concern and Pathogens with Enhanced Pandemic Potential and accompanying implementation guidance, following years of public debate and recommendations made by the National Science Advisory Board for Biosecurity. As the New York Times explains, “The new policy, which applies to research funded by the federal government, strengthens the government’s oversight by replacing a short list of dangerous pathogens with broad categories into which more pathogens might fall. The policy pays attention not only to human pathogens, but also those that could threaten crops and livestock. And it provides more details about the kinds of experiments that would draw the attention of government regulators.”

Read Max Kozlov’s summary and discussion of this new policy in Nature.

Emergent BioSolutions Announces Layoff Plans, Plant Closures

Emergent BioSolutions, the Gaithersburg-based company best known for producing Narcan, has announced it is shuttering its Maryland manufacturing facilities and laying off about 300 employees. This includes its Baltimore-Bayview Drug Substance manufacturing facility and its Rockville Drug Product facility, according to The Baltimore Banner. The company has also said it will eliminate 85 currently vacant positions. This is all on top of the more than 230 Maryland employees Emergent laid off last year.

Emergent drew national attention in the summer of 2021 after the company, which had secured a government contract to produce COVID-19 vaccines on behalf of Johnson & Johnson and AstraZeneca, came under Congressional scrutiny for potentially contaminating at least 75 million vaccine doses. Furthermore, as The New York Times highlighted at the time, “With its stock price cut in half, Emergent faces several shareholder lawsuits accusing it of securities fraud, and a pension fund filed a complaint last Tuesday claiming that some executives and board members — including several former federal officials — had engaged in insider trading by unloading more than $20 million worth of stock over the past 15 months.”

An investigation found that Emergent was forced to destroy or discard up to 400 million doses’ worth of ingredients for COVID-19 vaccines. ABC News explained in a piece about the report that “Congressional investigators probing the Maryland-based biotech company found that Emergent executives had privately raised urgent quality-control concerns even before the company began manufacturing the vaccines’ key ingredient — despite publicly expressing confidence in their ability to deliver on their multimillion-dollar government contract.”

‘”Despite major red flags at its vaccine manufacturing facility, Emergent’s executives swept these problems under the rug and continued to rake in taxpayer dollars,” House Oversight and Reform Committee Chairwoman Carolyn Maloney, D-N.Y., said of the report, which determined that the company’s “manufacturing failures and deceptive tactics” led to the large-scale waste of ingredients that could have helped make millions of vaccine doses.”

Emergent’s stock price did jump following the announcement of the layoffs, finishing yesterday at $4.37 up from $1.93 on May 1, a far cry from the $130 its shares were traded for in August 2020. According to The Baltimore Banner, “The company estimated that the restructuring will cost up to $21 million this year and save the company about $80 million annually. In a filing with the U.S. Securities and Exchange Commission, Emergent said most of those initial costs will be related to severance and benefits.”

OPCW Releases Statement on Ukraine

The OPCW released this week a statement about Russia’s alleged use of toxic chemicals as weapons in Ukraine. It reads in part “The Secretariat of the Organisation for the Prohibition of Chemical Weapons (OPCW) has been monitoring the situation on the territory of Ukraine since the start of the war in February 2022 in relation to allegations of use of toxic chemicals as weapons…The information provided to the Organisation so far by both sides, together with the information available to the Secretariat, is insufficiently substantiated.”

Read more here.

Mason Biodefense Graduate Program Director Discusses AI, Biological Weapons Risks with CNN

Biodefense Graduate Program Director Gregory Koblentz was recently interviewed in this May 5 CNN Newsroom segment covering AI and biological weapons proliferation risks. It was filmed ahead of the release of an episode of CNN’s “How It Really Happened” focused on the 2001 Amerithrax attacks.

“2024 U.S. Department of State Report on North Korea’s ‘Genetic Scissors’ Technology and Capabilities and Its National Security Implications”

This report from the Institute for National Security Strategy was co-authored by Biodefense PhD Program alumnus Hyun Jung Kim: “The recent U.S. State Department’s report, titled “2024 Adherence to and Compliance with Arms Control, Nonproliferation, and Disarmament Agreements and Commitments,” articulates that North Korea has acquired the capability to genetically engineer biological products utilizing CRISPR. This report raises alarms over the potential transformation of this genetic engineering technology into an offensive biological weapons program. CRISPR, often referred to as ‘genetic scissor’ technology, renowned for its ability to precisely cut and replace sections of the genome, holds promise for groundbreaking developments in medicine, agriculture, and energy sectors. However, this technology also faces several challenges, including ethical and institutional issues and safety concerns. The national security threats posed by the advancement of North Korea’s genetic engineering technology include unconventional warfare tactics such as terrorism and targeted assassinations, the potential leakage of genetically modified bioagents due to laboratory accidents, and the proliferation of weapons of mass destruction. Furthermore, the same report notes the development of ‘dual-use marine toxins’ by the Chinese People’s Liberation Army, which may imply possible strategic cooperation and coordination between China and North Korea in the development of biological toxins, posing a significant challenge to the international security landscape.”

“China, Biotechnology, and BGI: How China’s Hybrid Economy Skews Competition”

Anna Puglisi and Chryssa Rask recently published this issue brief with Georgetown’s Center for Security and Emerging Technology: “As the U.S. government considers banning genomics companies from China, it opens a broader question about how the United States and other market economies should deal with China’s “national champions.” This paper provides an overview of one such company—BGI—and how China’s industrial policy impacts technology development in China and around the world.”

“The National Blueprint for Biodefense: Immediate Action Needed to Defend Against Biological Threats”

This latest report from the Bipartisan Commission on Biodefense urges policymakers to adopt several measures to help sustain and grow US biodefense, including establishing a congressional working group focused on biodefense at the start of each Congress, making amendments to the Public Health Service Act in order to “produce a research and development plan for reducing pathogen transmission in built environments,” and replacing BioWatch.

In addition to the report linked above, Axios’ Alison Snyder has summarized the report and provided context to its recommendations here.

“Twenty Years of Preparedness: Reflecting on the Legacy of the Project BioShield Act of 2004”

Adey Pierce-Watkins and Tanima Sinha recently published this report for BDO: “This July 2, 2024, marks the 20th anniversary of The Project BioShield Act of 2004 (P.L. 108-276); legislation enacted in response to the anthrax attacks of September 2001, which revealed the need for development and acquisition of medical countermeasures (vaccines, therapeutics, and diagnostics) to protect the U.S. population from chemical, biological, radiological, and nuclear (CBRN) threats. This Act, and associated Congressional Appropriations, established a Special Reserve Fund (SRF) of $5.593B advanced funding available over a 10-year period for the advanced development and procurement of medical countermeasures with the intent of initiating a new posture of national preparedness.1 Simultaneously, this legislation created new market incentives for pharmaceutical and biotech companies to engage in the development of CBRN medical countermeasures and transformed the partnership between the federal government and industry into a shared responsibility for increasing preparedness against CBRN threats. As a result, this legislation and the SRF created a “guaranteed market” for pharmaceutical companies to produce CBRN medical countermeasures for which there previously was no commercial demand…In recognition of the 20th Anniversary of The Project BioShield Act, it is fitting to highlight the impact and milestones of this legislation based on its intended purpose and outcomes to date.”

“It Shouldn’t Be Easy to Buy Synthetic DNA Fragments to Recreate the 1918 Flu Virus”

Kevin M. Esvelt recently authored this piece for STAT News, writing in part “It should be hard — exceedingly hard — to obtain the synthetic DNA needed to recreate the virus that caused the deadly 1918 influenza pandemic without authorization. But my lab found that it’s surprisingly easy, even when ordering gene fragments from companies that check customers’ orders to detect hazardous sequences…Our experiment demonstrates that the immense potential benefits of biotechnology are profoundly vulnerable to misuse. A pandemic caused by a virus made from synthetic DNA — or even a lesser instance of synthetic bioterrorism — would not only generate a public health crisis but also trigger crippling restrictions on research.”

Applied Biosafety Special Issues on Biosafety and Biosecurity for Synthetic Genomics

Applied Biosafety‘s first and second special issues focused on biosafety and biosecurity for synthetic genomics is now available online. Articles include “Enhancing Gene Synthesis Security: An Updated Framework for Synthetic Nucleic Acid Screening and the Responsible Use of Synthetic Biological Materials,” “Developing a Common Global Baseline for Nucleic Acid Synthesis Screening,” Biosecurity Risk Assessment for the Use of Artificial Intelligence in Synthetic Biology,” “Biosecurity Assessments for Emerging Transdisciplinary Biotechnologies: Revisiting Biodefense in an Age of Synthetic Biology,” and more.

“Supporting Follow-Up Screening for Flagged Nucleic Acid Synthesis Orders”

Tessa Alexanian and Sella Nevo recently published this briefer with CSR’s Nolan Center, writing in part “Medical diagnostics, biomanufacturing, and many other parts of the bioeconomy rely on synthetic DNA and RNA purchases, which are ordered from commercial providers and shipped to laboratories around the globe. In addition to enabling beneficial biotechnology, affordable and accessible nucleic acid synthesis raises biosecurity concerns: some sequences can be used to reconstruct pathogen genomes or engineer dangerous biological agents, and it’s necessary to ensure those sequences are not misused by actors seeking to cause harm.”

“Most commercial synthesis providers screen the orders they receive to identify sequences of concern that could facilitate the construction of dangerous biological agents. When sequences in an order are flagged, follow-up screening determines whether the order is fulfilled. This screening centers on the customer: do they have a legitimate, peaceful purpose for obtaining the flagged sequences of concern?”

“This follow-up screening is the subject of this briefer. Between July and August 2023, we interviewed industry contacts and other policy and biosecurity experts. In the subsequent months, we conducted independent research and solicited expert feedback on report drafts. This process made clear that today, the follow-up screening process is ad-hoc. The customer service representatives, bioinformaticians, and security experts conducting follow-up screening often lack support for handling ambiguous cases, and there is little infrastructure to support information-sharing with other synthesis providers or law enforcement…”

“Developing a Customer Screening Framework for the Life Sciences”

A new report from Blueprint Biosecurity: “Since the 1970’s and the advent of recombinant DNA, biology has consistently become easier to engineer, and the pace of these advances is increasing. Many tools and capabilities for engineering biology are becoming more powerful, more affordable, and more widely available. These capabilities are critical for basic scientific research as well as advances in health, agriculture, and a wide range of applications in the burgeoning bioeconomy. However, access to these tools also raises the possibility that they could be accidentally or deliberately misused to cause harm by enabling development of toxins, pathogens, or other dangerous biological agents, including some not found in nature. Potential biological harms include high-consequence events such as the development and release of an engineered pathogen that causes a global catastrophe as well as a wide range of lower-consequence, higher-likelihood events. To prevent this type of misuse, policy experts have recommended expanding customer screening practices and policy frameworks to include a broad range of life sciences products, services, and infrastructure (Carter and DiEuliis, 2019a). Recent advances in artificial intelligence (AI) have increased this type of risk and have intensified these calls for action (Carter, et al., 2023; Helena, 2023).”

“To Combat Cow Flu Outbreak, Scientists Plan to Infect Cattle with Influenza in High-Security Labs”

Science’s Kai Kupferschmidt discusses current efforts to better understand H5N1 in this piece, writing in part “The avian influenza virus that has been infecting dairy cows and spreading alarm in the United States was expected to reach Germany this week. But that’s actually good news. A shipment of samples of the H5N1 virus from Cornell University virologist Diego Diel is destined for the Federal Research Institute for Animal Health in Riems, which has one of the rare high-security labs worldwide that are equipped to handle such dangerous pathogens in cattle and other large animals. There, veterinarian Martin Beer will use the samples to infect dairy cows, in search of a fuller picture of the threat the virus poses, to both cattle and people, than researchers have been able to glean from spotty data collected in the field.”

“Biodiversity Loss is Biggest Driver of Infectious Disease Outbreaks, Says Study”

This piece from The Guardian discusses the findings of a recent Nature meta-analysis: “New infectious diseases are on the rise and they often originate in wildlife. In meta-analysis published in the journal Nature, researchers found that of all the “global change drivers” that are destroying ecosystems, loss of species was the greatest in increasing the risk of outbreaks. Biodiversity loss was followed by climate change and introduction of non-native species.”

“Washington Accuses Russia of Chemical Weapons Attacks in Ukraine”

Andrea Stricker and Anthony Ruggiero recently authored this piece for the Foundation for Defense of Democracies that summarizes the United States’ claim that Russia has used CW in Ukraine, writing in part “The United States last week accused Russia of using chemical weapons against Ukrainian troops and sanctioned 12 Russian entities and individuals associated with Vladimir Putin’s ongoing chemical weapons program. The finding points to yet another instance of Moscow’s violation of international norms and conventions through the continued possession, stockpiling, and use of chemical weapons.”

“The Alleged Use of Chemical Weapons in Ukraine: How the International Community Can Investigate”

Ahmet Üzümcü recently authored this commentary piece for the European Leadership Network, explaining in part “I have summarised above the different mechanisms employed in the recent past to investigate allegations of the use of chemical weapons. I believe that one of them might be activated to investigate reported incidents in Ukraine. Whichever is selected may not enjoy the support of the whole membership; however, if one of the options is chosen, it needs to be practical and produce concrete results despite the challenges associated with the ongoing conflict. One of the strengths of the OPCW’s robust verification and compliance regime has always been its level of expertise and objectivity in the area of chemical weapons. The international community could leverage these strengths to test the veracity of the allegations that have been levelled against Russia about chemical weapons use during the armed conflict in Ukraine. The States Parties to the Chemical Weapons Convention should support such an initiative for two reasons: first, to provide a deterrent effect against further alleged uses of chemical weapons, and second, to uphold the integrity and credibility of the Chemical Weapons Convention, which is one of the pillars of the rules-based international order.”

ICYMI: Biological Weapons Convention Scientific and Technological Advisory Mechanism

From the UN Institute for Disarmament Research: “The Friends of the Chair, together with UNIDIR and @unitednations_disarmament, organized this informal webinar on a BWC scientific and technological advisory mechanism. This webinar was designed to support ongoing activities of the BWC Working Group and to stimulate thinking and discussion around a mechanism during the intersessional period. The event consisted of an expert panel followed by a moderated question-and-answer session with the audience.”

Watch here.

NEW-Slaves to the Bomb: The Role & Fate of N. Korea’s Nuclear Scientists

“The Committee for Human Rights in North Korea (HRNK) is delighted to invite you to the rollout of its latest report, Slaves to the Bomb: The Role & Fate of North Korea’s Nuclear Scientists by Robert Collins. The event will be open to the press and on the record. The report will be published on HRNK’s website on the day of the report rollout.”

This event will take place on May 17, at 3 pm EST. Learn more and RSVP here.

NEW-Getting Ahead of Avian Influenza: Why Organizations Need to Prepare Today

From Bluedot: “Highly Pathogenic Avian Influenza A(H5N1), commonly referred to as bird flu, has been making headlines around the world, as the virus rapidly spreads to new animal species. Already the cause of a panzootic (global animal pandemic), last month a human H5N1 case was reported in the U.S. after likely contracting it from infected dairy cattle. The virus has now been detected in dairy herds across multiple states, with evidence to suggest it has been spreading more widely than previously thought — begging the question: Are we at risk for an avian influenza-instigated pandemic?”

“Join us for a deep dive into avian influenza as we explore why and how organizations should prepare to safeguard against bird flu. Together, through collaborative efforts and informed decision-making, we can mitigate the risk of increased transmission to humans. BlueDot’s experts have been closely monitoring the situation and potential risks, issuing multiple alerts on H5N1 — and other avian influenzas — over the past 15 months.”

This event will take place on May 23, at 11 am ET. Learn more and register here.

Biosafety and the Origin of the COVID-19 Pandemic: Evidence and Policy Implications

From Brookings: “The world just lived through the COVID-19 pandemic, with more than 7 million reported direct deaths globally, more than 775 million reported cases, more than 14 million indirect excess deaths, and likely millions more unreported deaths. Despite the devastating effects on people and economies around the world, we still do not know with certainty how the pandemic originated, with the two most likely hypotheses either a natural spillover from an animal host or a research lab leak. Finding an answer to this question is not just a matter of doing justice to the millions of victims of COVID-19—it will have significant ramifications for policy implementation to help prevent the next pandemic.”

“Importantly, the catastrophic impact of the COVID-19 disease has shown us that preventing the next pandemic and biosafety in general should be top of mind for researchers, regulators, policymakers and public health officials, and it will likely require an array of measures by private, public, and nongovernmental organizations. This includes reconsidering our early warning systems for emergent diseases from the natural world, and taking a closer look at research with dangerous pathogens in biolabs. Identifying the origins of the recent pandemic can help target those efforts.”

“On May 14, the Brookings Center on Regulation and Markets will address these complex questions. First, Alina Chan, scientific advisor at the Broad Institute, and Alison Young, Curtis B. Hurley chair in public affairs reporting at the University of Missouri School of Journalism, will explain why the origin of the SARS-CoV-2 virus matters for public policy. Then, a balanced expert panel will debate the two most likely origins: natural spillover or a leak from a lab. A final panel of biosafety experts will discuss what measures would be best suited to improve biosafety and reduce the risks for research-related lab incidents as well as future pandemics. This event is a part of the CRM series on Reimagining Modern-day Markets and Regulations.”

This online event will take place on May 14 at 1:30 pm EDT. Learn more and access the event here.

Addressing the Challenges Posed by Chemical and Biological Weapons: Intensive Online Introductory Course for Students of Technical Disciplines

“SIPRI and the European Union Non-Proliferation and Disarmament Consortium (EUNPDC) invite graduate and postgraduate students of the technical or natural science disciplines to apply for an intensive online introductory course on chemical and biological weapons—their proliferation, the efforts to eliminate them, the various mechanisms used to control their spread—and endeavours underway to reduce the risk of chemical or biological agents in terrorist attacks. The course will take place online, during four half-days on 28–31 May 2024, 14:00 to 18:00 Central European Summer Time (CEST).”

“The course will cover the fundamentals of chemical and biological weapons as well as of missiles and other means of delivery; the history of chemical and biological warfare; the evolution of international norms against these weapons; the threats associated with potential terrorist uses of chemical and biological material; bioweapons and other related scientific advances; the current challenges posed by chemical weapons; arms control treaties; and mechanisms to curb the spread of dangerous substances, including export controls.”

“The course will also discuss the role of the EU institutions and industry to address the challenges mentioned above. The course will be instructed by renowned experts on non-proliferation, arms control, disarmament, export controls, verification and related subjects from SIPRI, other European research centres, think tanks and international organizations.”

Learn more and apply here.

Registration for GHS 2024 Now Open

Registration is now open for the Global Health Security 2024 conference in Sydney, Australia. This iteration will take place 18-21 June, 2024. The call for abstracts is also still open. “The mission of the Global Health Security conference is to provide a forum where leaders, researchers, policy-makers, and representatives from government, international organisations, civil society, and private industry from around the world can engage with each other, review the latest research and policy innovations, and agree solutions for making the world safer and healthier. To that end, our mission is to help foster a genuinely multidisciplinary community of practice that is committed to working collaboratively to enhance global health security and eliminate disease, irrespective of its origin or source.”

SBA.3 International Synthetic Biology, and Biosecurity Conference in Africa

“Join us for the SBA.3 International Synthetic Biology and Biosecurity Conference in Africa, a groundbreaking event that brings together experts, researchers, and enthusiasts in the field of synthetic biology. This in-person conference will take place at the Laico Regency Hotel from Wed, Jul 17, 2024 to Friday, Jul 19, 2024.”

“Get ready to dive into the exciting world of synthetic biology and explore its potential applications in Africa. From cutting-edge research to innovative solutions, this conference offers a unique opportunity to learn, network, and collaborate with like-minded individuals.”

“Discover the latest advancements, trends, and challenges in synthetic biology through engaging keynote speeches, interactive workshops, and thought-provoking panel discussions. Immerse yourself in a vibrant atmosphere where ideas flow freely and new connections are made.”

“Whether you’re a seasoned professional or just starting your journey in synthetic biology, this conference provides a platform to expand your knowledge, exchange ideas, and contribute to the growth of the field in Africa.”

“Don’t miss out on this extraordinary event that promises to shape the future of synthetic biology and biosecurity in Africa. Mark your calendars and join us at the SBA.3 International Synthetic Biology and Biosecurity Conference in Africa!”

Learn more and register here.

IBBIS Announces The Common Mechanism

The International Biosecurity and Biosafety Initiative for Science (IBBIS) recently launched The Common Mechanism, “An open-source, globally available tool for DNA synthesis screening.” The organization explains on its website that “The Common Mechanism helps providers of synthetic DNA and RNA to effectively screen orders to prevent synthesis technology from being exploited. We provide free, distributed, open-source, automated software for screening sequences of nucleic acids (including DNA and RNA) as well as resources to facilitate customer screening.”

Learn more and access the tool here.

Pandora Report 1.5.2024

Happy New Year! This week covers reports of over 450 chemical attacks by Russia since the invasion of Ukraine in 2022, the fifth anniversary of DHS’ CWMD Office, and several recent publications.

Ukraine Reports Hundreds of Chemical Attacks by Russia Since Start of Invasion

In late December, the Kyiv Post published an article explaining a post from Ukraine’s Armed Forces Support Forces Command, which “claims that Russian troops have conducted 465 chemical attacks in Ukraine since the initiation of the full-scale invasion, with over 80 such attacks in December 2023, including one grenade containing a new, unknown chemical agent…The command notes an escalating trend in the use of such weapons by Russian forces, highlighting eight chemical attacks on Dec. 19 alone.”

The article continues, explaining “The commonly used weapons include grenades like K-51, RGR, and Drofa-PM gas hand grenades dropped from unmanned aerial vehicles (UAVs). Additionally, improvised explosive devices equipped with irritant substances and artillery shelling containing chemically dangerous substances are being employed.”

“The report mentions that 28 cases involving dangerous chemicals were documented and forwarded for investigative actions as part of criminal proceedings by groups of radiation, chemical, and biological intelligence from the military units of the Support Forces Command, working in collaboration with the Security Service of Ukraine (SBU).”

In case you missed it: Last summer, the Royal United Services Institute published an article on this topic, exploring the reported limited use of riot control agents and broader deployment of CW by Russia could mean in this war. The piece offers insight into Russia’s potential ogic in using these kinds of weapons in Ukraine, making it helpful in understanding this latest reporting.

DHS Celebrates Five Years of the Countering Weapons of Mass Destruction Office

In late December, the Department of Homeland Security celebrated the fifth anniversary of the founding of the Countering WMD Office. In an email update from the Department, Assistant Secretary for the Countering Weapons of Mass Destruction Office, Mary Ellen Callahan, was quoted saying “The threat of weapons of mass destruction terrorism is real. Five years ago, in the face of a dynamic, evolving threat environment, legislators recognized that the U.S. needed a more holistic approach to countering chemical, biological, radiological, and nuclear threats to the Homeland…By authorizing CWMD, the legislators enabled us to enhance and coordinate the chemical, biological, radiological, and nuclear detection efforts of federal, state, local, tribal, and territorial governments to improve preparedness and response capabilities throughout the United States. We look forward to continuing this essential mission to protect the American people.”

The update further explained “Congress established the CWMD Office in 2018 to elevate, consolidate, and streamline DHS efforts to protect the Homeland from weapons of mass destruction (WMD) and chemical, biological, radiological, and nuclear (CBRN) threats. CWMD serves as the DHS nexus for WMD and CBRN coordination, which includes providing direct financial and operational support nationwide to government and industry partners for full-time biological detection, illicit nuclear material detection, training, and exercises. Additionally, as part of the President’s Executive Order on AI signed in October 2023, President Biden tasked CWMD with helping to evaluate and mitigate the potential for AI to be used to develop WMDs, such as through AI-enabled misuse of synthetic nucleic acids to create biological weapons. The President directed the CWMD Office to evaluate the potential for AI to lower the barriers to entry for developing WMD and to develop a framework to evaluate and stress test synthetic-nucleic acid screening, creating a standardized set of expectations for third parties that audit AI systems to prevent the risk of abuse and proliferation by malicious actors.”

Defense Dossier Issue 38: “Pandemic Preparedness and Biodefense”

The American Foreign Policy Council’s December Defense Dossier is focused on biodefense and pandemic preparedness, featuring an article-“Parsing the Great Gain of Function Debate”-co-authored by Biodefense PhD Program alumni Yong-bee Lim and Saskia Popescu. It also includes other articles like “China’s Evolving Thinking About Biotechnology,” and “Understanding the Cyberbiosecurity Threat.” Read here.

“Virology-the Path Forward”

Rasmusen et al. recently published this commentary article in the Journal of Virology. They write in their abstract, “In the United States (US), biosafety and biosecurity oversight of research on viruses is being reappraised. Safety in virology research is paramount and oversight frameworks should be reviewed periodically. Changes should be made with care, however, to avoid impeding science that is essential for rapidly reducing and responding to pandemic threats as well as addressing more common challenges caused by infectious diseases. Decades of research uniquely positioned the US to be able to respond to the COVID-19 crisis with astounding speed, delivering life-saving vaccines within a year of identifying the virus. We should embolden and empower this strength, which is a vital part of protecting the health, economy, and security of US citizens. Herein, we offer our perspectives on priorities for revised rules governing virology research in the US.”

“Interpreting the Biological Weapons Convention – What Are “Necessary Measures” Under Article IV of the Convention?”

Sally Longworth recently published this report with the Swedish Defence Research Agency. She explains in her summary, “Article IV of the Biological Weapons Convention 1972 (BWC) requires States Parties to implement national implementation measures to prohibit and prevent the development, production, stockpiling, retention, acquisition, transfer, and use of biological agents, toxins and weapons in violation of the Convention. No definition of “national implementation measures” is included in the treaty, but there has been over 50 years of State practice in implementing this obligation, which can provide guidance on how States Parties interpret the obligations under Article IV. The Final Declarations agreed by consensus by States Parties at the Convention Review Conferences held every five years are particularly useful tools in understanding what measures are required and what, if any, development there has been in interpreting Article IV. Using legal methods to interpret international treaties, this memo first analyses the obligations set out in Article IV and then considers the interpretative value of the Final Declarations in relation to the BWC. It goes on to highlight a number of measures identified by the States Parties considered necessary in the implementation of the obligations contained in Article IV and important developments in what must be covered.”

“Vision, Needs, and Proposed Actions for Data for the Bioeconomy Initiative”

The National Science and Technology Council recently released this report from the Interagency Working Group on Data for the Bioeconomy. Its executive summary explains in part, “To realize a thriving bioeconomy, the Data Initiative identifies strategic investments and opportunities to leverage and build upon existing resources. The goal is to create an interwoven data fabric that connects data with the infrastructure and computational resources necessary to analyze, synthesize, and use those data for the widest audience. This vision depends on creation and adoption of community-driven standards, both for data and for repositories to enable interoperability and integration; training and education to build the bioeconomy data workforce of tomorrow; efforts to limit and mitigate security risks; and ongoing coordination to ensure efforts keep pace with transformations in data science, computing, biotechnology and biomanufacturing. While additional data are needed, government coordination and investment in infrastructure are also needed to make best use of the existing and anticipated data.”

Furthermore, in identifies seven Core Action areas the Data Initiative indicates requires “consistent whole-of-government coordination and investments”:

  1. Dedicated long-term funding mechanisms for data and computational resources and infrastructure;
  2. Standards to establish common best practices that foster and strengthen a shared U.S. bioeconomy data ecosystem;
  3. Biodata Catalog to identify extant data and metadata;
  4. Security practices and policies that secure the data landscape while supporting innovation;
  5. Workforce to drive U.S. leadership in the bioeconomy of the future;
  6. Strategically Targeted Areas for Rapid Transformation (START) to determine viability and impact and chart a course for larger investments; and
  7. Coordination of intergovernmental investments, efforts, and resources.

“FACT SHEET: Biden-⁠Harris Administration Releases Global Health Security Partnerships Annual Progress Report Demonstrating Results from United States Investments”

The White House recently released this fact sheet along with the release of its Global Health Security Partnerships Annual Progress Report. The fact sheet explains in its introduction, “The Biden-Harris Administration continues to prioritize global health security as a critical component of national biodefense.  The COVID-19 pandemic, as well as HIV/AIDS, Ebola, mpox and other outbreaks in recent years, has demonstrated the catastrophic impacts infectious diseases can have on health, economies, and societies, regardless of where they start.  The United States partners with countries around the world to build stronger global health security capacity – the ability to prevent, detect, rapidly respond to, and recover from new and emerging public health threats and prevent their spread across borders. Partnering with countries to stop infectious disease threats at their source, including by strengthening equitable health systems in their own countries and across regions, effectively protects the health of Americans and people across the world.”

“Exploring Actions for Epidemic and Pandemic Preparedness”

The National Academies recently released this Proceedings of a Symposium-in Brief: “Investing in pandemic preparedness ahead of disease outbreaks can greatly reduce the toll of epidemics and pandemics when they occur. Although several tools exist for assessing pandemic preparedness at an epidemiological and operational level, less information and fewer approaches are available to guide the prioritization of preparedness investments at the country level. The National Academies of Sciences, Engineering, and Medicine held an international, virtual symposium series in May and June 2023 to explore possible strategies for evidence-based prioritization of global health capabilities to prepare for future epidemics and pandemics. Speakers and participants discussed assessment tools for national action planning; country and organizational decision-making about funding priorities; effective approaches for disease surveillance and risk communication; governance structures that support robust and reliable systems for global health investments; and specific actions for tools and resource prioritization for preventing and preparing for future epidemics and pandemics. This publication summarizes the presentation and discussions of the symposium.”

“America Should Be More Like Operation Warp Speed”

Gary Hamel and Michele Zanini recently published this Ideas piece in The Atlantic focused on how OWS offers lessons for the rest of the government in achieving goals. They write in their introduction, “The U.S. government can achieve great things quickly when it has to. In November 2020, the Food and Drug Administration granted emergency-use authorization to the Pfizer-BioNTech vaccine for COVID-19. Seven days later, a competing vaccine from Moderna was approved. The rollout to the public began a few weeks later. The desperate search for a vaccine had been orchestrated by Operation Warp Speed, an initiative announced by the Trump administration that May. Developing, testing, manufacturing, and deploying a new vaccine typically takes a decade or more. OWS, which accomplished the feat in months, belongs in the pantheon of U.S. innovation triumphs, along with the Manhattan Project and the Apollo moon-landing program. It’s a case study in how the U.S. government can solve complex, urgent problems, and it challenges the narrative that public institutions have lost their ability to dream big and move fast.”

“Why the World Needs Its Own Immune System”

Atul Gawande, USAID’s Assistant Administrator for Global Health, recently published this opinion piece in The New York Times. He writes in part, “This is now the pattern: one emergency after another, often overlapping, diverting focus away from longer-term public health goals. And there’s no sign of this letting up. Displacement and activities like deforestation have increased contact between humans and wildlife — and thus the incidence of animal diseases leaping to humans. (The Ebola virus, for example, has been linked to bats as a possible source of spread.) The risk of outbreak-causing laboratory accidents is a significant concern as labs proliferate and safety measures lag. On average, between 1979 and 2015, more than 80 laboratory-acquired infections were reported per year, several involving transmission beyond those initially infected, and underreporting is rife. The growing field of synthetic virology has simultaneously generated lifesaving new treatments (mRNA vaccines, for example) and made it easier for bad actors to turn infectious diseases into weapons of mass destruction.”

“But we can break the pattern. Longer-range investment in local preparedness for such events — in building what I think of as a global immune system — could reduce the threat these crises pose and even reduce dependence on foreign aid to weather them. As dangers rise, so can our capacity to get ahead of them. With the right strategy, we could use the mishaps, malefactors and shocks we face to strengthen our capacity to adapt. This is not about developing resilience (the ability to recover from crisis) or robustness (the ability to resist crisis). It is about developing what the writer Nassim Nicholas Taleb has called antifragility — the ability to become stronger from crisis.”

“The OPCW and Civil Society: Considerations on Relevant Themes and Issues”

Alexander Ghionis recently published this working paper for CBWNet. He explains in its executive summary, “This paper explores some key elements of the relationship between the Organisation for the Prohibition of Chemical Weapons (OPCW) and civil society, with the specific and limited aim of supporting ongoing discussions being held within the OPCW regarding options and mechanisms to enhance that relationship. The paper is designed to be practical, providing readers from State Parties, the Technical Secretariat, civil society, and other stakeholders, with some initial perspectives, ideas, and considerations that could inform discussions.”

The paper addresses “The composition and focus of accredited civil society organisations (CSOs); How CSOs have engaged with the OPCW so far and what alternative modes of engagement may be beneficial; and, What foundational aspects can strengthen the relationship between the OPCW and civil society moving forward.”

“The Altered Nuclear Order in the Wake of the Russia-Ukraine War”

Rebecca Davis Gibbons, Stephen Herzog, Wilfred Wan, and Doreen Horschig recently published this research paper with the American Academy of Arts & Sciences. They explain in their executive summary: “On February 24, 2022, Russia invaded nonnuclear-armed Ukraine and leveraged threats with its nuclear arsenal as a “shield” to deter third-party intervention. The well-publicized horrors on the ground in Ukraine are, unfortunately, not the only consequences of Russia’s full-scale invasion of its neighbor. The war is having unmistakable effects on how governments, scholars, and the public think about nuclear arms. Not only has Moscow reintroduced the world to the often-unsavory realities of nuclear deterrence, but its suspension of the New Strategic Arms Reduction Treaty (START) and deratification of the Comprehensive Nuclear-Test-Ban Treaty (CTBT) have been setbacks for arms control and disarmament. Meanwhile, vulnerable states around the globe may be further incentivized to develop nuclear weapons or seek protection from nuclear-armed patrons to avoid being invaded like Ukraine.”

“Given these changing geopolitical circumstances, how might the Russian war on Ukraine affect the global nuclear order? The authors in this publication conclude that the United States and the broader international community must now more seriously engage with alternatives to traditional arms control, nonproliferation, and disarmament endeavors. Specifically, the authors discuss the increasing prominence of approaches such as the Treaty on the Prohibition of Nuclear Weapons (TPNW)—popularly known as the Nuclear Ban—and risk reduction measures. They assess whether these initiatives can have an impact in reducing nuclear dangers. Additionally, they examine temptations for states to pursue more forceful counterproliferation measures and describe the risks of doing so.”

NEW: “When Medicine Stops Saving Us: The Antimicrobial Resistance Crisis”

“Interim Dean Abel Valenzuela and the UCLA Division of Social Sciences present an exclusive screening of a new documentary from the team behind the award winning NETFLIX documentary, RESISTANCE. This genre-bending short film, HOLOBIOME, features the harrowing story of UCLA graduate Bradley Burnam’s personal encounter with a deadly superbug. Through a variety of creative elements, HOLOBIOME examines the need for innovation in AMR and questions the overall human relationship with infectious disease and the microbial world. The screening will be followed by an interdisciplinary panel discussing the looming AMR crisis through the lenses of sociology, public policy, industry, and public health.”

This event will be moderated by Biodefense PhD Program alumna Jomana Musmar. It will take place on January 22, at 5 pm PST. Learn more and register here.

NEW: AI Executive Order Report Card Reviewing the First 90 Days

“On October 30, 2023, the Biden Administration issued a call to action outlining a host of requirements and deliverables for U.S. government agencies on artificial intelligence. The executive order touched on a range of AI-relevant issues, including testing and evaluation of new AI systems, developing a healthy and capable U.S. AI workforce, and ensuring U.S. competitiveness in the years to come.”

“Join CSET researchers on January 31, 2024, for a discussion of what the U.S. Government has accomplished so far, what have we learned, and what’s left to do to complete the EO’s ambitious goals.”

This online event will begin at 12 pm EST. Learn more and register here.

International Conference, CBRNE Research & Innovation

“The last 40 years have demonstrated that both military and civilian populations could be exposed to highly hazardous CBRNE agents following conflicts, natural outbreaks and disasters, industrial incidents or terrorist attacks.”

“Worldwide, researchers, responders and industrial capacities have been commited to provide adapted response to these challenges.”

“Building on the success of the first 5 International Conferences « CBRNE Research and Innovation » which took place in Antibes (2015), Lyon (2017), Nantes (2019), on line (2021) and Lille (2022), we want to give you a new opportunity to build up or strengthen collaborative networks in Strabourg (March 19th – 21rst 2024).”

“The CBRNE R&I Conference is specifically devoted to scientific updates, responders’ feedbacks and expression of needs. It also includes workshops and demonstrations of innovative materials, technologies and procedures, according to the following themes: DETECTION – IDENTIFICATION, PROTECTION – DECONTAMINATION, MEDICAL COUNTERMEASURES, RISKS & CRISIS MANAGEMENT.”

“Looking forward to your proposals for communication and to welcoming you at Strasbourg in March 2024!”

Learn more here.

Registration for GHS 2024 Now Open

Registration is now open for the Global Health Security 2024 conference in Sydney, Australia. This iteration will take place 18-21 June, 2024. The call for abstracts is also still open. “The mission of the Global Health Security conference is to provide a forum where leaders, researchers, policy-makers, and representatives from government, international organisations, civil society, and private industry from around the world can engage with each other, review the latest research and policy innovations, and agree solutions for making the world safer and healthier. To that end, our mission is to help foster a genuinely multidisciplinary community of practice that is committed to working collaboratively to enhance global health security and eliminate disease, irrespective of its origin or source.”

Vote: 2023 Arms Control Person(s) of the Year Nominees

“Since 2007, the independent, nongovernmental Arms Control Association has nominated individuals and institutions that have, in the previous 12 months, advanced effective arms control, nonproliferation, and disarmament solutions and raised awareness of the threats posed by mass casualty weapons.”

“In a field that is often focused on grave threats and negative developments, the Arms Control Person(s) of the Year contest aims to highlight several positive initiatives—some at the grassroots level, some on the international scale—designed to advance disarmament, nuclear security, and international peace, security, and justice.”

“Voting will take place between Dec. 8, 2023, and Jan. 11, 2024. The results will be announced on Jan. 12, 2024. Follow the discussion on social media using the hashtag #ACPOY2023.”

Learn about the nominees and vote here.

Pandora Report 12.15.2023

This week covers the FDA’s ongoing investigation into contaminated applesauce, the passing of Gao Yaojie-an activist responsible for bringing to light the extent of China’s AIDS epidemic-, and more.

Biodefense MS Graduates Riley Flynn and Sophie Hirshfield at GMU’s 2023 Winter Commencement Ceremony

FDA Leadership Says Tainted Applesauce Pouches May Have Been Intentionally Contaminated

Cinnamon applesauce pouches available Weis, WanaBanana, and Schnucks have been pulled from shelves after they were found to be contaminated with lead. Dozens of children in the United States have been sickened by the tainted products. Now, the FDA’s Deputy Commissioner for Human Foods, Jim Jones, says they may have been intentionally contaminated.

In an interview with Politico, Jones said “We’re still in the midst of our investigation. But so far all of the signals we’re getting lead to an intentional act on the part of someone in the supply chain and we’re trying to sort of figure that out.” All of the pouches in question were linked to a manufacturing facility in Ecuador that the FDA is currently inspecting.

‘“My instinct is they didn’t think this product was going to end up in a country with a robust regulatory process,” Jones said. “They thought it was going to end up in places that did not have the ability to detect something like this.”’

Politico further explained that “The FDA continues to investigate a number of theories for how the pouches became contaminated, and has not drawn any conclusions about the way the lead was added, why or by whom. The FDA says it currently believes the adulteration is “economically motivated.” That generally refers to ingredients being altered in order to make products appear higher in value, often so companies can produce a cheaper item and sell it at an elevated price.”

“The agency and the Centers for Disease Control and Prevention have collaborated with state and local health authorities as well as Ecuadorian authorities to trace the origin of the cinnamon in the applesauce pouches, which is believed to be the source of the lead contamination. More than 60 U.S. children under the age of 6 have tested positive for lead poisoning after consuming the pouches — some at levels more than 500 times the acceptable threshold for lead, according to The Washington Post.”

Gao Yaojie, Chinese Physician and Self-Exiled AIDS Activist, Dead at 95

Gao Yaojie, a gynecologist and well-known AIDS activist, died on December 10 in New York City. Gao, formerly based in China’s Henan province, was famous for her work to expose the outbreak of HIV/AIDS in the country in the 1990s and 2000s. The outbreak was large in scale and primarily driven by the country’s Plasma Economy, which arose because of restrictions on foreign imports of blood products in the 1990s. This resulted in blood plasma donation becoming a way for rural populations to make money in government-supported plasma donation centers. However, unsafe practices like repeated use of unsterilized needles and pooling multiple donors’ blood during the plasmapheresis allowed HIV to spread widely.

Because of the Chinese government’s efforts to suppress reporting on this epidemic, poor rural populations were left largely unaware of the dangers of plasma donation and the public in general was unaware of the severity of the crisis. Gao was one of the first to speak publicly about the outbreak, helping draw the attention of media outlets. She later told documentary filmmakers about her motivations for doing this, saying, “My driving thought is: how can I save more people from dying of this disease? We each only live one life.”

It is estimated that at least one million Chinese were infected with HIV during this epidemic, highlighting the importance of Gao’s and others’ bravery. For this, she garnered praise from the United Nations, several Western organizations, and even Hillary Clinton. This rising fame led to her being placed under house arrest in 2007, with about 50 police preventing her from traveling to the United States to accept an award recognizing her work. In response to this, she told NPR “I think they feel I got in the way of their political achievements and their official careers…Otherwise, why would they put me under house arrest? What law did I break to warrant mobilizing all these police?”

NPR further explained her activities later in life in their article on her passing, writing: “Despite pressure from Henan provincial authorities to stop publicizing the AIDS crisis, she continued her work, using all the proceeds from her books and pamphlets to support AIDS families, especially children orphaned by the disease or the many suicides that it caused.”

“Restrictions on her movement began hindering in work in China, however, and in 2009, she abruptly fled to the US, after fearing she would be put under house arrest again. Many admirers continued to visit her apartment in West Harlem, including a group of young Chinese students who kept her company in the loneliness of exile.”

‘”Many Chinese regarded her as a hero, and when they came to New York, if they didn’t know how to contact her , [sic] they would ask me. I would ask them for an email written in Chinese and would forward it to her. So far as I know, she always wrote back to those people and welcomed them to come visit,” remembers Andrew Nathan, a political science professor at Columbia University who handled much of Gao’s affairs in New York.”

“The Biological and Toxin Weapons Convention in 2023: Glimmers of Progress Set Against a Troubled Geopolitical Landscape”

Experts at CSR’s Nolan Center, including Biodefense PhD Program alumna and current faculty member Saskia Popescu, recently authored this blog post focused on the BWC’s potential for success in verification, universalization and effective implementation in Africa, and the creation of an International Agency for Biological Safety. They explain in their introduction: “For nearly two decades, efforts to strengthen the Biological and Toxin Weapons Convention (BWC) were in stasis, with opportunities missed and States Parties unable to agree to definite action. States Parties arrived at the Review Conference last year facing a growing biological weapons threat—augmented by rapidly converging complimentary technologies—coupled with a status quo in the BWC that was insufficient for the task. Yet nations drove a breakthrough: the consensus achieved at last year’s Review Conference proved that action is still possible despite the challenging international security environment.”

“In a world in which biological threats and vulnerabilities are exceedingly complex, there is a critical need to reinforce relationships among global experts, national governments, and civil society. Over the past two weeks, these stakeholders have met to identify, examine, and develop specific and effective measures to strengthen the Convention. An unwavering theme throughout the Meeting of States Parties underscored that preparedness and resilience are investments, rather than costs, reinforcing the deterrence by denial efforts CSR continues to promote. Although the challenging international security environment continues to hinder progress there are glimmers of genuine progress across several fronts…”

“Biosecurity in the Americas: Regional Threat Assessment”

A new from UMD’s START, co-authored by Biodefense MS Program alumna Alexandra Williams: “This publication, currently available in Spanish, provides a breadth and depth of focuses as a high-level assessment of the Central and South America regions and introduction to key topics as:

  1. The needed expansion of understanding of the differences and areas of collaboration between the concepts of biosafety and biosecurity,
  2. Existing international obligations to biosecurity through the BWC and UNSC Resolution 1540,
  3. How biosecurity applies to and may differ in application across a variety of facility types that engage in biological research or production, whether private or public laboratories, agricultural or university-based facilities,
  4. Biosecurity risks that include proliferation, bioterrorism, agroterrorism, and biocrime,
  5. The five pillars and mechanisms of biosecurity,
  6. Lastly, the application of biosecurity in the Central and South American regions.”

“NTI|Bio Convenes Workshop on Disincentivizing State Bioweapons Development and Use”

From NTI: “A week ahead of the Biological Weapons Convention (BWC) Working Group meetings in Geneva, Switzerland, NTI | bio convened a workshop on “Disincentivizing State Bioweapons Development and Use.” This two-day workshop on November 29 and 30 brought together academics, diplomats, biosecurity experts, and government policy makers to begin developing a cross-disciplinary thought and practice community to explore and develop potential disincentivizing solutions. Current thinking and policy on disincentivizing bioweapons acquisition and use is underdeveloped—especially by comparison with the nuclear security field.”

‘“We launched this effort because we see the need for more rigorous thinking on effective approaches to making bioweapons unattractive to nation-states,” said NTI | bio Vice President Jaime Yassif. “NTI’s goal is to bridge theory and practical policy-relevant approaches to develop new ideas that can invigorate international efforts to reduce biological threats.”’

Biodefense Graduate Program Director Gregory Koblentz and Associate Professor Sonia Ben Ouagrham-Gormley both participated in this workshop. Read more about it here.

“Great Powers and the Norms of the BW Prohibition Regime”

A new working paper from CBWNet: “The United States of America and the Soviet Union were instrumental in creating the biological weapons prohibition regime more than 50 years ago. This has left the regime with a big gap in its normative structure related to the verification of treaty compliance. The working paper by Alexander Kelle and Eva Siegmann analyses great power involvement in several areas of regime implementation and concludes that none of the great powers, including China, has supported the addition of declaration and inspection norms. While recent US and Chinese initiatives could still lead to a strengthening of the regime in different areas, Russian policies, most notably false accusations against the US and others, threaten to undermine the regime.”

“AI and Biorisk: An Explainer”

A new explainer from Georgetown’s CSET: “Recent government directives, international conferences, and media headlines reflect growing concern that artificial intelligence could exacerbate biological threats. When it comes to biorisk, AI tools are cited as enablers that lower information barriers, enhance novel biothreat design, or otherwise increase a malicious actor’s capabilities. In this explainer, CSET Biorisk Research Fellow Steph Batalis summarizes the state of the biorisk landscape with and without AI.”

“Bio X AI: Policy Recommendations For A New Frontier”

Jeffrey et al. discuss the work of the Federation of American Scientists’ Bio x AI Policy Development Sprint in this piece, explaining in their introduction: “Artificial intelligence (AI) is likely to yield tremendous advances in our basic understanding of biological systems, as well as significant benefits for health, agriculture, and the broader bioeconomy. However, AI tools, if misused or developed irresponsibly, can also pose risks to biosecurity. The landscape of biosecurity risks related to AI is complex and rapidly changing, and understanding the range of issues requires diverse perspectives and expertise. To better understand and address these challenges, FAS initiated the Bio x AI Policy Development Sprint to solicit creative recommendations from subject matter experts in the life sciences, biosecurity, and governance of emerging technologies. Through a competitive selection process, FAS identified six promising ideas and, over the course of seven weeks, worked closely with the authors to develop them into the recommendations included here. These recommendations cover a diverse range of topics to match the diversity of challenges that AI poses in the life sciences. We believe that these will help inform policy development on these topics, including the work of the National Security Commission on Emerging Biotechnologies.”

“Push to Improve Biosecurity in the Age of Genetic Engineering”

Wilmot James recently authored this opinion piece for Business Day, explaining in part “The possibility of using AI to develop bioweapons raises additional concerns, and remains uncharted territory. While the intersection of AI and biotechnology holds immense potential for positive applications in healthcare, research and diagnostics, it also poses risks if misused. AI algorithms could be employed to analyse vast genetic data sets and identify specific sequences for manipulation. This could accelerate the process of genetic engineering, allowing for the creation of more efficient and potentially harmful pathogens…To safeguard against such threats, multilateral and public-private sector agreements and regulations to govern the ethical use of AI in science, emphasising the prohibition of bioweapon development, should be established, with strong oversight committees responsible for assessing the ethical implications at the intersection of AI and biotechnology. These committees should include experts in AI, virology, bioethics and global health security.”

“Sounding the Alarm on Anti-Science”

Margaret Winchester provides background and overview of Peter Hotez’s latest book-The Deadly Rise of Anti-Science-in this piece for Health Affairs: “In his book, The Deadly Rise of Anti-Science, Hotez, professor and dean of the National School of Tropical Medicine at Baylor College of Medicine, and co-director of the Center for Vaccine Development at Texas Children’s Hospital, paints a bleak picture of public science denial during the pandemic, embedded in historic context. He tells the story of systematic anti-science efforts from his view in the trenches—and as a personal target for anti-science activists. This book, and his commentary in our December issue of Health Affairs on global lessons from COVID-19, highlight the very real effects of this movement, including lives lost, undermined public health efforts, foregone vaccinations, social schisms, and more, that will be felt for generations to come. As he writes, “anti-science now kills more Americans than global terrorism, or other deadly societal forces and social determinants.” Drawing from multiple sources, he estimates that approximately 200,000 people needlessly died in the US after COVID-19 vaccines became widely available.”

EU vs Disinfo Disinformation Review

The most recent edition of EU vs Disinfo’s Disinformation Review is now available and features multiple sections focused on Russia’s continued use of alleged US biological weapons laboratories as a bogeyman. Be sure to check it out for fantastic lines such as “If the only tool that you have is a hammer, everything looks like a biolab,” and “At a staged event, Putin mumbled out an announcement to veterans and the wider public that his regime would continue to rule over Russia after an orchestrated ritual not to be confused with an event known as an ‘election’ in the free world.”

2023 State of the Bioeconomy

From BIOISAC: “We have a lot to celebrate as we close 2023 and just over 12 months since the Executive Order calling for a safe, secure bioeconomy. Join us as we recap the activity, publications, outcomes, and – we will of course share a glimpse of the “behind the scenes” conversations from our 3 regional events and our one-day “Closing the Knowledge Gaps” event, our two-day table top training and the resulting “Going Viral: Bioeconomy Defense TTX” report, and, of course, the industry-demanded outputs from our hardware/software device security workgroup report and supplements, “Fortifying the Bioeconomy” as well as the Bioeconomy Security Questionnaire and Instrument Disposal Guide. We also have a lot left to do! We plan to share a few of our goals for 2024 and our upcoming regional events schedule.”

“Join us December 19th at 2pm Eastern-US for a live discussion.” Register here.

Presidential Advisory Council on Combating Antibiotic-Resistant Bacteria (PACCARB) Virtual Meeting

“The Presidential Advisory Council on Combating Antibiotic-Resistant Bacteria (PACCARB) provides advice, information, and recommendations to the U.S. Secretary of Health and Human Services (HHS Secretary). The council supports and evaluates U.S. government activities focused on fighting antimicrobial resistance (AMR) in human health, animal health, and environmental health. Using this One Health approach, members of the PACCARB have expertise from a range of backgrounds, including academia, industry, public health, advocacy, veterinary, and agricultural production.”

“The PACCARB was established under Executive Order 13676 and included in the Pandemic and All-Hazards Preparedness and Advancing Innovation Act of 2019 (PAHPAIA). Since 2019, the President has given authority to the HHS Secretary as the primary recipient of PACCARB recommendations. Additional information on the authority and activities of the PACCARB can be found on the About Us page in the charter.”

“As a federal advisory committee, the PACCARB looks to engage with the public and all AMR stakeholders. The council holds several public meetings every year both in-person and live streamed on the HHS.gov website. These meetings are open to anyone with an interest in combating AMR. See how to get involved!”

This virtual meeting will take place on December 20 from 9-4 EST. Learn more here.

61st ISODARCO Course: Nuclear Order and International Security after Ukraine

“The war in Ukraine has had an enormous impact on global security, reviving nuclear fears, undermining the prospects for arms control, and shattering many of the norms and constraints that were the foundation of European security.  ISODARCO 2024 will examine the global nuclear order in light of the Ukraine war, focusing on the states, the policies and the technologies that will shape the future in a much more difficult environment.  How will we cope with this more dangerous world?”

This course will take place January 7-14, 2024, at the University of Trento. Learn more and register here.

International Conference, CBRNE Research & Innovation

“The last 40 years have demonstrated that both military and civilian populations could be exposed to highly hazardous CBRNE agents following conflicts, natural outbreaks and disasters, industrial incidents or terrorist attacks.”

“Worldwide, researchers, responders and industrial capacities have been commited to provide adapted response to these challenges.”

“Building on the success of the first 5 International Conferences « CBRNE Research and Innovation » which took place in Antibes (2015), Lyon (2017), Nantes (2019), on line (2021) and Lille (2022), we want to give you a new opportunity to build up or strengthen collaborative networks in Strabourg (March 19th – 21rst 2024).”

“The CBRNE R&I Conference is specifically devoted to scientific updates, responders’ feedbacks and expression of needs. It also includes workshops and demonstrations of innovative materials, technologies and procedures, according to the following themes: DETECTION – IDENTIFICATION, PROTECTION – DECONTAMINATION, MEDICAL COUNTERMEASURES, RISKS & CRISIS MANAGEMENT.”

“Looking forward to your proposals for communication and to welcoming you at Strasbourg in March 2024!”

Learn more here.

Registration for GHS 2024 Now Open

Registration is now open for the Global Health Security 2024 conference in Sydney, Australia. This iteration will take place 18-21 June, 2024. The call for abstracts is also still open. “The mission of the Global Health Security conference is to provide a forum where leaders, researchers, policy-makers, and representatives from government, international organisations, civil society, and private industry from around the world can engage with each other, review the latest research and policy innovations, and agree solutions for making the world safer and healthier. To that end, our mission is to help foster a genuinely multidisciplinary community of practice that is committed to working collaboratively to enhance global health security and eliminate disease, irrespective of its origin or source.”

WHO Announces Proposed Members of Technical Advisory Group on Response Use of the Life Sciences and Dual-Use Research

The WHO recently announced its proposed membership of its Technical Advisory Group on Responsible use of the life sciences and dual-use research (TAG-RULS DUR). According to WHO, “As per WHO processes, there will be now a two-week public consultation period for WHO to receive feedback on the proposed TAG-RULS DUR members and set in place the modalities for the TAG-RULS DUR’s first meeting, which is planned to take place following this consultation period…The final membership to the TAG-RULS DUR is subject to the above-mentioned public consultation period and relevant WHO practices and procedures.”

The proposed membership and instructions for providing commentary on the individuals included are both available here.

Vote: 2023 Arms Control Person(s) of the Year Nominees

“Since 2007, the independent, nongovernmental Arms Control Association has nominated individuals and institutions that have, in the previous 12 months, advanced effective arms control, nonproliferation, and disarmament solutions and raised awareness of the threats posed by mass casualty weapons.”

“In a field that is often focused on grave threats and negative developments, the Arms Control Person(s) of the Year contest aims to highlight several positive initiatives—some at the grassroots level, some on the international scale—designed to advance disarmament, nuclear security, and international peace, security, and justice.”

“Voting will take place between Dec. 8, 2023, and Jan. 11, 2024. The results will be announced on Jan. 12, 2024. Follow the discussion on social media using the hashtag #ACPOY2023.”

Learn about the nominees and vote here.

Pandora Report 12.08.2023

This week includes coverage of updates to Japan’s End User List, the Taliban’s newly declared war on polio, Biomemory’s $1k DNA storage cards, new publications, upcoming events, and more.

Japan Revises End User List, Includes 101 Chinese Organizations and Institutions

Japan’s Ministry of Economy, Trade, and Industry has revised the country’s End User List, which provides “…exporters with information on foreign entities for which concern cannot be eliminated regarding involvement in activities such as the development of weapons of mass destruction (WMDs) and other items, for the purpose of enhancing the effectiveness of the catch-all control on cargos and other loads relating to WMDs and other items.”

The updated list, which takes effect on Monday, now includes 706 organizations in 15 countries and regions, according to Nikkei. This is an increase of 36 over last year’s list and, notably, it includes the China Academy of Engineering Physics (CAEP)-the main center for Chinese research on and manufacturing of nuclear weapons. Seven total Chinese entities were added to the list, about 90% of which are thought to be involved in missile development. Nikkei notes that “Many universities, academies and research institutes are also listed, which reveals the extent of Xi Jinping’s Military-Civilian Fusion policy. Machine tools produced by Japanese companies and others are suspected of being used by the CAEP, according to a Nikkei investigation.”

223 Iranian organizations and institutions are on the list, in addition to 153 North Korean ones, and 101 each from China and Pakistan. Nikkei further explains that “Japan aims to prevent the outflow of civilian technology that could be diverted to military use. Exporters are required to get approval from the Minister of Economy, Trade and Industry to export products to the listed organizations unless it is clear that the materials will not be used to develop WMDs such as nuclear weapons or missiles.”

“The economy ministry makes the list to enhance the effectiveness of its “catch-all” control system, which obliges exporters to apply for an export license for goods that may be used for the development of WMDs even if the goods are not subject to export restrictions under international agreements. The list has been issued since catch-all controls were introduced in April 2002 and is revised about once a year. It is not an embargo list.”

Taliban Announces Polio Eradication Campaign

Naturally acquired polio remains endemic in just two countries today- Afghanistan and Pakistan- in part because, as Radio Azadi explains, “Islamic militants often target polio-vaccination teams, falsely claiming the vaccination campaigns are a Western conspiracy to sterilize children.” During its 20-year struggle to regain power, the Taliban often banned door-to-door vaccination efforts. In 2021, nationwide door-to-door polio vaccinations were allowed to resume after the Taliban and the United Nations/World Health Organization reached an agreement.

Now, as explained by a recent article in The Washington Post, the Taliban is “declaring war” on polio in an apparent complete reversal of its previous stance. The article explains “Vaccinators in the country’s northeast, the center of the poliovirus outbreak, search cars for unvaccinated children at roadside checkpoints manned by Taliban soldiers. With no deadly attacks on public health campaigners reported in Afghanistan this year, they also feel increasingly comfortable venturing into remote virus hot spots that were previously far beyond their reach.”

The country’s health ministry announced the continuation of its annual polio vaccination campaign in March of this year, marking the second year the program has continued to operate under the Taliban’s rule. The ministry indicated it aimed to reach approximately 9 million children with the campaign, as Afghanistan and neighboring Pakistan continue to struggle with endemic polio due in large part to accessibility difficulties, displacement, regional instability, and concerns about external interference. Pakistan suspended its anti-polio drive in multiple districts this year after police escorting vaccination teams were repeatedly attacked.

French Start-Up Announces Sales of DNA Storage Cards, BIO-ISAC Joins DNA Data Storage Alliance Amid Growing Interest, Concerns

Multiple news outlets have covered the French start-up Biomemory‘s release of $1,000 pairs of DNA cards that promise a “minimum” 150-year lifespan of data storage. The Verge’s Emma Roth explains “DNA has emerged as a theoretical alternative to hard drives, SSDs, and other forms of digital data storage, namely because of its impressive lifespan. Science estimates the technology could potentially last hundreds of thousands of years if stored in a cool, dry environment. That’s a heck of a lot longer than the lifespan of your average hard drive, which typically tops out at around five years.”

However, Biomemory’s cards currently offer just one kilobyte of storage, or about one email according to Wired. The data stored on the card is retrieved by mailing the cards to Eurofins Genomics, who then return the stored information using strings of DNA’s nucleotide bases-adenine (A), cytosine (C), guanine (G) and thymine (T). Users can then use Biomemory’s DNA translation feature to decode the stored information. The card is not returned afterward. The company expects to begin shipping orders from its waitlist in January.

‘”The launch of our DNA Cards represents a significant milestone in the evolution of data storage technology,” Erfane Arwani, CEO of Biomemory, said about the pioneering development. “After years of talk about the potential of molecular computing, we are incredibly proud to bring the first DNA data storage product to market, that not only pushes the boundaries of innovation but also aligns with our commitment to environmental sustainability and efficiency.”‘

This news has coincided with the announcement that the Bioeconomy Information Sharing and Analysis Center, an international organization that aims to address threats unique to the bioeconomy, has joined the DNA Data Storage Alliance. The organization explained in a statement: “This year BIO-ISAC created the Genomic Data Workgroup, informing the National Cybersecurity Center of Excellence at National Institute of Standards and Technology efforts to launch the Cybersecurity Framework Profile for Genomic Data and the forthcoming text on the Privacy Framework Profile for Genomic Data. Prioritizing workgroup efforts to apply and implement this work, BIO-ISAC pursued membership and presentation opportunities with aligned organizations and audiences.”

“Today, BIO-ISAC joins more than 40 members of the DNA Data Storage Alliance, in hopes of creating a future with safe, secure data storage systems and processes for genetic data at all stages of its lifecycle.”

“Founded in 2020, the DNA Data Storage Alliance was built to create and promote an interoperable storage ecosystem based on DNA as a data storage medium. The organization seeks to educate the public and raise awareness about this emerging technology and its vast power to preserve our digital legacy. As the methods of commercially viable DNA storage become better understood, the Alliance will consider recommending the creation of specifications and standards (e.g., encoding, reliability, retention, file systems) which enable end-users to add interoperable DNA-based storage solutions to their existing storage hierarchies.”

On a more fun note, Biomemory’s homepage does include a DNA Translate feature at the bottom which shows users how lines of text may be converted to strings of As, Cs, Gs, and Ts, so we tested it out: AGAGAGACAGTCTCACAGTCAGAGACTCACACAGAGACACAGTCACAGAGTCTGTCAGTCAGACAGTCTGTGAGTGACTCAGTCACAGACTCACACAGAGACTCAGTCAGAGAGTGACACAGTCTGTGAGTGACTCAGTGAGACACTCACACAGTCTCAGAGTGACTGACTCACACAGTGAGACAGTCTCACAGTCAGAGACTCACACAGTCACTCAGTCAGAGAGTGACTGAGTGAGACACTCACACAGTCTGTCAGTCAGAGAGTGCCGAAGTGACTGAGTCTGACAGTCAGAGAGTGAGACAGTGAGACAGTCAGAGAGTGACTCCCGAACAG

The page lacks a feature allowing users to translate their string of nucleotide bases back to regular text, so take our word for it: The Pandora Report is the best newsletter!

WHO Weekly Epidemiological Record One Health-Focused Issue

“The Weekly Epidemiological Record (WER) serves as an essential instrument for the rapid and accurate dissemination of epidemiological information on cases and outbreaks of diseases under the International Health Regulations and on other communicable diseases of public health importance, including emerging or re-emerging infections.”

The most recent issue is focused on One Health and includes pieces on incorporating One Health into the international political agenda, the Collaboration on One Health between WHO, FAO, WOAH, and UNEP, and more.

“Henry Kissinger Supported Wars and Coups. He Also Played a Little-Known Role in Eliminating Bioweapons”

Matt Field recently authored this piece about the late Henry Kissinger in The Bulletin of the Atomic Scientists, writing in part: “By the late 1960s, incidents with chemical weapons—including an accident with VX nerve agent in Utah that killed some 6,000 sheep—had focused Congress’s attention on the US chemical and biological warfare operation. Internationally, there were efforts to begin arms control negotiations around these weapons of mass destruction. And Kissinger led internal government deliberations over what to do with the US program. At one point, according to Tucker and Mahan, Kissinger, unhappy with a policy paper that contained both arguments in favor and against retaining biological weapons, produced his own paper that cut the points in favor of the offensive program. He included his personal recommendation to restrict the US program to biological defense, which involves the development of countermeasures such as vaccines.”

“Insights from BARDA Industry Day 2023”

Tanima Sinha, Director of Life Science Product Development and Government Contracts at the Biomedical Advanced Research and Development Authority (BARDA), recently authored this post covering BARDA Industry Day 2023 and upcoming insights from the conference that will be made available. She explains in part, “Here we will take a quick glimpse at ASPR (Administration for Strategic Preparedness and Response) and BARDA’s programs to enhance the nation’s biomedical industrial base and supply chain capacity. The COVID-19 pandemic brought to light the inadequate availability of essential medical needs. In response to these deficiencies, the USG/ HHS (Health and Human Services) (Health and Human Services) is expanding the public health industrial base through innovative solutions.”

Fortifying the Bioeconomy

From BIO-ISAC: “Standardizing tools for assessing, remediating, and disposing of hardware and software instruments has been a recurring problem in our sector, reducing our ability to operate in a safe, secure way. Earlier this year, BIO-ISAC took action to address this need.”
“Fortifying the Bioeconomy, an in-depth resource about shared responsibility in hardware and software lifecycle management, is now available. This resource includes additional materials including a standardized vendor questionnaire and  an instrument disposal guide.”

“We hope these materials guide industry and offer us a safe, secure path forward for our nation’s labs, biomanufacturers, growers, and innovators.”

Access here.

“Country Reports on Terrorism 2022”

“Country Reports on Terrorism 2022 is submitted in compliance with Title 22 of the United States Code, Section 2656f (the “Act”), which requires the Department of State to provide to Congress a full and complete annual report on terrorism for those countries and groups meeting the criteria of the Act.”

This report includes “Chapter 3 — The Global Challenge of Chemical, Biological, Radiological, or Nuclear Terrorism,” explaining the status of CBRN materials and expertise as terrorist threats and the United States’ efforts to counter them in 2022.

“New Information Tool on Nuclear Weapons Seeks to Identify the Next Arms Control Strategies”

Andrew Facini recently authored this piece for The Bulletin of the Atomic Scientists discussing the Council on Strategic Risks’ recently-launched Nuclear Weapons System Project. He explains, “For those of us seeking to cultivate nuclear policies geared toward enhancing strategic stability, the current trend reflects a worrying loss of perspective—a forgetting of the hard-earned lessons of the Cold War. To help put today’s trends in their historical context, a team of the Council on Strategic Risks (CSR) developed a new visualization tool and information system that maps every type of nuclear weapon fielded by the five nuclear weapons states (P5) under the Nuclear Non-Proliferation Treaty (NPT)—China, France, Russia, the United Kingdom, and the United States—from their inception to present day.”

What We’re Listening To 🎧

Technologically Speaking Podcast Ep. 6, Science is Messy

New from the Department of Homeland Security: “Host John Verrico sits down with Dr. Nick Bergman, director of S&T’s National Biodefense Analysis and Countermeasures Center (NBACC). Dr. Bergman is a bit of a germaphobe, but it’s hard not to be when you run a Biosecurity Level 4 lab that studies pathogens for which no vaccine or treatment exists. Hear an insider’s perspective of the COVID pandemic, find out how NBACC regularly helps the FBI, and meet a guy living a “pretty typical life” of helping save us all from superbugs.”

Listen here.

What We’re Watching🍿

Biosecurity

New from the Dutch Ministry of Health, Welfare and Sport: “This film provides an introduction into eight pillars of good practice for biosecurity, that are important when implementing biosecurity control measures.”

“These control measures are necessary to protect high-risk biological materials against theft or misuse by malicious parties.”

“The biosecurity aspects in these eight pillars of good practice are explained, which can help you to implement biosecurity within your organisation. This film is focussed on organisations that work with high risk biological materials.”

The short film is available in Dutch, English, and English with Russian subtitles.

Mitigating Arboviral Threats and Strengthening Public Health Preparedness

“Arboviruses are a broad group of viruses that are spread by arthropods, such as ticks and mosquitoes. Diseases caused by arboviruses, like dengue, chikungunya, Zika, and yellow fever, present a significant public health burden and threaten billions of people worldwide. Despite the global recognition of the devastating health and economic impacts of these diseases, the need persists for improved integration of mitigation efforts into public health systems and environmental and urban planning.”

“The National Academies Forum on Microbial Threats will conduct a two-day workshop that will identify lessons learned from previous outbreaks, outline current arbovirus surveillance capacities, and describe novel approaches to arbovirus mitigation. The workshop will include perspectives from researchers, public health practitioners, and environmental management experts from across the globe.”

This event will take place on December 12 and 13. Learn more here.

Presidential Advisory Council on Combating Antibiotic-Resistant Bacteria (PACCARB) Virtual Meeting

“The Presidential Advisory Council on Combating Antibiotic-Resistant Bacteria (PACCARB) provides advice, information, and recommendations to the U.S. Secretary of Health and Human Services (HHS Secretary). The council supports and evaluates U.S. government activities focused on fighting antimicrobial resistance (AMR) in human health, animal health, and environmental health. Using this One Health approach, members of the PACCARB have expertise from a range of backgrounds, including academia, industry, public health, advocacy, veterinary, and agricultural production.”

“The PACCARB was established under Executive Order 13676 and included in the Pandemic and All-Hazards Preparedness and Advancing Innovation Act of 2019 (PAHPAIA). Since 2019, the President has given authority to the HHS Secretary as the primary recipient of PACCARB recommendations. Additional information on the authority and activities of the PACCARB can be found on the About Us page in the charter.”

“As a federal advisory committee, the PACCARB looks to engage with the public and all AMR stakeholders. The council holds several public meetings every year both in-person and live streamed on the HHS.gov website. These meetings are open to anyone with an interest in combating AMR. See how to get involved!”

This virtual meeting will take place on December 20 from 9-4 EST. Learn more here.

61st ISODARCO Course: Nuclear Order and International Security after Ukraine

“The war in Ukraine has had an enormous impact on global security, reviving nuclear fears, undermining the prospects for arms control, and shattering many of the norms and constraints that were the foundation of European security.  ISODARCO 2024 will examine the global nuclear order in light of the Ukraine war, focusing on the states, the policies and the technologies that will shape the future in a much more difficult environment.  How will we cope with this more dangerous world?”

This course will take place January 7-14, 2024, at the University of Trento. Learn more and register here.

International Conference, CBRNE Research & Innovation

“The last 40 years have demonstrated that both military and civilian populations could be exposed to highly hazardous CBRNE agents following conflicts, natural outbreaks and disasters, industrial incidents or terrorist attacks.”

“Worldwide, researchers, responders and industrial capacities have been commited to provide adapted response to these challenges.”

“Building on the success of the first 5 International Conferences « CBRNE Research and Innovation » which took place in Antibes (2015), Lyon (2017), Nantes (2019), on line (2021) and Lille (2022), we want to give you a new opportunity to build up or strengthen collaborative networks in Strabourg (March 19th – 21rst 2024).”

“The CBRNE R&I Conference is specifically devoted to scientific updates, responders’ feedbacks and expression of needs. It also includes workshops and demonstrations of innovative materials, technologies and procedures, according to the following themes: DETECTION – IDENTIFICATION, PROTECTION – DECONTAMINATION, MEDICAL COUNTERMEASURES, RISKS & CRISIS MANAGEMENT.”

“Looking forward to your proposals for communication and to welcoming you at Strasbourg in March 2024!”

Learn more here.

Registration for GHS 2024 Now Open

Registration is now open for the Global Health Security 2024 conference in Sydney, Australia. This iteration will take place 18-21 June, 2024. The call for abstracts is also still open. “The mission of the Global Health Security conference is to provide a forum where leaders, researchers, policy-makers, and representatives from government, international organisations, civil society, and private industry from around the world can engage with each other, review the latest research and policy innovations, and agree solutions for making the world safer and healthier. To that end, our mission is to help foster a genuinely multidisciplinary community of practice that is committed to working collaboratively to enhance global health security and eliminate disease, irrespective of its origin or source.”

“Biodefense Budget Breakdown: Data Visualization of U.S. Biodefense Investments”

New from Council on Strategic Risks: “In recent years, U.S. strategies and policies have advanced greatly in addressing biological risks from all sources. We at CSR have marked several areas of progress through writings and analysis: the beginning of a pivot toward pathogen-agnostic approaches, requiring annual exercises on biological risks, and the creation of the Biodefense Council within the Department of Defense, and more…In September, CSR launched a scorecard process to track signs of implementation of stronger U.S. biodefense and biosecurity policies. CSR’s Biodefense Budget Breakdown will accompany the scorecard, tracking trends in resources and investments.”

“Before the launch of this tool, no publicly-accessible resource provided a detailed analysis of the total budget across the federal biodefense enterprise. By creating the Biodefense Budget Breakdown, we hope to provide a robust and user-friendly resource for the government, key stakeholders, and the general public.”

“This tool is intended to provide focused analyses of the biodefense budget, with multiple interfaces to understand and analyze the federal biodefense portfolio. This tool starts with the cumulative U.S. biodefense totals for each fiscal year dating back to 2019, progresses to agency-specific drill-downs, and culminates with a detailed line item index for biodefense budgets across key agencies. This tool reports biodefense investments across three steps in the budget cycle: requested (R), enacted (E), and actual (A) levels of funding.”

Call for Applications: Ecological Security Fellowship

“The Council on Strategic Risks is pleased to announce a call for applications for its Ecological Security Fellowship, a key part of its broader Ecological Security Program.”

“Tackling complex, converging risks arising from ecological degradation requires the development of resilient leaders spanning international, national, state, and local levels. This program will familiarize participants with novel ways of conceptualizing the security risks posed by ecological disruption driven by human activities, climate change, and other stressors. Participants will acquire expertise and build professional development through networking with experts and practitioners in different areas of ecological security.”

Learn more and apply here.

Pandora Report 12.01.2023

This week covers a wide range of topics, including chemical weapons, indictments for those involved in running the illegal laboratory in Reedley, CA, and more. Several new publications follow, as well new upcoming events and newly-available resources in the announcement section.

George Mason University’s Biomedical Laboratory Receives $12 Million in Funding from NIH

From GMU: “Farhang Alem, Interim Director of the Biomedical Research Laboratory, Institute for Biohealth Innovation, and Aarthi Narayanan, Professor, Biology, will receive more than $12 million from the National Institute for Health to support development of Mason’s Biomedical Research Laboratory, advancing the university’s research capabilities for infectious diseases.”

“George Mason University’s Biomedical Laboratory (BRL) is one of 12 Regional Biocontainment Laboratories (RBLs) established through the National Institute of Allergy and Infectious Diseases. The BRL offers Biosafety Level 3 (BSL-3) facilities that conduct cutting edge pathogen research and serve as resources to rapidly address emerging infectious disease outbreaks.”

“Funding will support a number of facility improvements including the implementation of a comprehensive BSL-3 facilities preventative maintenance and upgrade plan to ensure continuity of operations, compliance with federal regulations, and a safe and secure facility. Funding will also enhance safety and quality of BSL-3 laboratory practices and create two new research cores in high containment.”

Read more here.

DOD Chemical and Biological Defense Program Celebrates 30th Anniversary

The Department of Defense recently reached the 30-year anniversary of the formation of its Chemical and Biological Defense Program. “Congress created the DOD wide chemical and biological defense program in November 1993, after a government report noted U.S. forces were not sufficiently prepared to address Iraq’s chemical and biological warfare capabilities…Prior to the creation of the program under the Office of the Secretary of Defense, the military services were each responsible for developing their own chemical and biological defense capabilities.” 

Read more about the program here.

OPCW Adopts Measures Aimed at Ensuring Compliance with CW Ban in Syria and Elsewhere

The OPCW announced the adoption of new measures aimed at addressing non-compliance with the CWC yesterday, the Day of Remembrance for all Victims of Chemical Warfare. In a statement, the OPCW explained: “The Twenty-Eighth Session of the Conference of the States Parties to the Chemical Weapons Convention (CWC) today adopted a decision titled “Addressing the Threat from Chemical Weapons Use and the Threat of Future Use”, brought forward by 48 countries.”

“The Conference decided that the continued possession and use of chemical weapons by the Syrian Arab Republic, and its failures to submit an accurate and complete declaration and to destroy all its undeclared chemical weapons and production facilities, have caused serious damage to the object and purpose of the Chemical Weapons Convention.”

“In adopting the decision, States Parties condemned “in the strongest possible terms the use of chemical weapons by anyone, under any circumstances, emphasising that any use of chemical weapons anywhere, at any time, by anyone, and under any circumstances is unacceptable and contravenes international norms and standards”. States Parties reaffirmed their determination to continue to take action to address threats related to chemical weapons in Syria and elsewhere.”

“Today’s decision seeks to implement for the first time Paragraph 3 of Article XII of the Convention, which refers to measures States Parties can take in order to ensure compliance.”

Read more here.

Syrian Network for Human Rights Statement On the Day of Remembrance For All Victims of Chemical Warfare

The Syrian Network for Human Rights released its statement yesterday on the Day of Remembrance for all Victims of Chemical Warfare, highlighting CW attacks perpetrated by the Assad regime and the ongoing struggle for victims to hold the regime accountable. The statement is available below.

2023 OPCW-The Hague Award Recipients Announced

OPCW Director-General Amb. Fernando Arias and the Mayor of the Municipality of The Hague, Mr. Jan van Zanen, announced last week the three recipients of the 2023 OPCW-The Hague Award. These recipients are the Spiez Laboratory in Switzerland, Dr. Syeda Sultana Razia at the Bangladesh University of Engineering and Technology, and Mr. Hubert K. Foy at the African Centre for Science and International Security in Ghana.

‘“All three of these recipients have demonstrated that everyone has a role to play in ridding the world of chemical weapons and preventing their re-emergence,” said OPCW Director-General, Ambassador Fernando Arias. “We must together strive to continue to ensure that toxic chemicals are never used as instruments of harm and that our populations are protected.”’

Read more about the recipients and their work here.

NTI, NextGen, iGEM, SynBio Africa, GHSN, and 80,000 Hours Announce Winners of 7th Annual Next Generation for Biosecurity Competition

The winners of the Seventh Annual Next Generation for Biosecurity Competition were recently announced. They are Gupreet Dhaliwal, Ph.D. candidate in Synthetic Biology and Immunology at the University of Cambridge, Askar Kleefeldt, Ph.D. candidate in Synthetic Biology at the MRC Laboratory of Molecular Biology and the University of Cambridge, and Alexandra Klein, Ph.D. candidate in Science, Technology, Engineering and Public Policy at the University College London and research assistant at the Centre for the Study of Existential Risk, University of Cambridge.

“In their winning paper, Biosecurity-By-Design to Safeguard Emerging Bioeconomies: Integrating Biosecurity Considerations into the Full Biotechnology Innovation and Development Pipeline, the team proposes a ‘biosecurity-by-design’ approach to ensure that biosecurity is integrated into every stage of the life science research and development pipeline, especially project conceptualization. The three authors outline a set of recommendations to achieve this goal, including fostering a culture of responsibility among scientific communities through the adoption of the Tianjin Biosecurity Guidelines for Codes of Conduct for Scientists as a global standard in emerging bioeconomies. The authors emphasize the importance of engaging with the private sector and encourage governments to incentivize biosecurity in product design by using levers such as market access regulations or reputational rewards through seals of approval. The authors also propose that States Parties at the Biological Weapons Convention adopt a systematic review mechanism for science and technology to raise awareness of emerging biotechnology risks. Overall, these recommendations aim to make biosecurity an integral part of biotechnology innovation while allowing the bioeconomy to flourish.”

Read more here.

No Cost COVID-19 Tests Available in United States Again

The US Government is once more offering four at-home viral tests delivered via the US Postal Service. Those who did not order any in September can order up to eight of them during this round. Order tests at COVIDtests.gov.

ICYMI: Select Committee on the CCP Releases Report on Reedley Lab, DOJ Announces Indictment of Operator

Last month “Chairman Mike Gallagher (R-WI) of the House Select Committee on the Chinese Communist Party unveiled a report on its investigation into the illegal People’s Republic of China-tied biolab discovered in Reedley, CA. The members were joined by Rep. Jim Costa (D-CA), whose district includes Reedley, CA, Former Speaker Kevin McCarthy (R-CA), Rep. Dan Newhouse (R-WA), and Rep. Neal Dunn (R-FL).”

According to the report, the Committee’s main findings were:

  • “The illegal biolab was run by a PRC citizen who is a wanted fugitive from Canada with a $330 million Canadian dollar judgment against him for stealing American intellectual property.
  • This PRC citizen was a top official at a PRC-state-controlled company and had links to military-civil fusion entities.
  • The illegal biolab received millions of dollars in unexplained payments from PRC banks while running the illegal biolab.
  • The illegal biolab contained thousands of samples of labeled, unlabeled, and encoded potential pathogens, including HIV, malaria, tuberculosis, and Covid.
  • The illegal biolab also contained a freezer labeled “Ebola,” which contained unlabeled, sealed silver bags consistent with how the lab stored high risk biological materials. Ebola is a Select Agent with a lethality rate between 25-90%.
  • The biolab contained nearly a thousand transgenic mice, genetically engineered to mimic the human immune system. Lab workers said that the mice were designed “to catch and carry the COVID-19 virus.”
  • After local officials who discovered the lab sought help from the CDC and others, the CDC refused to test any of the samples.” 

Meanwhile, the Department of Justice announced a three-count indictment against operators of the lab, saying in a press statement “A federal grand jury returned a three-count indictment today against Jia Bei Zhu, aka Jesse Zhu, Qiang He, and David He, 62, a citizen of China who formerly resided in Clovis, charging him with distributing adulterated and misbranded medical devices in violation of the federal Food, Drug, and Cosmetic Act and for making false statements to the Food and Drug Administration (FDA), U.S. Attorney Phillip A. Talbert announced.”

“According to court documents, between January 2020 and March 2023, through the companies Universal Meditech Incorporated (UMI) and Prestige Biotech Incorporated (PBI), Zhu sold hundreds of thousands of COVID-19 test kits to companies throughout the United States. UMI and PBI were based in Fresno and Reedley and did not obtain pre-market approval, pre-market clearance, emergency use authorization, or other applicable exemption from the FDA as was required. UMI and PBI received millions of dollars for the sales of the test kits.”

“When questioned by FDA officials, Zhu made several false statements to them, including that (1) his name was Qiang “David” He, (2) he was hired by UMI as a COVID-19 consultant in 2021, (3) he was hired by PBI just a couple of weeks prior to meeting with the FDA to communicate with government agencies on PBI’s behalf, and (4) he did not know anything about the manufacturing or distribution histories for UMI or PBI.”

“This case is the product of an investigation by the FDA Office of Criminal Investigations with assistance from the Federal Bureau of Investigation and the California Department of Public Health – Food and Drug Branch. Assistant U.S. Attorneys Joseph D. Barton, Arelis M. Clemente, and Henry Z. Carbajal III are prosecuting this case.”

“Why AI-Assisted Bioterrorism Became a Top Concern for Open AI and Anthropic”

Louise Matsakis covers the now constant concern about the potential for AI to aid in bioterrorism, explaining in her introduction “In the spring of 1995, U.S. lawmakers were becoming concerned that material uploaded to the nascent internet might pose a threat to national security. The Oklahoma City bombing had happened several weeks earlier, drawing attention to publications circulating online like The Big Book of Mischief, which included instructions on how to build homemade explosives.”

“Worried the information could be used to orchestrate another attack, then-Senator Dianne Feinstein pushed to make publishing bomb recipes on the internet illegal. The effort sparked a national debate about “Open Access vs. Censorship,” as one newspaper headline put it at the time.”

“Nearly 30 years later, a similar debate is now unfolding about artificial intelligence. Rather than DIY explosives, some U.S. officials and leading AI companies say they are increasingly worried that large language models could be used to develop biological weapons. The possibility has been repeatedly cited as one reason to be cautious about making AI systems open source.”

Matsakis interviewed George Mason’s Sonia Ben Ouagrham-Gormley as well in writing this piece, writing ‘“With new technologies, we tend to project in the future as though their development was linear and straightforward, and we never take into consideration the challenges and the contingencies of the people using them,” said Sonia Ben Ouagrham-Gormley, an associate professor at George Mason University who has interviewed former scientists in both the U.S. and Soviet Union’s now-defunct biological weapons programs.”

And later: “Ben Ouagrham-Gormley said her research has shown that achieving each of these steps requires employing different, highly-trained experts, including people who specialize in the exact type of pathogen being used. An AI model might be able to replace some of their work in the future, but she argued it can’t replicate the hands-on wisdom that comes from working in a laboratory.”

‘“This kind of tacit knowledge exists everywhere, but in the bio field, it’s really important because of the fragility of the raw material,” Ben Ouagrham-Gormley said.”

“Artificial Intelligence and Synthetic Biology Are Not Harbingers of Doom”

David Bray provides an optimistic outlook on the potential of AI and synthetic biology in this policy memo for the Stimson Center. Bray writes, “Contrary to many people’s fears, artificial intelligence (AI) can be a positive force in advancing biological research and biotechnology. The assumption that AI will super-empower the risks that already exist for the misuse of biotech to develop and spread pathogens and fuel bioterrorism misses three key points. First, the data must be out there for either an AI or a human to use it. Second, governments stop bad actors from using bio for nefarious purposes by focusing on the actors’ precursor behaviors. Third, given how wrong large language models (LLMs) often are and their risk of hallucinations, any would-be AI intended to provide advice on biotech will have to be checked by a human expert. In contrast, AI can be a positive force in advancing biological research and biotechnology — and insights from biology can power the next wave of AI for the benefit of humankind. Private and public-sector leaders need to make near-term decisions and actions to lay the foundation for maximizing the benefits of AI and biotech. National and international attention should focus on both new, collective approaches to data curation and ensuring the right training approaches for AI models of biological systems.”

“Going Viral: Bioeconomy Defense”

This report from Johns Hopkins’ Applied Physics Lab summarizes the findings of a May tabletop exercise:

“The May tabletop exercise at APL revealed four key areas of action to ensure a safe and secure bioeconomy.

Trust in lab equipment performance and data is foundational to the bioeconomy. Recommendations include developing digital security standards for lab equipment, hardening waypoints at each step in the data life cycle, and introducing a system of tiered levels of compliance.

Awareness of vulnerabilities, cyber and physical, and the steps for prevention and intervention are needed. Recommendations include additional exercises to strengthen intra-agency coordination and training and extending this activity to private sector companies.

Responsibility for responding to threats in the bioeconomy, and the roles for each team member, need to be defined with a process workflow, using a shared responsibility model, and teams need regular training opportunities to practice.

Preparedness is lacking, and threat-mitigation strategies specific to the bioeconomy need to be identified, tested and distributed. The exercise pushed the limits of participants’ traditional threat-mitigation strategies and identified the need for assessments of critical infrastructure and functions, cross-domain training, and the establishment of policies and procedures for an inter-agency group to rapidly respond to threats.”

“Security Considerations At the Intersection of Engineering Biology and Artificial Intelligence”

New from the Engineering Biology Research Consortium: “This white paper describes three areas at the intersection of engineering biology and artificial intelligence that may yield significant security concerns: de novo biological design, closed-loop autonomous laboratories, and natural language Large Language Models. It describes each area, identifies potential security concerns, and offers ideas for the potential mitigation of those concerns, ultimately calling for an international forum to continually address this evolving issue.”

“Pascale Ferrier and the Threat of Bioterror”

Markus K. Binder recently published this piece in NCT’s CBNW: “Drawing upon the START CBRN Data Suite and other research, Markus Binder considers the five ricin bio-attacks directed at the U.S. President and other officials that have taken place since 2013 to assess what, if anything, they can tell us about bioterrorism.”

“Americans’ Trust in Scientists, Positive Views of Science Continue to Decline”

New work from the Pew Research Center has found that “…the share of Americans who say science has had a mostly positive effect on society has fallen and there’s been a continued decline in public trust in scientists.”

“Overall, 57% of Americans say science has had a mostly positive effect on society. This share is down 8 percentage points since November 2021 and down 16 points since before the start of the coronavirus outbreak.”

“About a third (34%) now say the impact of science on society has been equally positive as negative. A small share (8%) think science has had a mostly negative impact on society.”

Read the report here.

“A Systematic Review Of COVID-19 Misinformation Interventions: Lessons Learned”

Smith et al. recently published this article with Health Affairs: “Governments, public health authorities, and social media platforms have employed various measures to counter misinformation that emerged during the COVID-19 pandemic. The effectiveness of those misinformation interventions is poorly understood. We analyzed fifty papers published between January 1, 2020, and February 24, 2023, to understand which interventions, if any, were helpful in mitigating COVID-19 misinformation. We found evidence supporting accuracy prompts, debunks, media literacy tips, warning labels, and overlays in mitigating either the spread of or belief in COVID-19 misinformation. However, by mapping the different characteristics of each study, we found levels of variation that weaken the current evidence base. For example, only 18 percent of studies included public health–related measures, such as intent to vaccinate, and the misinformation that interventions were tested against ranged considerably from conspiracy theories (vaccines include microchips) to unproven claims (gargling with saltwater prevents COVID-19). To more clearly discern the impact of various interventions and make evidence actionable for public health, the field urgently needs to include more public health experts in intervention design and to develop a health misinformation typology; agreed-upon outcome measures; and more global, more longitudinal, more video-based, and more platform-diverse studies.”

“Coffee As a Dietary Strategy to Prevent SARS-CoV-2 Infection”

Wu et al.‘s recent article in Cell & Bioscience offers further validation for coffee drinkers (as if we needed it): “Background: To date, most countries lifted the restriction requirement and coexisted with SARS-CoV-2. Thus, dietary behavior for preventing SARS-CoV-2 infection becomes an interesting issue on a daily basis. Coffee consumption is connected with reduced COVID-19 risk and correlated to COVID-19 severity. However, the mechanisms of coffee for the reduction of COVID-19 risk are still unclear.”

“Results: Here, we identified that coffee can inhibit multiple variants of the SARS-CoV-2 infection by restraining the binding of the SARS-CoV-2 spike protein to human angiotensin-converting enzyme 2 (ACE2), and reducing transmembrane serine protease 2 (TMPRSS2) and cathepsin L (CTSL) activity. Then, we used the method of “Here” (HRMS-exploring-recombination-examining) and found that isochlorogenic acid A, B, and C of coffee ingredients showed their potential to inhibit SARS-CoV-2 infection (inhibitory efficiency 43–54%). In addition, decaffeinated coffee still preserves inhibitory activity against SARS-CoV-2. Finally, in a human trial of 64 subjects, we identified that coffee consumption (approximately 1–2 cups/day) is sufficient to inhibit infection of multiple variants of SARS-CoV-2 entry, suggesting coffee could be a dietary strategy to prevent SARS-CoV2 infection.”

“Conclusions: This study verified moderate coffee consumption, including decaffeination, can provide a new guideline for the prevention of SARS-CoV-2. Based on the results, we also suggest a coffee-drinking plan for people to prevent infection in the post-COVID-19 era.”

“WHO: ‘Collective Action’ Needed to Effectively Reduce Antimicrobial Resistance”

CIDRAP’s Chris Dall covers WHO officials’ answers to questions about AMR in this piece written in recognition of World AMR Awareness Week. Dall explains “Encouraging the medical community, world leaders, and other stakeholders to do their part in staving off that grim future is one of the goals of World AMR Awareness Week, a global campaign of the World Health Organization (WHO) this week aimed at raising public awareness and promoting practices that help mitigate the threat posed by drug-resistant infections…CIDRAP News recently submitted a series of questions to WHO officials about the themes of this year’s World AMR Awareness Week, their assessment of the progress that countries have made in addressing AMR, and the challenges that lay ahead. Responses were provided by Sarah Sheppard, the WHO’s communications lead for Medicines, Health Products & AMR.”

“The World’s Chemical-Weapons Stockpiles Are Gone – But a New Challenge Looms”

Peter J. Hotchkiss, science policy adviser to the OPCW’s Scientific Advisory Board, recently published this World View piece with Nature. He explains in part, “In 2019, the OPCW’s 193 member states decided unanimously, for the first time in history, to add compounds to the schedules, the lists of chemicals that are regulated under the convention. The four entries comprise toxic nerve agents with no known civilian use: three cover phosphorus-based agents (in the ‘novichok family’), and the fourth is a family of carbamates, another kind of nerve agent. The convention already prohibited using these (or any chemical) to intentionally kill or harm people through toxicity. Now, their production, transfer and storage are subject to stringent verification by the OPCW, through declarations and on-site inspections.”

“Yet some states have been reticent to share data on these chemicals with the OPCW. The lack of information on the newly scheduled chemicals is in jarring contrast to what we have on other weapons listed in the convention and on their precursors. To ensure the health and safety of staff members during inspections, the OPCW needs the best understanding of these chemicals’ properties, the types of personal protective equipment and medical countermeasures that are effective against them and the analytical methods for detecting them. These data would also help us to provide the best information and training to all member states, ensuring that they are prepared in the event that any of these chemicals are used as a weapon.”

“29 Morally Bankrupt Governments, Headed by Russia, Voted Against the OPCW’s Resolutions”

The Syrian Network for Human Rights recently released this report “…emphasizing that many states worldwide must bring cases against the Syrian regime before the International Criminal Court (ICC) over the regime’s repeated violations of the Chemical Weapons Convention (CWC).”

“In the 15-page report, SNHR notes that the Syrian regime has carried out 184 chemical attacks since ratifying the Convention in September 2013. The report outlines the decisions adopted by the Organization for the Prohibition of Chemical Weapons (OPCW), identifying the states that voted against those decisions, or in other words the states that support the continuation of the Syrian regime’s chemical weapons program. Through this action, it notes, these states are, in effect, encouraging the regime to use weapons of mass destruction – chemical weapons – and emboldening it to carry out more chemical weapons attacks against the Syrian people.”

“Scientific Experts Provide Key Recommendations on Biotoxin Analysis to the OPCW”

“The Scientific Advisory Board (SAB) of the Organisation for the Prohibition of Chemical Weapons (OPCW) endorsed a report outlining key recommendations on biotoxin analysis and investigations of their alleged use as weapons submitted by a SAB Temporary Working Group (TWG) earlier this year.”

“Biotoxins are toxic chemicals produced by living organisms, which vary widely in properties such as structure, size, and mechanisms of toxicity. Some biotoxins can  be more toxic than traditional nerve agents. There are two biotoxins subject to stringent verification measures under the Chemical Weapons Convention – ricin and saxitoxin – with many others also posing safety and security concerns.” 

“The risk of misuse of biotoxins as weapons requires the OPCW to be prepared to conduct various investigations and missions related to their alleged use. To ensure the Organisation’s readiness to do so, the TWG’s report makes critical recommendations to the OPCW…”

Read more here.

“2023 Catalogue of Civil Society Activities Supporting the Chemical Weapons Convention”

The Stimson Center recently released its 2023 Catalogue of Civil Society Activities Supporting the Chemical Weapons Convention, “a catalogue of civil society capacity-building, assistance, and/or research programs supporting the Chemical Weapons Convention (CWC). The catalogue highlights all interested parties, including the CWC States Parties, the Organisation for the Prohibition of Chemical Weapons (OPCW), the Global Partnership Against the Spread of Weapons and Materials of Mass Destruction, international organizations, and industry stakeholders, civil society’s contributions to strengthen reducing the threat of chemical weapons and promoting the peaceful use of chemistry. By providing a uniform product, interested parties will be able to easily identify programs, experts, and organizations that support the CWC and related chemical weapons nonproliferation instruments.”

“Emerging and Re-Emerging Chemical Threats (Part 2)”

MRIGlobal continues their discussion of CW threats with “Chemical Threats on the Battlefield and Home Front” in this blog post, explaining in part “Today’s conflicts around the world highlight the current and pressing need for continued research to help ensure the safety of anyone in danger. And though we touched on “Emerging and Re-emerging Chemical Threats” earlier in the year, because emerging and re-emerging chemical threats pose an ever-present challenge to both warfighters and civilians, we are revisiting the topic to share additional expertise. To learn more, we visited with Cristina Youngren and Evan Durnal, subject matter experts in MRIGlobal’s Integrated Defense Solutions division.”

“What Does a French Arrest Warrant Mean for Normalization With Assad?”

Julia Neumann discusses what France’s arrest warrants for Bashar al-Assad and several associates mean in practice and for regional normalization in this piece for Syria Direct.

“Why Cheap Drones Pose a Significant Chemical Terrorism Threat”

Zachary Kallenborn recently published this piece with The Bulletin of the Atomic Scientists, writing in part “Relatively cheap drones are becoming a mainstay of conflicts, from the war in Ukraine to the Israel-Hamas conflict in Gaza. Though drones were once the purview of rich and powerful militaries, it’s now possible to use cheap consumer drones in battle. With a few tweaks, they can whistle past even sophisticated air defenses. As Al-Bared’s case highlights, they may also present a significant chemical terrorism threat. Drones can be equipped with sprayers to deliver chemical weapons, or they could be used in an attack on a chemical plant. They could also provide critical attack support, helping with reconnaissance to plan out and conduct an attack, monitor law enforcement response, and create propaganda to highlight terrorist activities.”

“Stanford Emerging Technology Review: Reporting on Key Technology Areas and Their Policy Implications”

“Emerging technologies are transforming societies, economies, and geopolitics. This moment brings unparalleled promise and novel risks. In every era, technological advances buoy nations that develop and scale them—helping to save lives, win wars, foster greater prosperity, and advance the human condition. At the same time, history is filled with examples where slow-moving governments stifled innovation in ways policymakers never intended, and nefarious actors used technological advances in ways that inventors never imagined. Technology is a tool. It is not inherently good or bad. But its use can amplify human talent or degrade it, uplift societies or repress them, solve vexing challenges or exacerbate them. These effects are sometimes deliberate but often accidental.”

“The stakes of technological developments today are especially high. Artificial intelligence (AI) is already revolutionizing industries, from music to medicine to the military, and its impact has been likened to the invention of electricity. Yet AI is just one among many technologies that are ushering in profound change. Fields like synthetic biology, materials science, and neuroscience hold potential to vastly improve health care, environmental sustainability, economic growth, and more. We have experienced moments of major technological change before. But we have never experienced the convergence of so many technologies with the potential to change so much, so fast.”

“The Stanford Emerging Technology Review (SETR) is the first product of a major new Stanford technology education initiative for policymakers. Our goal is to help both the public and private sectors better understand the technologies poised to transform our world so that the United States can seize opportunities, mitigate risks, and ensure that the American innovation ecosystem continues to thrive.”

ICYMI: FBI Director Statement Before the House Committee on Homeland Security

FBI Director Christopher Wray delivered this statement to the House Committee on Homeland Security last month, highlighting the work of his agency across several mission areas, including emerging technologies and counter WMD. Wray explained in part of this statement that, “In addition to fighting terrorism, countering the proliferation of weapons-of-mass-destruction materials, technologies, and expertise, preventing their use by any actor, and securing nuclear and radioactive materials of concern are also top national security priority missions for the FBI. The FBI considers preventing, mitigating, investigating, and responding to weapons of mass destruction (“WMD”) terrorism a “no-fail” mission because a WMD attack could result in substantial injuries, illness, or loss of lives, while yielding significant social, economic, political, and other national security consequences. In collaboration with federal, state, local, tribal, territorial, and other partners, the FBI integrates complementary efforts to counter WMD terrorism. An example of this collaboration is the FBI-led Weapons of Mass Destruction Strategic Group. This interagency crisis action team spans more than 15 departments and agencies to coordinate the federal government’s response to WMD threats and incidents. Alongside the FBI, the Department of Homeland Security maintains the largest footprint on the strategic group.”

Read the full statement here.

NEW: Looking Ahead in Ukraine: What Could Increase the Risk of Escalation?

“As U.S. lawmakers debate the question of continued defense and humanitarian aid to Ukraine, the Ukrainian fight to expel Russian invaders continues with no end in sight. The stalemate on the front lines in Ukraine masks continued intense fighting and demands for resources on both sides that may drive longer-term changes—on the battlefield, inside Russia, and beyond. This could lead to further escalation, including the potential to turn the conflict into a wider war. Understanding which circumstances and policies may risk escalation in Ukraine is paramount: not only are decisions about supporting Ukraine critical to the long-term trajectory of the conflict but also the United States confronts a broad set of challenges across the globe.”

“Please join RAND’s National Security Research Division on Tuesday, December 5, 2023, 9:30 – 11:00 am ET, for a moderated panel discussion about which circumstances or policies may risk escalation in Ukraine—either deliberate or inadvertent—and the potential triggers and restraining factors likely to shape Russian escalation decisions in particular.”

“Missy Ryan, a national security reporter at the Washington Post, will moderate the discussion.”

Learn more and register here.

NEW: Threat Agnostic Biodefense Webinar: Assessing the Zoonotic Risk of Pre-Emergent Viruses

From PNNL: “Exploration of the “virosphere” is in its golden age. The sheer number of new viruses discovered daily, and the fact that most cannot be cultured, creates enormous uncertainty about where to allocate attention and resources. It is not an intractable problem, however, to distinguish those few viruses that are likely to emerge as zoonoses from the many others that are not. This talk describes two diametric approaches to addressing this problem. The first approach involves a field-to-lab investigative methodology that, when combine with biologically informed predictive computational models, can assess the zoonotic risk of viruses that have not yet been identified in humans. The second approach relies on the power of modern methods in anthropology and ethnography to identify zoonotic transmission pathways, even before the identification of any pathogens that might traverse those pathways. A unifying example is simian hemorrhagic fever virus and its relatives in the family Arteriviridae, which cause important animal diseases but have never been documented to infect humans. Both approaches identify these viruses as high-risk pre-emergent zoonoses.”

Learn more and register for this December 6 event here.

NEW: Bio & Beer

“As a rising global leader in the bioeconomy, investments in the future STEM workforce are critical in order to secure the U.S.’s position as a world resource for biohealth technology and innovations. Join us and our three guest speakers as we discuss the importance of a diverse, skilled STEM workforce to address rapidly increasing industry demand. We will also talk about training and other opportunities designed to prepare individuals for STEM careers. Enjoy an evening of networking, drinks, and fun!”

Learn more and RSVP here.

Meeting the Moment: Biodefense Policy, Procurement, and Public Health

From the Bipartisan Commission on Biodefense: “As the Nation continues to endure the consequences of recent pandemics, and with continued interest in biological weapons by nation states and other enemies, the federal government has an opportunity to address vulnerabilities in the biodefense enterprise. At this meeting, titled Meeting the Moment: Biodefense Policy, Procurement, and Public Health, the Commission intends to further explore : (1) biodefense policies and activities at the Department of Defense; (2) federal stockpile evaluation and decision-making for smallpox medical countermeasures; (3) needed authorities of the Department of Health and Human Services, including the Centers for Disease Control and Prevention; and (4) biodefense leadership.”

This meeting will take place on December 5, from 10:30 am until 4 pm ET. Register here.

2023 EPA International Decontamination Research and Development Conference-“Advancing Preparedness through Science and Collaboration”

“The clean-up of chemical, biological, or radiological (CBR) contamination incidents and natural disasters is a critical challenge for the United States. Understanding how to characterize and remediate affected areas of environmental contamination and waste is necessary for daily life to return.”

“The Decon Conference is designed to facilitate presentation, discussion, and further collaboration of research and development topics focused on an all-hazards approach to remediate contaminated indoor and outdoor areas, critical infrastructure, water distribution systems, and other environmental areas/materials.”

“This conference is free and open to the public. Content and presentations are geared towards the emergency response community, including local and state emergency managers, homeland security officials, first responder coordinators, private sector industry, risk managers, educators in the field of emergency management, and others.”

This event will take place December 5-7 in Charleston, SC. Learn more and register here.

Mitigating Arboviral Threats and Strengthening Public Health Preparedness

“Arboviruses are a broad group of viruses that are spread by arthropods, such as ticks and mosquitoes. Diseases caused by arboviruses, like dengue, chikungunya, Zika, and yellow fever, present a significant public health burden and threaten billions of people worldwide. Despite the global recognition of the devastating health and economic impacts of these diseases, the need persists for improved integration of mitigation efforts into public health systems and environmental and urban planning.”

“The National Academies Forum on Microbial Threats will conduct a two-day workshop that will identify lessons learned from previous outbreaks, outline current arbovirus surveillance capacities, and describe novel approaches to arbovirus mitigation. The workshop will include perspectives from researchers, public health practitioners, and environmental management experts from across the globe.”

This event will take place on December 12 and 13. Learn more here.

Presidential Advisory Council on Combating Antibiotic-Resistant Bacteria (PACCARB) Virtual Meeting

“The Presidential Advisory Council on Combating Antibiotic-Resistant Bacteria (PACCARB) provides advice, information, and recommendations to the U.S. Secretary of Health and Human Services (HHS Secretary). The council supports and evaluates U.S. government activities focused on fighting antimicrobial resistance (AMR) in human health, animal health, and environmental health. Using this One Health approach, members of the PACCARB have expertise from a range of backgrounds, including academia, industry, public health, advocacy, veterinary, and agricultural production.”

“The PACCARB was established under Executive Order 13676 and included in the Pandemic and All-Hazards Preparedness and Advancing Innovation Act of 2019 (PAHPAIA). Since 2019, the President has given authority to the HHS Secretary as the primary recipient of PACCARB recommendations. Additional information on the authority and activities of the PACCARB can be found on the About Us page in the charter.”

“As a federal advisory committee, the PACCARB looks to engage with the public and all AMR stakeholders. The council holds several public meetings every year both in-person and live streamed on the HHS.gov website. These meetings are open to anyone with an interest in combating AMR. See how to get involved!”

This virtual meeting will take place on December 20 from 9-4 EST. Learn more here.

61st ISODARCO Course: Nuclear Order and International Security after Ukraine

“The war in Ukraine has had an enormous impact on global security, reviving nuclear fears, undermining the prospects for arms control, and shattering many of the norms and constraints that were the foundation of European security.  ISODARCO 2024 will examine the global nuclear order in light of the Ukraine war, focusing on the states, the policies and the technologies that will shape the future in a much more difficult environment.  How will we cope with this more dangerous world?”

This course will take place January 7-14, 2024, at the University of Trento. Learn more and register here.

International Conference, CBRNE Research & Innovation

“The last 40 years have demonstrated that both military and civilian populations could be exposed to highly hazardous CBRNE agents following conflicts, natural outbreaks and disasters, industrial incidents or terrorist attacks.”

“Worldwide, researchers, responders and industrial capacities have been commited to provide adapted response to these challenges.”

“Building on the success of the first 5 International Conferences « CBRNE Research and Innovation » which took place in Antibes (2015), Lyon (2017), Nantes (2019), on line (2021) and Lille (2022), we want to give you a new opportunity to build up or strengthen collaborative networks in Strabourg (March 19th – 21rst 2024).”

“The CBRNE R&I Conference is specifically devoted to scientific updates, responders’ feedbacks and expression of needs. It also includes workshops and demonstrations of innovative materials, technologies and procedures, according to the following themes: DETECTION – IDENTIFICATION, PROTECTION – DECONTAMINATION, MEDICAL COUNTERMEASURES, RISKS & CRISIS MANAGEMENT.”

“Looking forward to your proposals for communication and to welcoming you at Strasbourg in March 2024!”

Learn more here.

Registration for GHS 2024 Now Open

Registration is now open for the Global Health Security 2024 conference in Sydney, Australia. This iteration will take place 18-21 June, 2024. The call for abstracts is also still open. “The mission of the Global Health Security conference is to provide a forum where leaders, researchers, policy-makers, and representatives from government, international organisations, civil society, and private industry from around the world can engage with each other, review the latest research and policy innovations, and agree solutions for making the world safer and healthier. To that end, our mission is to help foster a genuinely multidisciplinary community of practice that is committed to working collaboratively to enhance global health security and eliminate disease, irrespective of its origin or source.”

Council on Strategic Risks Launches the Nuclear Weapon Systems Project

“How states view the roles and relevance of nuclear weapons is changing. While these perspectives have been dynamic since the dawn of the atomic age, the changes occurring today and drivers of these changes are particularly worrisome—in particular given that they seem to be on the cusp of reversing a period heavily characterized by arms control agreements, reductions in global arsenals, and advances in international cooperation to reduce nuclear weapons risks.” 

“CSR’s core nuclear policy work to address this challenging time has focused largely on qualitative approaches to reducing the risks of nuclear miscalculations, uses of these weapons, arms racing behavior, and other dangerous trends. Going beyond numbers of weapons—which has been a major policy focus given numerical limitations in past nuclear treaties—a qualitative view of the nuclear weapons landscape is done through the lens of the nuclear capabilities nations seek, and associated policies and postures. This can help to show where multiple nations might find areas for potential cooperation that would be mutually beneficial. It can also help to show where nations currently possess the capabilities they claim to need, and thereby in what ways cooperative or unilateral measures of restraint are the most appropriate.”

“In order to facilitate this work by CSR and by others, we are launching The Nuclear Weapon Systems Project to help visualize how the types of nuclear capabilities fielded in the world have evolved since the advent of these weapons.”

“This project seeks to document and characterize every deployed nuclear weapons system that NPT-recognized nuclear states have developed in history. More than just a list of bombs, missiles, and artillery shells, the resulting dataset illustrates a complex story of risks, strategies, and lessons learned—and lost. We consider this data to be a living resource, and encourage outside contributions and feedback.”

Read more here.

“Georgetown Global Health Center Launches First Open-Access Wildlife Disease Database”

Georgetown University Medical Center’s Center for Global Health Science and Security recently announced “the launch of a first-of-its-kind wildlife disease database — a system for collecting records of viruses, bacteria, fungi, parasites, etc. — designed to support an early warning system for potential viral emergence. The Pathogen Harmonized Observatory, or PHAROS, is open to the global community and free to access.”

“Scientists in GHSS’ Verena program, a collaborative institute comprising a global team of scientists, designed PHAROS to advance research and education around viral emergence — the process of viruses jumping from animals to humans. Verena co-founder and director Colin Carlson, PhD, says most platforms designed to track diseases in wild animals are very limited and are developed only in response to a major outbreak, such as birds dying off suddenly due to avian flu.”

‘“Our goal is to build a data sharing system that lets us eventually predict pandemics like the weather,” Carlson says. “When we collect data on wildlife viruses, it gets published in journals and then lost forever, because it isn’t ever standardized or compiled. After COVID, there’s no excuse to keep working that way.”’

Texas A&M Research Assistant Professor (Pandemic Preparedness/Biosecurity) Openings

Texas A&M University’s Scowcroft Institute of International Affairs is seeking up to two Research Assistant Professors with expertise in pandemic preparedness and/or biosecurity. The Research Assistant Professor will be in the Scowcroft Institute of International Affairs, Bush School of Government & Public Service, and will work with the Pandemic Preparedness & Biosecurity Policy Program. Responsibilities include teaching graduate courses, conducting research, and writing policy-relevant publications on biosecurity, global health security, bio and agro-defense, federal life sciences policy, one health, biotechnology, or related policy topics. 


Learn more and apply here.

Pandora Report 5.12.2023

This week covers the failure to reach consensus at the Chemical Weapons Convention Fifth Review Conference and the recent release of a Senate Republican-led probe into the start of the COVID-19 pandemic. New publications and upcoming events are also discussed, including recent congressional testimony by a Biodefense PhD Program alumnus and a new publication discussing the full economic toll of the pandemic on the United States.

Biodefense PhD Student Wins Boren Fellowship

Biodefense PhD Student Danyale C. Kellogg recently received a David L. Boren Fellowship from the Defense Language and National Security Education Office. Named after former US Senator David L. Boren, the Boren Awards provide students with funding to study languages and cultures deemed critical to national security in exchange for a public service commitment. According to the program, “Through a competitive, national, merit-based annual competition, successful applicants distinguish themselves as highly motivated in their academic and career goals and in their strong commitment to public service. In return for support, award recipients agree to work in qualifying national security positions for at least one year.”

Kellogg will spend one year in Taiwan studying Mandarin at National Taiwan Normal University’s Mandarin Training Center in Taipei. She previously earned a Master of International Affairs concentrated in China Studies and Pandemics and Biosecurity from Texas A&M. Her research is focused on China’s failed outbreak responses, particularly the inner-workings of the Chinese Communist Party and the broader implications of China’s rise for global health security.

To read more about this and other national awards won by Mason students-including several from the Schar School-this cycle, check out this article.

Chemical Weapons Convention Review Conference Held This Week

The Fifth Chemical Weapons Convention Review Conference was held this week in The Hague, a little over a year after the 25th anniversary of the treaty’s entrance into force in 1997. As CBW Events explains, “The Chemical Weapons Convention (CWC) was the second treaty to globally prohibit an entire class of weapons of mass destruction but the first to do so with a system of multilateral verification measures. The CWC was signed in 1993 and entered into force in 1997. Treaties are always shaped by the concerns at the forefront of the minds of the negotiators during the period they were being negotiated, making them creatures of their time. Yet treaties have to operate within constantly evolving contexts – from the scientific and technical to the political – and be able to respond to events. With that in mind, a common feature of treaties dealing with active problems is a review process in order to ensure they stay relevant and up to date in their activities.”

The evolving nature of the security environment and its effect on the CWC was the subject of much discussion leading into this review conference, particularly as this is supposed to be the last of the review conferences to deal with CW stockpile destruction. Issues with non-compliance, such as Syria and Russia’s use of these weapons, were also important points of consideration heading into the week. The review conference also had to address more mundane, administrative tasks regarding the OPCW’s day-to-day functions, particularly as its mission evolves.

However, in a potential sign of the fragility of multilateral disarmament, the week ended in a failure to reach consensus of the conference’s final report. Richard Guthrie recalls this, writing “Immediately after lunch, the CoW was convened behind closed doors in the main meeting room to take the procedural steps to forward the text resulting from the informal group to the plenary. Immediately following this, the plenary received an oral report from the Chair of the CoW who informed delegates that there were still ‘outstanding issues’ on which ‘fundamental divergence of views’ continue to exist and so it had been impossible to reach consensus.”


“The Chair of the Conference announced that the plenary would reconvene on Friday afternoon to adopt the report of the Conference which would reflect that no consensus could be found. The plenary was then adjourned.”


“The atmosphere in the room was one of surprise at the suddenness of the end of the process. Some delegates wandered around the room speculating whether anything could be done to retrieve the situation but it was clear that the challenges were too great.”‘

Summaries of each day’s happenings are available on CBW Net.

Senate Republicans Release Another COVID-19 Origins Report

This week, Senator Marco Rubio released the findings of a probe into the origins of COVID-19 initiated nearly two years ago. Rubio, the vice chair of the Senate Intelligence Committee, led the initial probe and released the report through his office. The report claims that new information discovered by the team involved with this probe lends credibility to the “lab leak theory.” However, the report’s introduction explains plainly “To be clear, it is the aggregate picture that emerges from this report – not any particular piece of information standing as a proverbial “smoking gun” – which matters most when assessing the origin question.”

Later in the introduction, the report also reads “It is not the limits of science that constrain our understanding of the origin of SARSCoV-2. It was the political decision to block scientists from accessing the clinical and genomic data that would have allowed them to methodically reconstruct what happened. For this reason, we approached the origin question as a political puzzle, first and foremost, with a scientific component that is important, but not decisively so. This report borrowed a legal standard – the preponderance of the evidence – to assess what we know at this juncture, using the admittedly incomplete information we have available. Whatever its limitations, we trust that most readers will judge this report to be a useful contribution to the search for answers and accountability.”

In the end of its introduction, the report makes a hefty promise: “Risky research conducted at a state-run laboratory having inadvertently unleashed a novel pathogen, which then set in motion a once-in-a-century pandemic of almost unimaginable devastation, is a decidedly different and unprecedented problem with a path of culpability that leads unquestionably back to Beijing. When one further considers that this state-run laboratory was built to showcase China’s growing scientific prowess, and at least some segment of its research involved state secrets, it is not hard to imagine the extreme embarrassment and sensitivity that such a scenario would elicit in CCP leaders, even if the accident had not precipitated a pandemic. Needless to say, we do not yet know with complete certainty that a biocontainment failure was responsible for the first human infection of SARS-CoV-2, but what we present below is a substantial body of circumstantial evidence that supports the plausibility of such a scenario.“

The 329-page report is available here. An in-depth analysis of this report will be available from the Pandora Report next week. Our discussion of last year’s reporting from the Senate HELP Committee and the corresponding article published by ProPublica and Vanity Fair is also available here.

“Biological Weapons Convention: In the Crosshairs of Geopolitical Tensions, Part 1”

Filippa Lentzos and Tancredi Francese explain in this piece that “The Biological Weapons Convention has become an outlet for geopolitical tensions heightened by the war in Ukraine. This two-part article charts how the diplomatic battle between Moscow and Washington for control of the narrative on treaty compliance and verification is at a precarious point.”

The first portion offers an in-depth recalling of Russia’s efforts last year to bring allegations of BWC non-compliance before the UNSC and into the consultative meeting process. The second discusses the outcome of last year’s BWC review conference with the authors writing “Ultimately, it seems clear that Russia will continue to demand clarifications from the United States, at least as long as the war in Ukraine continues. These allegations and their impacts on the international security community are part of the conflict; they are not a side show but instead a dimension of the clash between two different visions of the world. In terms of biosecurity, imagining reconciliation as long as this clash continues seems difficult, and it risks significantly eroding what remains of the international architecture against the proliferation of biological weapons. If there is a lesson to draw from the events in 2022, particularly the review conference, it is that the BWC still matters for many. Even when interests were far apart, states were still able to negotiate and agree on an ambitious plan for the next several years.”

“Public Health Preparedness: Critical Need to Address Deficiencies in HHS’s Leadership and Coordination of Emergencies”

In this recent report, the Government Accountability Office found “…persistent deficiencies in the Department of Health and Human Services’ (HHS) ability to lead and coordinate the nation’s preparedness for, and response to, public health emergencies. Specifically, HHS has consistently fallen short in five areas of an effective national response…”

These areas are:

  • “Establish clear roles and responsibilities
  • Collect and analyze complete and consistent data
  • Provide clear, consistent communication
  • Establish transparency and accountability
  • Understand key partners’ capabilities and limitations”

The report continues, explaining “For example, GAO found that HHS has not

  • developed clear roles and responsibilities, including exercising them;
  • developed an interoperable network of systems for near real-time public health situational awareness, as required in statute since 2006;
  • provided clear, consistent communication about disease outbreaks, including information about COVID-19 testing;
  • been transparent when disseminating information during an emergency, such as the scientific reasoning for changes to the COVID-19 testing guidelines; and
  • undertaken key workforce planning to meet its emergency planning and response mission and goals.”

“Sustained leadership and attention from the executive branch and Congress in this area is needed to ensure the systemic issues GAO has identified are sustainably addressed so that the U.S. is adequately prepared for future emergencies. A whole-of-nation multidisciplinary approach to preparedness and response is essential. HHS partnership and engagement with nonfederal entities, including state, local, tribal, and territorial governments, and the private sector are key elements of this approach. GAO will continue to monitor HHS’s efforts in this area.”

“COVID-19’s Total Cost to the Economy in US Will Reach $14 Trillion by End of 2023 – New Research”

In this piece for the Conversation Jakub Hlávka and Adam Rose hash out the economic toll of the COVID-19 pandemic on the United States. Their modeling suggests that, by the end of 2023, that cost will total USD 14 trillion. They discuss this shocking sum, writing in part “The COVID-19 pandemic’s economic consequences are unprecedented for the U.S. by any measure. The toll we estimate that it took on the nation’s gross domestic product is twice the size of that of the Great Recession of 2007-2009. It’s 20 times greater than the economic costs of the 9/11 terrorist attacks and 40 times greater than the toll of any other disaster to befall the U.S. in the 21st century to date.”

“Although the federal government has now lifted its COVID-19 Public Health Emergency declaration, the pandemic is still influencing the U.S. economy. The labor force participation rate, which stood at 62.6% in April 2023, has only recently neared the February 2020 level of 63.3%.”

War on All Fronts

“It is now widely recognized that disease pandemics are a threat to national and global security. Yet the field of health security remains under theorized, in particular in its relation to civil and human rights. In War on All Fronts, Nicholas G. Evans provides a novel theory of just health security and its relation to the practice of conventional public health. Using COVID-19 as a jumping-off point to examine wider issues, including how the US thinks about and prepares for pandemics, He asks what ethical principles justify declaring, and taking action during, a public health emergency such as the ongoing COVID-19 pandemic; and arrives at principles that parallel those of the ethics of armed conflict. Just as just war theory properly understood begins with pacifism and a commitment to the right not to be killed and then steps back to ask under what limited conditions it is permissible to kill, Evans argues that in a similar way a just health security must also begin with the idea that public health should hold human rights sacrosanct and then ask under what limited conditions other concerns might prevail. Evans’s overall goal is to formulate a guide to action, particularly as the world deals with the fallout of the COVID-19 pandemic. Turning to the transition from war back to peace in public health, he looks at reparation, rebuilding, and the accountability of actors during the crisis.

Available from MIT Press“

“Woke Virology? Ron DeSantis Finds Another Thing to Ban in Florida”

In this piece for the Bulletin of the Atomic Scientists, Matt Field explains “On Thursday, the governor signed a host of bills on hot-button issues-of-the-day among Republican politicians and voters, including one that would prevent research involving potentially pandemic capable viruses that result from “enhancing the transmissibility or virulence of pathogen.” The US Department of Health and Human Services is reviewing recommendations to tighten its requirements for funding such projects, known colloquially as “gain of function” research, but DeSantis has now leapfrogged any federal decision.”

‘“We are the first state in the United States to ban, formally, gain of function research,” DeSantis said to cheers from a Florida audience.”

“According to the law, “any research that is reasonably likely to create an enhanced potential pandemic pathogen or that has been determined by the United States Department of Health and Human Services, another federal agency, or state agency…to create such a pathogen is prohibited in this state.”’

NEW: Soft Launch of the Biological Weapons Convention Implementation Measures Database

From UNIDIR: “The Biological Weapons Convention (BWC) National Implementation Measures Database is a searchable, publicly accessible database containing information about the national implementation measures undertaken by BWC States Parties. The database is designed to strengthen the implementation of the BWC, allowing States Parties, Signatories, and other stakeholders to better understand different approaches to national implementation from around the world and identify possible gaps and limitations in BWC implementation.”

“As part of the development of the database, UNIDIR’s Weapons of Mass Destruction Programme and VERTIC’s National Implementation Measures Programme are organising an online event to introduce the tool and showcase its structure and functions.”

This event will take place on May 31, at 1 pm CEST. Learn more and register here.

ICYMI: Oversight And Investigations Subcommittee Hearing: “Protecting Critical Infrastructure from Cyberattacks: Examining Expertise of Sector Specific Agencies”

The House Energy and Commerce’s Subcommittee on Oversight and Investigations held a hearing this week titled “Protecting Critical Infrastructure from Cyberattacks: Examining Expertise of Sector Specific Agencies.” The hearing’s recording is available here. Among the witnesses was Biodefense PhD Program alumnus and current Schar School adjunct Dr. Brian Mazanec, Deputy Director, Office of Preparedness, Administration for Strategic Preparedness and Response, Department of Health and Human Services. A copy of Mazanec’s testimony is available here.

Nobel Prize Summit-Truth, Trust and Hope

Taking place May 24-26 this year in DC and virtually, this Nobel Prize Summit asks “How can we build trust in truth, facts and scientific evidence so that we can create a hopeful future for all?”

“Misinformation is eroding our trust in science and runs the risk of becoming one of the greatest threats to our society today.”

“Join us at this years’ Nobel Prize Summit which brings together laureates, leading experts and you in a conversation on how we can combat misinformation, restore trust in science and create a hopeful future.”

Learn more and register here.

Building Capacity for Dual-Use Oversight in the Life Sciences through the IEGBBR

Join the International Experts Group of Biosafety and Biosecurity Regulators for this virtual event on May 30 at 7 am EDT. This event will discuss “how to identify, assess, and mitigate dual-use concerns in the life sciences – two examples of oversight measures in a national oversight system”. Register here.

CSWMD 2023 Annual Symposium: WMD in the Decisive Decade

“The National Defense University’s Center for the Study of Weapons of Mass Destruction (CSWMD) invites you to join us on 14 June 2023 for the virtual Annual CSWMD Symposium, titled WMD in the Decisive Decade.”

“This year’s symposium will explore the cognitive impacts WMD has on strategic decision making and the challenges associated with operating in an environment where WMD has been employed. It will be an opportunity for the WMD community to engage with officials and thought leaders on current WMD challenges at the unclassified level, including keynote addresses by Richard Johnson, Deputy Assistant Secretary of Defense for Nuclear and CWMD Policy and Rebecca Hersman, Director of the Defense Threat Reduction Agency.”

“For more information and to register for this event click here. Please RSVP by 9 JUNE 2023.”

“We look forward to hosting you for the event. For more information about the WMD Center and reference our research, please visit our website at https://wmdcenter.ndu.edu/ and follow us on Twitter and on LinkedIn.”

Gordon Research Conference: Cross-Cutting Science Facilitating Collaboration Across the Threat-Science Research Community

“The Nonproliferation, Counterproliferation and Disarmament Science GRC is a premier, international scientific conference focused on advancing the frontiers of science through the presentation of cutting-edge and unpublished research, prioritizing time for discussion after each talk and fostering informal interactions among scientists of all career stages. The conference program includes a diverse range of speakers and discussion leaders from institutions and organizations worldwide, concentrating on the latest developments in the field. The conference is five days long and held in a remote location to increase the sense of camaraderie and create scientific communities, with lasting collaborations and friendships. In addition to premier talks, the conference has designated time for poster sessions from individuals of all career stages, and afternoon free time and communal meals allow for informal networking opportunities with leaders in the field.”

This conference will take place July 9-14 in Ventura, CA. Learn more and register here.

Weekly Trivia Question

You read the Pandora Report every week and now it’s time for you to show off what you know! The first person to send the correct answer to biodefense@gmu.edu will get a shout out in the following issue (first name last initial). Our question this week is: In late 2019, what two nerve agents were added to the CWC’s Schedule 1?

Shout out to Alexander G. for correctly answering last week’s question. Our question was: “On what date did the CWC enter into force?” The answer is April 29, 1997.

Pandora Report 5.12.2023

Happy Friday! This week we’re covering the end of the US COVID-19 public health emergency, the upcoming CWC Review Conference, and the resumption of the NIH’s funding for the EcoHealth Alliance’s bat coronavirus research. Several new publications and events are also covered, including new books on cyberbiosecurity and infodemics.

Congrats to Our Graduating Biodefense Students

A big congratulations to all of our graduating Biodefense MS students this semester, and a special shout out to Cassidy Bilskie-this year’s Outstanding Masters Student in Biodefense Award recipient! We’re so proud of you all and can’t wait to see what you do next!

Biodefense PhD Student Wins BioRisk Reduction Award

“PhD student Ryan Houser recently won an award from BioRisk Reduction for this work within the organization.  Ryan was awarded the Stanley Hall Award which was handed out at the company’s 2022 Awards meeting.  Stanley Hall was a dear friend of the CEO and President Ryan McAllister who he came to know through officiating K-12 football during the McAllister’s time in graduate school. The relationships and life skills McAllister possess from this time are as important to his personal and career success as his scientific knowledge and understanding. Early in the COVID-19 pandemic, Stanley was unfortunately taken from us by the illness, despite being a younger athletic individual. Stanley’s name lives on through the annual Stanley Hall award within BioRisk Reduction to the team member who best represents some of Stanley’s best qualities: Role Model to their peers, Loyal to their team, and Amicable.”

“Houser started with Biorisk Reduction in October 2021 as an Associate Team Member. He was promoted to Team Member in June 2022.  Houser also serves as a Class III Consultant and a Business Biosafety Committee (BBC) Community Member within Biorisk Reduction.  Houser has supported various ongoing projects which include facilitating and translating biosafety-related education and training programs (First Aid and Airborne Pathogen Training), academic journal publications, and a novel Credentialing Program.”

“BioRisk Reduction is a global network of experts in infectious disease who have come together to reduce the stress, time, and cost for clients associated from every day diseases such as COVID-19. Our network is comprised of Scientists, Physicians, Nurses, Public Health Professionals, High Containment Researchers and Engineers, Combat Medics, Legal analysts, Educators, Public Safety Officers, and other professionals.  BioRisk Reduction provides communities and businesses direct access to infectious disease experts both virtually or in-person. BioRisk Reduction Business to Business and professional development services include Consulting, Technical Writing, Education and Training, Risk Assessments, and Committee Accreditation.  For more information inquire through email at mailto:bioriskreduction@bioriskreduction.com or phone at tel:3072280981. http://www.bioriskreduction.com“

US COVID-19 Public Health Emergency Ends

The United States officially ended the COVID-19 public health emergency yesterday, May 11, over three years after its initial declaration. This came on the heels of the WHO announcing last week that it no longer considers COVID-19 a public health emergency of international concern. The Washington Post explains that “Starting in early 2020, the emergency declaration, along with subsequent declarations, legislation and administrative actions, gave the federal government flexibility to waive or modify certain rules in the Medicare and Medicaid programs as well as in private health insurance. The goal has been to help the nation fight the worst public health crisis in a century and help some patients get care in a time of shutdowns.”

“As this long emergency period expires, experts say, the biggest impact for consumers will be the end of free coronavirus tests — both at-home tests and those performed by clinicians and analyzed by commercial labs — with broad implications for people’s ability to get timely covid diagnoses, prevent disease transmission and track the virus.”

Importantly, this will also impact COVID-19 data collection tools. With hundreds of people dying from the disease in the US every day, this is especially concerning. In fact, COVID-19 was the fourth leading cause of death in the United States in 2022, down from third place in 2020 and 2021. COVID-19 was superseded only by unintentional injuries (including drug overdoses and car wrecks), heart disease, and cancer. The New York Times writes “The death rate went down by a lot, but we also want to emphasize we’re not out of the woods here,” said Dr. Robert Anderson, the chief of the mortality statistics branch at the National Center for Health Statistics. “There are still a lot of people who died, and we’re still seeing deaths in 2023 as well.”

This comes at a time when the US is seeing a shakeup in public health leadership, with CDC Director Rochelle Walensky announcing her resignation last week and the Biden administration struggling to find a new pandemic czar. Politico quoted GMU Biodefense Assistant Professor Dr. Saskia Popescu on this problem, writing “This is a critical resource to ensuring there is awareness for biopreparedness at the highest level,” said Saskia Popescu, an epidemiologist and assistant professor in George Mason University’s biodefense program, adding that among its chief jobs will be breaking “a cycle of neglect in preparedness efforts.’…Still, the top job is proving a difficult sell amid worries the director will get stuck with a long to-do list and little influence to get it done.”

While these are concerning signs that US public health might struggle even more in the coming years, there is some positive news. It was recently reported that a bipartisan group of senators are attempting to revive efforts to create a national COVID-19 taskforce. This would be modeled after the 9/11 Commission and it would be tasked with investigating the federal government’s response to the pandemic in addition to debates about the virus’s origin.

Check out this Q&A piece from The Conversation about what the end of the COVID-19 national emergencies means in terms of domestic policies and the end of the pandemic.

CWC Review Conference Begins Next Week

The Fifth Review Conference (RC) for the Chemical Weapons Convention (CWC) will be held next week from May 15 through 19 in The Hague. The RC is a special session convened by the Conference of the States Parties every five years to examine the CWC’s operation, evaluate its implementations status, and outline priorities for the OPCW for the next five years. Event schedules, press releases, relevant documents, webcasts, and more can be accessed at: https://www.opcw.org/calendar/rc.

Ahead of the big event, here are some relevant recent works to check out:

“The Future of Chemical Disarmament in an Eroding Global Order”-This conference report and annotated bibliography from Lawrence Livermore National Laboratory’s Center for Global Security Research address questions about how the CWC and OPCW can adapt to technical and political challenges, lessons learned from the treaty’s first 25 years, and what prospects there are for continued progress in chemical disarmament.

“Countering the Future Chemical Weapons Threat”– In this piece for Science, Dr. Tuan Nguyen explains that “After decades of difficult negotiations, the Chemical Weapons Convention (CWC) was adopted in 1993 and entered into force on 29 April 1997, banning the development, production, stockpiling, transfer, and use of chemical weapons (CW). As the CWC celebrates the 25th anniversary of its entry into force, it can document considerable success, much of it attributed to the CWC implementing body—the Organisation for the Prohibition of Chemical Weapons (OPCW). Yet, facing a volatile international security environment and an everchanging chemical industry, the OPCW must transform to meet its mission and remain an exemplar for multilateralism. As the next CWC review conference approaches in 2023, a next-generation OPCW 2.0 can be effective and credible only if it reinforces international norms against CW, anticipates future challenges posed by advancements in science and technology (S&T), incorporates more qualitative elements into the verification and compliance system, and keeps pace with technological change.”

“Report of the Scientific Advisory Board on Development in Science and Technology to the Fifth Special Session of the Conference of the States Parties to Review the Operation of the Chemical Weapons Convention”-This Director General report covers findings from the OPCW’s Scientific Advisory Board, noting issues and concerns in CWC implementation like developments in science and technology such as AI and the convergence of different fields of science. It offers several recommendations, including ones focused on how best to address increasing threats posed by newly scheduled chemicals and CNS-acting chemicals.

“Developing a Plan B for the Chemical Weapons Convention 5th Review Conference”-In this piece for the European Leadership Network, Alexander Ghionis discusses the polarization and lack of consensus in recent years, driven in large part by Syria’s use of CW. He argues “…State Parties should pursue agreements on individual issues likely to command consensus rather than seeking to adopt a watered-down consensus final document with little vision or impetus to shape the future.”

“Two Years On, Syria’s Suspension from the OPCW Was Beneficial”-The Foundation for the Defense of Democracies’ Andrea Stricker tackles efforts led by Russia, China, and Iran to prevent the OPCW from fully functioning, both in holding CWC violators accountable and in conducting routine business. She writes in part “Building such a coalition will require intensive diplomacy. Officials close to the OPCW say that while Damascus’ suspension was “one hundred percent useful” for the OPCW’s functioning, there is no appetite to suspend Russia. Western countries still prefer Moscow inside the system. What they evidently fail to grasp: so long as Russia remains a member in good standing, the Kremlin will undermine serious efforts to eliminate chemical weapons.”

“Ponghwa Chemical Factory: North Korea’s Chemical Facilities: Site Profile 1”-The first of the Royal United Services Institute for Defence and Security Studies’ site profiles, this report covers North Korea’s Ponghwa Chemical Factory in Sinŭiju: “This report on the Ponghwa Chemical Factory is the first in a series exploring different chemical production facilities throughout North Korea. The project seeks to map out the North Korean chemical industry and its potential links to a chemical weapons programme. There is nothing in open sources that suggests this site is involved in producing chemical weapons. However, it is the main oil refinery in North Korea and, as such, would provide the building-block raw materials for the production of organic chemicals. Ponghwa Chemical Factory is therefore a central part of North Korea’s chemical industry, and no networked assessment of the country’s national industrial-chemical capacity, and its potential to produce chemical warfare agents (CWAs) would be complete without analysis of a site producing these basic raw materials.”

“The report covers a brief history of the site from its construction and commissioning in the 1970s through to satellite imagery demonstrating that it is still operational. Individual areas are identified and analysed in relation to their purpose. Finally, local links to the site are explored to give it a wider context within the area.”

“The features and areas of the site are consistent with those expected in a refinery, making it unlikely that it is directly involved in the manufacture of chemical weapons. The site manufactures various fractions from crude oil. These fractions include liquid petroleum gas/refinery gas, petrol/gasoline, kerosene/paraffin, diesel oil, heavy fuel oil and bitumen/tars/coke.”

EcoHealth Alliance Back in Bat Business

The NIH has resumed its grant funding to the EcoHealth Alliance, providing the organization with $576,000 annually for the next four years to continue its research on bat-origin coronaviruses. Science explains “The new 4-year grant is a stripped-down version of the original grant to the EcoHealth Alliance, a nonprofit research organization in New York City, providing $576,000 per year. That 2014 award included funding for controversial experiments that mixed parts of different bat viruses related to severe acute respiratory syndrome (SARS), the coronavirus that sparked a global outbreak in 2002–04, and included a subaward to the Wuhan Institute of Virology (WIV). The new award omits those studies, and also imposes extensive new accounting rules on EcoHealth, which drew criticism from government auditors for its bookkeeping practices.”

“But EcoHealth’s embattled director, Peter Daszak, says his group is pleased: “Now we have the ability to finally get back to work,” he says.”‘

Cyberbiosecurity: A New Field to Deal with Emerging Threats

“Biocybersecurity applies cybersecurity research to the field of biology, and, to a lesser degree, applies biological principles to the field of cybersecurity. As biologists increasingly research, collaborate, and conduct research online, biocybersecurity has become crucial to protect against cyber threats. This book provides an overview of biocybersecurity through the lens of researchers in academia, industry professionals, and government, in both biology and cybersecurity fields. The book highlights emerging technologies, and identifies emerging threats connected with these technologies, while also providing a discussion of the legal implications involved.”

“This book takes on a multidisciplinary approach, and appeals to both professionals and researchers in the synthetic biology, bioinformatics, and cybersecurity fields.”

“Benchtop DNA Synthesis Devices: Capabilities, Biosecurity Implications, and Governance”

From NTI: “Synthetic DNA is used by bioscience laboratories globally and plays a fundamental role in bioscience, biotechnology, and biomanufacturing advances applied to a range of areas from agricultural products to pharmaceuticals to advanced fuels. A new generation of benchtop DNA synthesis devices—machines designed to be used on any lab workbench—will soon enable users to print DNA more quickly and easily in their own laboratories. This new technology could disrupt the traditional DNA synthesis market, in which customers order DNA online from a select set of providers, making it harder to safeguard DNA synthesis technology and to prevent bad actors from obtaining the building blocks of dangerous pathogens. A new NTI | bio report released today, Benchtop DNA Synthesis Devices: Capabilities, Biosecurity Implications, and Governance, describes the status of this rapidly advancing technology, explains the risks for biosecurity, and recommends action and oversight by governments, industry, and the scientific community to reduce the risks.”

“We Could Easily Make Risky Virological Research Safer”

New York Times opinion writer David Wallace-Wells recently published this piece discussing biosecurity risks and recent recommendations from the National Science Advisory Board for Biosecurity. He writes in part “Lab accidents happen, and they aren’t especially rare. A 2014 USA Today investigation by Alison Young, whose book “Pandora’s Gamble: Lab Leaks, Pandemics, and a World At Risk” is a shocking accounting of the problem, identified more than a thousand accidents reported to federal regulators from 2008 to 2012. Some were not especially dangerous. But if you’ve read accounts of them at any point over the course of the Covid-19 pandemic as debate continued over its origins, chances are they’ve shaken you a bit. Many of the touchstone examples have been tied to quotidian causes — sloppy procedures and lax oversight. But lately debate has focused on the dangerousness of the experiments themselves, in part because knowing what is risky suggests what extra precautions might be taken and in part because it raises a more bracing fundamental question: What kind of work is worth this risk?”

“In January the National Science Advisory Board for Biosecurity issued a series of draft recommendations for tightening regulation and oversight. The proposed framework would expand the list of pathogens that would require rigorous review and close some loopholes that allowed some researchers to avoid that oversight. But for the moment, the recommendations sit in a kind of regulatory limbo, awaiting a green light from the White House and implementation at the National Institutes of Health.”

“The Rise and Fall of the Raccoon Dog Theory of COVID-19”

In this piece for The Intercept, Jimmy Tobias discusses recent debate about Jesse Bloom’s recent preprint. Tobias explains “Late last month, Jesse Bloom, a computational virologist at the Fred Hutchinson Cancer Center in Seattle released a paper in which he analyzed raw genomic data from hundreds of environmental swabs that Chinese scientists collected from cages, carts, and other surfaces at the Huanan Seafood Wholesale Market in Wuhan, China. The swabs were collected beginning on January 1, 2020, after Chinese authorities abruptly shut down the market amid the worsening Covid-19 outbreak in the city.

“…the raw data from the environmental swabs have long been seen as a possible clue to what happened at the Huanan Seafood Wholesale Market. But the data only became available to the global research community in 2023, after years in which Chinese Center for Disease Control and Prevention and its researchers kept it out of the public domain. The data has since sparked a firestorm of discussion, including numerous stories in mainstream news outlets that have relied on the data to report a link between raccoon dogs and Covid’s origin. Bloom’s new paper helps clarify what has become something of a confused, and confusing, media spectacle.”

“Bloom’s paper, which was published as a preprint on bioRxiv on April 26, found that the data from the swabs provide no evidence one way or another about whether raccoon dogs or other animals at the market were infected with SARS-CoV-2. It also highlights what is perhaps the most significant limitation of the data from the environmental swabs collected by Chinese scientists. The swabs were collected, Bloom writes, “at least a month after the first human infections in Wuhan.”’

Managing Infodemics in the 21st Century

“This open access book on infodemic management reviews the current discussions about this evolving area of public health from a variety of perspectives.”

“Infodemic management is an evidence-based practice underpinned by the science of infodemiology that offers guidance to better manage pandemic and epidemic risks and more quickly tackle new and resurgent health threats. Infodemic management has added much visibility and recognition for the importance of social-behavioural sciences, health communication, participatory and human-centered approaches, and digital health as complementary scientific and practical approaches that also must be strengthened in public health practice through a whole-of-society and whole information ecosystem approach. This volume makes a case that health of the information ecosystem in the digital age has emerged as the fourth ecosystem that public health is challenged by, along with the triad of environment-human-animal health.” 

“The book brings together scientists and practitioners across disciplines to offer insights on infodemic management. The tools, methods, analytics, and interventions that they discuss in the context of acute health events also can be applied to other public health areas. Topics covered include:

  • People’s Experience of Information Overload and Its Impact on Infodemic Harms
  • Smart Health! Expanding the Need for New Literacies
  • To Debunk or Not to Debunk? Correcting (Mis)information
  • Partnering with Communities for Effective Management of Health Emergencies”

“Managing Infodemics in the 21st Century is required reading for public health practitioners in need of an overview of this evolving field of practice that has made major scientific and practical leaps forward since early 2020. Global, regional, and local health authorities are increasingly recognizing the need to expand their capacities for infodemic management in their efforts to better prepare for future health emergencies. This book is the resource they need to build toward a mature infodemic management process. The text also can be used as supplemental reading for graduate programs and courses in public health.”

“Lessons Learned from the COVID-19 Pandemic – May 2023”

From the ECDC: “This document aims to collate and present the lessons identified from the public health stakeholders who responded to the COVID-19 pandemic. It is intended to serve as input for countries revising their pandemic or emergency preparedness plans.”

“A structured review of the response to a public health threat in order to learn lessons for future response should be built into the continuous preparedness cycle of anticipation, response and recovery from an incident. The COVID-19 pandemic presents a unique example of public health response to a severe incident and lessons should be quickly identified and used for the updating of pandemic preparedness plans. After-Action Reviews (AAR) and In-Action Reviews (IAR), for which ECDC has developed guidance, are valuable tools to assist countries in this process.”

“During 2021 and 2022, ECDC carried out a number of activities to identify lessons and collect insights from the response to the COVID-19 pandemic. These activities took the form of an internal exercise with ECDC experts; a review of country lessons reports; discussions with the Member States and two consultation sessions: an expert consultation on the evaluation and implementation of non-pharmaceutical interventions (NPIs), and an expert meeting on lessons learned from the COVID-19 pandemic. Lessons from these activities were collected systematically, initially in nine thematic areas. The information was then further collated into four lesson areas, each one representing a critical component of the response to a health threat:

  • Lesson Area 1: Investment in the public health workforce
  • Lesson Area 2: Preparing for the next public health crisis
  • Lesson Area 3: Risk communication and community engagement
  • Lesson Area 4: Collection and analysis of data and evidence.”

“This report presents the lessons identified in each of the areas, together with activities and future action where ECDC can contribute. Discussions on the prioritisation of ECDC follow-up actions are ongoing with the countries of the EU/EEA (European Union/European Economic Area) through the ECDC networks and governing bodies.”

“COP 28 Will be the First to Dedicate a Day to Health and Climate”

In this piece for the Bulletin of the Atomic Scientists, Fiona Harvey discusses the upcoming UN Climate Change Conference and the decision to dedicate more time during it to health issues. She writes in part, “The next UN climate summit will be the first to consider health issues in depth, with a meeting of global health ministers to highlight the consequences of the climate crisis for wellbeing.”

“Sultan Al Jaber, the president of Cop28, which will take place in Dubai this November, said on Tuesday: “We will be the first Cop to dedicate a day to health and the first to host a health and climate ministerial. And we need to broaden our definition of adaptation to enable global climate resilience, transform food systems and enhance forestry land use and water management.”’

“Ministers from around the world are gathered in Berlin this week for the Petersberg Climate Dialogue, an annual meeting on climate held by the German government. Al Jaber, addressing the conference, vowed to use Cop28 to fulfill the goals of the 2015 Paris agreement.”

“At Cop28, countries will for the first time formally assess progress since Paris, a process known as the global stocktake. This is likely to show that most countries are falling well short of the cuts in greenhouse gases needed to limit global temperature rises to 1.5C, the more stringent of the two goals in the Paris agreement, in line with scientific advice.”

ICYMI: A Roadmap for Biosecurity

This Milken Institute event was hosted on May 1, and moderated by Biodefense PhD alumnus Dr. Yong-bee Lim. “Many experts refer to climate change as a “threat multiplier” because it can exacerbate such global stressors as poverty, food insecurity, and political instability. Climate change is also linked to an increased risk of infectious diseases, as rising temperatures enable more pathogens to survive and spread. That risk is compounded as we encroach ever more on the natural habitat, creating more opportunities for human-animal interaction, thus increasing the risk for zoonotic spillover. To mitigate these risks, there must be greater coordination across and within government agencies, but the public sector cannot and should not do it alone. In this panel, experts will lay out a path to enable broader multi-sectoral and multi-stakeholder collaboration in responding to the threats to global biosecurity.”

Watch the event recording here.

Nobel Prize Summit-Truth, Trust and Hope

Taking place May 24-26 this year in DC and virtually, this Nobel Prize Summit asks “How can we build trust in truth, facts and scientific evidence so that we can create a hopeful future for all?”

“Misinformation is eroding our trust in science and runs the risk of becoming one of the greatest threats to our society today.”

“Join us at this years’ Nobel Prize Summit which brings together laureates, leading experts and you in a conversation on how we can combat misinformation, restore trust in science and create a hopeful future.”

Learn more and register here.

Building Capacity for Dual-Use Oversight in the Life Sciences through the IEGBBR

Join the International Experts Group of Biosafety and Biosecurity Regulators for this virtual event on May 30 at 7 am EDT. This event will discuss “how to identify, assess, and mitigate dual-use concerns in the life sciences – two examples of oversight measures in a national oversight system”. Register here.

CSWMD 2023 Annual Symposium: WMD in the Decisive Decade

“The National Defense University’s Center for the Study of Weapons of Mass Destruction (CSWMD) invites you to join us on 14 June 2023 for the virtual Annual CSWMD Symposium, titled WMD in the Decisive Decade.”

“This year’s symposium will explore the cognitive impacts WMD has on strategic decision making and the challenges associated with operating in an environment where WMD has been employed. It will be an opportunity for the WMD community to engage with officials and thought leaders on current WMD challenges at the unclassified level, including keynote addresses by Richard Johnson, Deputy Assistant Secretary of Defense for Nuclear and CWMD Policy and Rebecca Hersman, Director of the Defense Threat Reduction Agency.”

“For more information and to register for this event click here. Please RSVP by 9 JUNE 2023.”

“We look forward to hosting you for the event. For more information about the WMD Center and reference our research, please visit our website at https://wmdcenter.ndu.edu/ and follow us on Twitter and on LinkedIn.”

Gordon Research Conference: Cross-Cutting Science Facilitating Collaboration Across the Threat-Science Research Community

“The Nonproliferation, Counterproliferation and Disarmament Science GRC is a premier, international scientific conference focused on advancing the frontiers of science through the presentation of cutting-edge and unpublished research, prioritizing time for discussion after each talk and fostering informal interactions among scientists of all career stages. The conference program includes a diverse range of speakers and discussion leaders from institutions and organizations worldwide, concentrating on the latest developments in the field. The conference is five days long and held in a remote location to increase the sense of camaraderie and create scientific communities, with lasting collaborations and friendships. In addition to premier talks, the conference has designated time for poster sessions from individuals of all career stages, and afternoon free time and communal meals allow for informal networking opportunities with leaders in the field.”

This conference will take place July 9-14 in Ventura, CA. Learn more and register here.

Call for Feedback: Questionnaire on the United States Government’s Definition for Long COVID

The National Academies’ Committee on Examining the Working Definition for Long COVID invites you to participate in a questionnaire about how to best define Long COVID from different perspectives.

The term Long COVID was developed by patients experiencing lingering symptoms of COVID-19. Long COVID is a serious global issue with medical, social, economic, and personal impacts.

Results of this questionnaire and other input being gathered in Spring 2023 will be reviewed by the National Academies committee to understand more about defining Long COVID.

The questionnaire should take approximately 10-15 minutes to complete and will remain open through May 12, 2023. Submit feedback here.

To learn more about the study, please visit the project webpage.

Weekly Trivia Question

You read the Pandora Report every week and now it’s time for you to show off what you know! The first person to send the correct answer to biodefense@gmu.edu will get a shout out in the following issue (first name last initial). Our question this week is: On what date did the CWC enter into force?

Shout out to Detlef M. for correctly answering last week’s question. Our question was: “What nerve agent has the military designation “GB”?” The answer is sarin.

Pandora Report: 2.3.2023

Happy Friday! This week we are covering President Biden’s announcement that the national and public health emergency declarations for COVID-19 will terminate on May 11, recommendations to expand federal oversight of biosecurity and risky research, and the OPCW Investigation and Identification Team’s third report on the 2018 Douma chemical attack. We also have a number of new publications and a podcast episode featuring Dr. Glenn Cross, an alumnus of the Biodefense PhD Program, discussing Rhodesia’s CBW program during its counterinsurgency in the 1970s.

Biden Administration to End COVID-19 Emergency Declarations in May

In September of last year, President Biden declared in an interview on “60 Minutes” that “The pandemic is over,” drawing swift backlash for seemingly endorsing the sentiment that the pandemic is over because Americans want to behave like it is. He continued, saying “We still have a problem with COVID. We’re still doing a lot of work on it…but the pandemic is over. If you notice, no one’s wearing masks. Everybody seems to be in pretty good shape. And so I think it’s changing.” We wrote then, “Everybody” is definitely not “in pretty good shape.” With developments announced this week, this has potential to become even more true later this year with the end of pandemic protections.

President Biden notified Congress this week that he plans to end the national emergency and public health emergency declarations for the COVID-19 pandemic on May 11, a move that will shift the federal response to one designed at managing an endemic threat and end several protections and benefits. It comes as many have pushed for a “return to normal” and House Republicans threaten to end the national emergencies themselves. The end of these emergencies will likely mean that many Americans will have to pay for COVID-19 testing, vaccinations, and treatments out of pocket that were previously free to them. Zeke Miller explains this further in AP News, writing in part “It comes as lawmakers have already ended elements of the emergencies that kept millions of Americans insured during the pandemic. Combined with the drawdown of most federal COVID-19 relief money, it would also shift the development of vaccines and treatments away from the direct management of the federal government.”

Congress has refused to authorize additional funding for COVID-19 vaccines, prompting the federal government to begin preparations to move this care to the commercial market last year. Pfizer and Moderna have indicated that their prices for COVID-19 vaccines will likely be between $82 and $130 per dose. This amount is between three and four times what the federal government has paid for them through bulk purchasing programs, according to the Kaiser Family Foundation. The same Kaiser analysis found that, “If payers end up paying those prices for one dose per adult, the analysis estimates that the total cost of purchasing booster shots commercially would run between $6.2 billion and $29.7 billion a year, depending on price and how many people nationally get the vaccine or booster.”

The federal government spent over $30 billion on these vaccines to “…encourage their development, guarantee a market, and ensure that the public can access them at no charge.” Insurers may be able to negotiate discounted prices, but as Kaiser also points out, “…they will have limited leverage because they will generally be required to cover all recommended vaccines and boosters.” While those with public or private insurance may not personally bear this cost, this could drive up insurance premiums. Worse, those who are uninsured will lose their guaranteed access to these vaccines and, given the prices announced per dose by Pfizer and Moderna, paying out-of-pocket will likely be out of reach for many.

And the number of uninsured also has potential to rise with the end of expanded Medicare coverage in response to the COVID-19 pandemic. AP explains, “Medicaid enrollment ballooned during the pandemic, in part because the federal government prohibited states from removing people from the program during the public health emergency once they had enrolled. The program offers health care coverage to roughly 90 million children and adults — or 1 out of every 4 Americans. Late last year, Congress told states they could start removing ineligible people in April. Millions of people are expected to lose their coverage, either because they now make too much money to qualify for Medicare or they’ve moved. Many are expected to be eligible for low-cost insurance plans through the Affordable Care Act’s private marketplace or their employer.”

Worse yet “Food help for unemployed adults, under the age of 50 and without children, will also change after the public health emergency is lifted in May. During the emergency declaration, a rule that required those individuals to work or participate in job training for 20 hours per week to remain eligible for SNAP benefits was suspended. That rule will be in place again starting in June. SNAP aid for more low-income college students will also draw down in June.” Important to note here is that it is estimated as many as 4 million Americans are out of work because they are dealing with long COVID. The unemployment rate stayed roughly the same in January 2023 as job growth continued, but this does not address discrepancies between stagnated wages and rising costs of living. Ultimately, the end of all these expanded benefits and protections now will only harm especially vulnerable populations, more than likely threatening their overall health.

Finally, the Office of Budget and Management indicated this week that “…an abrupt end to the emergency declarations would create wide-ranging chaos and uncertainty throughout the health care system — for states, for hospitals and doctors’ offices, and, most importantly, for tens of millions of Americans. During the PHE, the Medicaid program has operated under special rules to provide extra funding to states to ensure that tens of millions of vulnerable Americans kept their Medicaid coverage during a global pandemic. In December, Congress enacted an orderly wind-down of these rules to ensure that patients did not lose access to care unpredictably and that state budgets don’t face a radical cliff. If the PHE were suddenly terminated, it would sow confusion and chaos into this critical wind-down. Due to this uncertainty, tens of millions of Americans could be at risk of abruptly losing their health insurance, and states could be at risk of losing billions of dollars in funding.” If the last three years have taught us anything, it is that giving about 100 days notice for these kinds of changes is hardly helpful for those who will be the most impacted.

Of course, the end of the national emergencies does not mean the pandemic is actually over. Three years after its inaugural meeting, the International Health Regulations (2005) Emergency Committee released the report from its fourteenth meeting regarding COVID-19. While the committee and WHO Director-General Tedros Adhanom Ghebreyesus acknowledged the pandemic is likely at a transition point, the “WHO Director-General concurs with the advice offered by the Committee regarding the ongoing COVID-19 pandemic and determines that the event continues to constitute a public health emergency of international concern (PHEIC).”

Importantly, “The WHO Secretariat expressed concern about the continued virus evolution in the context of unchecked circulation of SARS-CoV-2 and the substantial decrease in Member States’ reporting of data related to COVID-19 morbidity, mortality, hospitalization and sequencing, and reiterated the importance of timely data sharing to guide the ongoing pandemic response…WHO is urging countries: to remain vigilant and continue reporting surveillance and genomic sequencing data; to recommend appropriately targeted risk-based public health and social measures (PHSM) where necessary; to vaccinate populations most at risk to minimize severe disease and deaths; and to conduct regular risk communication, answering population concerns and engaging communities to improve the understanding and implementation of countermeasures.”

Ultimately, apathy towards this ongoing emergency is driving the end of protections and needed benefits for those that need them most. The pandemic is not over, despite politicians’ interest in that being the case. No amount of political rhetoric will ever substitute making needed investments in adequately managing and preventing these kinds of public health emergencies–a lesson the United States seems destined to “re-learn” yet again.

This illustration, created at the Centers for Disease Control and Prevention (CDC), reveals ultrastructural morphology exhibited by coronaviruses. Note the spikes that adorn the outer surface of the virus, which impart the look of a corona surrounding the virion, when viewed electron microscopically. A novel coronavirus, named Severe Acute Respiratory Syndrome coronavirus 2 (SARS-CoV-2), was identified as the cause of an outbreak of respiratory illness first detected in Wuhan, China in 2019. The illness caused by this virus has been named coronavirus disease 2019 (COVID-19).| Credit: CDC PHIL

National Science Advisory Board for Biosecurity Recommends Changes in Biosecurity Oversight

The National Science Advisory Board for Biosecurity endorsed a set of draft recommendations this past week that found, among other things, that current definitions of potential pandemic pathogens (PPP) and enhanced potential pandemic pathogens (ePPP) are too narrow and over-focused on pathogens that “…are both likely “highly” transmissible and likely “highly” virulent”. Their recommendations would expand oversight to cover work considered less risky and end blanket exclusions for “research activities associated with surveillance and vaccine development or production,” among several other measures aimed at enhancing safety and transparency. The White House will decide whether or not to adopt these recommendations.

Dr. Gregory Koblentz, Biodefense Graduate Program Director, discussed these recommendations with The New York Times, saying ““If the government implements the spirit of what they’ve written, this would be a major overhaul of dual-use research oversight in the United States,”. The article also explains his argument that the White house should go beyond these recommendations and create an independent agency to perform this oversight and streamline a system he says is too fragmented.

OPCW Investigation and Identification Team Releases Third Report on Douma Attack

The Organisation for the Prohibition of Chemical Weapons released its third report from its Investigation and Identification Team investigating a chemical weapons attack that occurred on April 7, 2018, in Douma, Syrian Arab Republic. The report indicates that “Based on the holistic assessment of the large volume and wide range of evidence gathered and analysed, and on the convergence of the outcomes of such corroborated multiple analyses, the IIT concluded that, on the evening of 7 April 2018, at least one helicopter of the Syrian “Tiger Forces” Elite Unit dropped two yellow cylinders containing toxic chlorine gas on two apartment buildings in a civilian-inhabited area in Douma, killing 43 named individuals and affecting dozens more.”

Syria’s Foreign Ministry commented on the report: “The [Syrian Foreign Ministry] statement said that the report lacks scientific and objective evidence, and no sane person or specialist can reach such misleading conclusions,” Syria’s state-run SANA news agency summarized the foreign ministry as saying….”Those who prepared this report neglected the objective observations raised by State parties, experts, academics and former OPCW inspectors, known for their expertise and knowledge.”

However, as polygraph.info explains, “That is false…The OPCW reviewed over 19,000 files, obtained and assessed 66 witness statements, and considered data related to 70 samples. It also followed up on “lines of inquiry” suggested by Syria and other state parties…Adhering to “best practices,” the OPCW reached its conclusions after collecting, scrutinizing and corroborating all the available information gathered throughout the course of its nearly two-year investigation.”

US Secretary of State Antony Blinken issued a joint statement with UK Secretary of State for Foreign, Commonwealth and Development Affairs James Cleverly, French Minister of Europe and Foreign Affairs Catherine Colonna, and German Federal Foreign Minister Annalen Baerbock discussing the OPCW report:

Today, the Organization for the Prohibition of Chemical Weapons (OPCW) released a report that found the Assad regime responsible for the deadly chemical weapons attack on Douma on April 7, 2018. The report refutes the Russian claim that it was an opposition attack.

The report concludes that there are reasonable grounds to believe that, around 19:30 local time on April 7, 2018 at least one Mi-8/17 helicopter of the Syrian Arab Air Force, departing from Dumayr airbase and operating under the control of the Tiger Forces, dropped two yellow cylinders which hit two residential buildings in a central area of the city releasing chlorine killing 43 named individuals and affecting dozens more.

This report marks the ninth instance of chemical weapons use independently attributed to the Assad regime by UN and OPCW mechanisms.

Our governments condemn in the strongest terms the Syrian regime’s repeated use of these horrific weapons and remain steadfast in our demands that the Assad regime immediately comply with its obligations under the Chemical Weapons Convention (CWC) and relevant UN Security Council resolutions.  Syria must fully declare and destroy its chemical weapons program and allow the deployment of OPCW staff to its country to verify it has done so.

The report also points out that the IIT received credible information, corroborated through multiple sources, that Russian forces were co-located at Dumayr airbase alongside the Tiger Forces. The IIT also obtained information that, at the time of the attack, the airspace over Douma was exclusively controlled by the Syrian Arab Air Force and the Russian Aerospace Defence Forces.

We call on the Russian Federation to stop shielding Syria from accountability for its use of chemical weapons. No amount of disinformation from the Kremlin can hide its hand in abetting the Assad regime. In the aftermath of Syria’s chemical attack on April 7, 2018, Russian military police helped the Syrian regime obstruct OPCW access to the site of the attack and attempted to sanitize the site.  Russian and Syrian troops also staged photographs later disseminated online in an attempt to support its fabricated narratives of this incident.

We commend the independent, unbiased, and expert work of the OPCW staff, condemn the use of chemical weapons anywhere, by anyone, under any circumstances.  We also reaffirm our commitment to hold accountable the perpetrators of all chemical weapons attacks in Syria and beyond.

Dr. Gregory Koblentz, Biodefense Graduate Program Director, said of the OPCW report: “This report documents the fifth chemical attack that can be directly attributed to the Syrian air force. The chlorine attack on Douma fits a pattern of chemical weapon use by the Assad regime and was an integral part of the brutal counterinsurgency operation the Assad regime was conducting at the time. The report is based on a thorough, multidisciplinary investigation that refutes Syrian and Russian allegations that this attack was somehow staged by the rebels.   The report breaks new ground by naming the Syrian military officer responsible for conducting this attack: Brigadier General Souheil Al-Hassan, commander of the notorious Tiger Forces, which has been responsible for a series of chemical attacks and other atrocities during the Syrian civil war.”

“Pandemic Origins: Technologies, Challenges, and Policy Options to Support Investigations”

This report from the Government Accountability Office discusses the findings of the office’s technology assessment, Pandemic Origins: Technologies and Challenges for Biological Investigations and covers “(1) key technologies available for pandemic origin investigations, (2) strengths and limitations of these tools and how researchers use them to investigate pandemic origins, and (3) cross-cutting challenges researchers face in trying to determine a pandemic’s origin.” GAO identified several challenges that can inhibit determination of a pandemic’s origin, including challenges in acquiring data and the lack of a sufficient and skilled workforce. According to the report, “GAO identified five policy options that may help address the cross-cutting challenges, including proactively establishing multilateral agreements for accessing and sharing samples and genetic sequence data, taking steps to grow an interdisciplinary workforce, and developing a national strategy targeted to pandemic origin investigations. These policy options represent possible actions that policymakers—who may include Congress, federal agencies, state and local governments, academia, industry, and international organizations—could consider taking.”

Disease X: The 100 Days Mission to End Pandemics

This new book was published this week by Kate Kelland, Chief Scientific Writer at the Coalition for Epidemic Preparedness Innovations (CEPI). “Distilling insights from health security experts, examining epidemics and pandemics of the past and present, and analysing what governments, societies and their people got right and wrong in the response to COVID-19 and other devastating disease outbreaks, Kelland explores why and how viruses—tiny as they are—can wreak enormous havoc on our way of life. But she also tells a story of hope, giving readers a glimpse of a future where the threat of pandemics has been neutralised by a prepared and collaborative world.”

Governing Pandemics Snapshot Inaugural Issue

The first issue of Governing Pandemics Snapshot is available now from the Geneva Graduate Institute’s Global Health Centre. “Welcome to the inaugural issue of the Governing Pandemics Snapshot, a publication aiming to provide a concise, periodic overview on the state of efforts to strengthen global pandemic preparedness and response (PPR). This first issue looks back at 2022 and forward to 2023, examining three topics that will recur with each issue: negotiations towards a Pandemic Treaty (or instrument), amendment of the International Health Regulations; and Financing of PPR. Each issue will also cover a rotating special topic, and we begin here with Pathogen- and Benefit-Sharing (PBS). More frequent updates are available on our timeline at GoverningPandemics.org.”

“Addressing Misconceptions About Biological and Chemical Weapons and Related Legal Frameworks”

This new report from VERTIC is available now here. “The main purpose of this resource is to disprove misconceptions about biological and chemical weapons and related international instruments. It addresses misconceptions about biological and chemical weapons and related legal frameworks that VERTIC staff have identified through interactions with states over 20 years’ work on these treaties, and from other sources such as the media. Each misconception is broken down into an explanation of the misconception and its implications, and how to address it. The misconceptions are then disproved through factual and legal discussions, supported by expert commentary.”

“New Bio-Defense Strategy to Eschew ‘One Bug, One Drug’ Programs”

This piece in National Defense covers discussion of the upcoming Bio-Defense Posture Review with USAF Col. James Harwell, deputy director for chemical, biological, radiological and nuclear defense at the Joint Chiefs of Staff’s Joint Requirements Office. The article reads in part, “Gone are the days where we take long periods of time to identify an emerging threat and build a specific countermeasure to that threat. Science is moving at a pace that allows for new threats to rapidly emerge and to undermine our ability to achieve our National Defense Strategy,” Harwell said.”

“The Doomsday Clock is Ticking on Biosecurity”

In this piece for Defense One, Suzet McKinney, Asha George, and David Relman discuss the Bulletin of the Atomic Scientists’ Science and Security Board’s setting of the Doomsday Clock’s time to 90 second to midnight. They acknowledge that it was mostly moved because of the war in Ukraine, but they also write that “The impact of this war on the global order has implications far beyond the nuclear realm and the battlefield more generally. The war thwarts international cooperation exactly when we need cooperation most—to address pressing 21st-century threats such as climate change, mis- and disinformation, and a problem we and others know quite well: the proliferation of biological threats.”  

“Managing the Risks of Biotechnology Innovation”

In this workshop policy paper for the Council on Foreign Relations, Dr. Gigi Kwik Gronvall discusses the risks posed by biotechnological progress and summarizes a November CFR workshop titled “Managing the
Risks of Biotechnology Innovation.” She identifies several gaps in global governance of these risks, including misinformation and disinformation’s influence on the progress and governance of biotechnology, writing in part “Well-funded groups have undermined the development of various biotechnologies, as seen in “golden rice,” which was developed in the 1990s to combat vitamin A deficiency. However, this intervention has not been deployed due to unjustified safety concerns, and millions of children have died from vitamin A deficiency. Misinformation about GMOs, vaccines, and therapies is common, and has intensified during the COVID-19 pandemic. In addition, Russia has recently presented the presence of public health laboratories in Ukraine as cause for suspicion of misuse of biotechnologies. Sometimes institutions, newspapers, or research groups will organize to counter specific threads of misinformation and disinformation, but it is a significant, often uncompensated, obligation for those involved.”

“The Next Generation of Coronavirus Vaccines: A Graphical Guide”

“Vaccines against the coronavirus SARS-CoV-2 have been given to billions of people to protect them from COVID-19, and have saved more than 20 million lives. But viral variants can evade some of the immunity provided by the original vaccines. As a result, vaccine developers around the world are working on dozens of ‘next-generation’ COVID-19 vaccines: not just updates of the first versions, but ones that use new technologies and platforms.” Check out this graphical guide from Nature that covers the next generation of COVID-19 vaccines.

“Could a Chatbot Teach You How to Build a Dirty Bomb?”

In this piece for Outrider, Matt Korda discusses concerns brought about by chatbots like ChatGPT and OpenAI. He writes in part, “But despite being programmed to align with human values, could ChatGPT be tricked into doing harm? To answer this question, many researchers (myself included) picked up ChatGPT’s proverbial gauntlet and went to work searching for creative ways to circumvent the AI model’s safety guardrails. The results of this collective experiment were often funny and—worryingly—occasionally successful.”

What We’re Listening To 🎧

Poisons and Pestilence “14 Bonus Episode: Dirty War with Glenn Cross”

In this latest episode, Dr. Brett Edwards discusses Rhodesia’s development of a CBW program and its use during the country’s counterinsurgency in the 1970s with Dr. Glenn Cross, an alumnus of the Biodefense PhD program and author of Dirty War, a book discussing this program in-depth that is a must read.

This Podcast Will Kill You “Episode 111 RSV: What’s syncytial anyway?”

“We’re kicking off our sixth season in the same way we ended our fifth: with another headline-making respiratory virus. But as our listeners know, not all respiratory viruses are the same, and it’s often those differences among them that play the biggest role in their spread or the symptoms they cause. This episode, we’re exploring the virus that everyone has been talking about lately. No, not that one. Or that one. The other one. Yes, we’re talking about respiratory syncytial virus, or RSV. For many people, the recent surge in RSV infections that dominated headlines this winter may have been the first time they had heard of this viral infection or realized how deadly it could be. But for others, RSV has long inspired fear and dread. In this episode, we Erins explain why this virus deserves such notoriety, how long we’ve recognized the dangers of infection, and what hope the future may hold for novel RSV treatments or vaccines. If at any point you’ve wondered what all the fuss is about this virus or how to pronounce syncytial, then this is the episode for you!”

Prosperity and Human Security: Japan and Asia’s 21st Century Governance Challenges

Join Harvard’s Program on US-Japan Relations for this symposium that includes panels on “Development and Governance Challenges in Public Health” and “Development, Climate Change, and Climate Migration”. The former will feature Dr. Yanzhong Huang, Senior Fellow for Global Health at the Council on Foreign Relations, discussing “China, Covid-19, and global health governance”. This event will take place on February 6 at 12 pm EST. Learn more and register here.

Jonathan Tucker CBW Symposium

“The James Martin Center for Nonproliferation Studies cordially invites you to the 11th annual Jonathan Tucker Symposium on chemical and biological weapons issues on February 9th and 10th, 2023.” BW topics include “Revisiting the Siege of Caffa & Catapulting Cadavers” and “Governance of Dual-Use Biological Research,” the latter of which will be moderated by Dr. Gregory Koblentz. CW topics include “Lessons learned from the U.S. Chemical Weapons Destruction Program” and “The 2023 CWC Review Conference”. Learn more and register for the virtual events here.

Publication Launch Event-Strategic Trade Review: 10th Issue

Join the Strategic Trade Research Institute on February 15, at 9 am EST for this launch event moderated by Dr. Andrea Viski, a Schar School adjunct professor who teaches courses on strategic trade controls. Featured authors will engage in a virtual interactive panel discussion discussing the new edition. Learn more and register here.

Personal Protective Equipment and Personal Protective Technology Product Standardization for a Resilient Public Health Supply Chain

“The National Academies will convene a public workshop, March 1-2, to examine standards gaps related to personal protective equipment (PPE) and personal protective technology (PPT). The event will explore innovative approaches and technologies needed to update and streamline the U.S. standardization system for PPE and PPT in support of supply chain resiliency. Policymakers, manufacturers, users, and relevant technical contributors will discuss ways to improve the effectiveness, safety, supply stability, and accessibility of PPE and PPT in health care settings and increase usage by critical infrastructure workers and the general public.” Learn more and register here.

Novel Applications of Science and Technology to Address Emerging Chemical and Biological Threats

For the first time since 2019, this Gordon Research Conference is back, this time in sunny Ventura, CA. “The Chemical and Biological Defense GRC is a premier, international scientific conference focused on advancing the frontiers of science through the presentation of cutting-edge and unpublished research, prioritizing time for discussion after each talk and fostering informal interactions among scientists of all career stages. The conference program includes a diverse range of speakers and discussion leaders from institutions and organizations worldwide, concentrating on the latest developments in the field. The conference is five days long and held in a remote location to increase the sense of camaraderie and create scientific communities, with lasting collaborations and friendships. In addition to premier talks, the conference has designated time for poster sessions from individuals of all career stages, and afternoon free time and communal meals allow for informal networking opportunities with leaders in the field.” The conference will be held March 19-24, 2023. Learn more and apply here by February 19.

Weekly Trivia Question

You read the Pandora Report every week and now it’s time for you to show off what you know! The first person to send the correct answer to biodefense@gmu.edu will get a shout out in the following issue (first name last initial). For this week, our question is: In February 1964, Albert Nickel, an animal caretaker at Fort Detrick, contracted and died from a disease after he was bitten by an infected rodent. What is the name of the disease and what is its causative agent?

Shout out to Pappas G. for winning last week’s trivia! The correct answer to “On April 22, 1915, the German Army infamously unleashed more than 160 tons of chlorine gas on French trenches near which Belgian city?” is Ypres. Check out the National World War I Museum and Memorial’s page on this event.