This week’s Pandora Report covers updates on the Trump administration’s response to the West Texas measles outbreak, challenges at NIH, possible budget cuts to DOD programs focused on WMDs and pandemic preparedness, and more.
Biodefense MS Information Session
“Prospective students are invited to attend a information session to hear more about the Biodefense M.S. program offered at the Schar School. The online session will provide an overview of the program, as well as the application process, student experience and graduate outcomes. This session admissions will be led by the Graduate Admissions team.”
This sessions will take place at 12 pm EDT on March 20. Learn more and register here.
Updates on the Trump Administration
Top HHS Officials Retire and Resign
Francis S. Collins, the well-known geneticist who ran the National Institutes of Health for 12 years, announced on Saturday that he has retired from the NIH and the federal government. Collins did not provide a reason for his departure, and he has refused to do any interviews. His parting statement offered a subtle yet pointed message to the Trump administration, with Collins writing in part “As I depart N.I.H., I want to express my gratitude and love for the men and women with whom I have worked side by side for so many years. They are individuals of extraordinary intellect and integrity, selfless and hard-working, generous and compassionate. They personify excellence in every way, and they deserve the utmost respect and support of all Americans.”
Tom Corry, Assistant Secretary of Public Affairs at HHS, also abruptly resigned from the department last Friday, just two weeks after starting his new role. Corry did not provide a reason for his departure either. He previously served as a senior advisor and Director of Communications at the Centers for Medicare & Medicaid Services during the first Trump administration.
Kennedy Embraces Unconventional Remedies as Measles Outbreak Grows
As the West Texas measles outbreak grows, HHS Secretary RFK Jr. has touted several unconventional remedies while continuing to not urge all Americans to get vaccinated against the disease. In an interview, Kennedy said the federal government is shipping doses of vitamin A to Gaines County, Texas, the epicenter of the outbreak, and helping to arrange ambulance rides. He also claimed that physicians in Texas have seen “very, very good results” treating measles with budesonide, clarithromycin, and cod liver oil. This has prompted strong backlash from many in the medical community.
As of March 6, 222 cases have been reported in Alaska, California, Florida, Georgia, Kentucky, New Jersey, New Mexico, New York City, Pennsylvania, Rhode Island, Texas, and Washington. The US eliminated measles in 2000. Today, an unvaccinated adult in New Mexico has been reported dead, a little over a week after the death of an unvaccinated child in Lubbock, Texas. The Pan American Health Organization issued an epidemiological alert in response to the outbreak earlier this week.
Bhattacharya Promises “Scientific Dissent” at NIH
Jay Bhattacharya, Donald Trump’s nominee for NIH director, said on Wednesday that NIH officials “oversaw a culture of coverup, obfuscation, and a lack of tolerance for ideas that differed from theirs” in recent years. He promised to, in response to this, “establish a culture of respect for free speech in science and and scientific dissent at the agency.”
Bhattacharya infamously co-authored the Great Barrington Declaration in October 2020, which argued for allowing people at lower risk of COVID-19 complications to go about life as normal, assuming that, if infected, they would experience mild disease and contribute to herd immunity. NPR explains that, “During the COVID pandemic, Bhattacharya clashed with the mainstream medical establishment, including the NIH, over lockdowns and other measures designed to control the spread of the virus. He says he was shunned and penalized for his views and he didn’t want anyone else to suffer the same fate.”
NIH Set to Terminate Active Research Grants
The NIH has begun mass terminations of research grants funding active scientific projects that no longer meet “agency priorities”. According to Nature News, “NIH staff members have been instructed to identify and potentially cancel grants for projects studying transgender populations, gender identity, diversity, equity and inclusion (DEI) in the scientific workforce, environmental justice and any other research that might be perceived to discriminate on the basis of race or ethnicity, according to documents and an audio recording that Nature has obtained. Grants that allot funding to universities in China and those related to climate change are also under scrutiny.”
This comes after a federal court temporarily blocked the administration’s proposed cut to NIH funding for universities’ indirect costs like facilities and administration. However, as Politico points out, the administration may pivot to renegotiating the payments with individual universities.
DOD Cuts Threaten Pandemic Preparedness, WMD Proliferation Prevention, and More
DOD agencies responsible for preventing WMD proliferation and building security capacity globally are at risk of intense budget cuts or outright abolition. According to a recent draft working paper, DOD is asking all agencies and services that oversee security cooperation programs to assess potential impacts of funding realignment. The paper was prepared in response to an RFI from Secretary of Defense Pete Hegseth that asked agencies to assess consequences of four levels of staff reduction, including 25%, 50%, 75%, and 100%. The authors of the working paper, according to WIRED, “…warn that the cuts could hobble the fight against organized crime in South America, impair the battle against the Islamic State, increase the likelihood of a rogue state producing and using chemical weapons, and defund pandemic surveillance measures.”
CDC Staff Now Prohibited from Co-Authoring Papers with WHO Personnel
Scientists at the CDC are now prohibited from co-authoring publications with WHO staff, according to reporting from HuffPost. An interim guidance document obtained by the news agency explained that “CDC staff should not be co-authors on manuscripts/abstracts with WHO staff,” while also adding that CDC staff should not author publications related to work that is “funded by WHO.” The guidance further instructs CDC staff who are lead authors on such publications to either pause all action on those publications, or to recuse themselves as authors if the publication process cannot be paused. It also says that manuscripts not in compliance with Trump’s executive orders that were submitted prior to January 20 should be withdrawn, or CDC staff should recuse themselves as authors.
US Funding Cuts Threaten Global Fight Against TB
The WHO issued a warning on Wednesday explaining that severe funding cuts (namely, those in the United States) threaten decades of progress in the global fight against tuberculosis. The agency explained that essential prevention, testing, and treatment services are collapsing, leaving millions at risk. The regions most affected include Africa, Southeast Asia, and the Western Pacific, where national TB programs depend on international support.
The TB Community Coordination Hub said in a statement about the funding cuts, “[We] strongly condemn this callous, abrupt and totally one-sided act that is unprecedented, and calls upon the US Administration to take immediate measures to restore funding and support projects globally that are crucial to contain and prevent a resurgence of this deadly disease.”
In a statement on Tuesday, the CDC said it is closely monitoring the outbreak of an unknown disease that has already killed dozens in the Democratic Republic of Congo. According to WHO, at least 1,318 people have exhibited symptoms of the disease, and 60 had died from it by February 27. A new mpox variant was also recently discovered in the country. The new variant has a mutation known as APOBEC3, which indicates it may be more easily transmissible than previously identified strains.
“WHO Technical Advisory Group on the Responsible Use of the Life Sciences and Dual-Use Research: Report of the Meeting, 30 October 2024”
From WHO: “The World Health Organization (WHO) Technical Advisory Group on the Responsible Use of the Life Sciences and Dual-Use Research (TAG-RULS DUR) was established to provide independent advice to WHO on the monitoring and mitigation of biorisks, the advances in the life sciences and related technologies, the governance of dual-use research and the responsible use of the life sciences. This report summarizes the meeting that was virtually held on 30 October 2024. Over the course of the meeting, participants discussed and provided feedback on activities to operationalize the framework and delivered updates on activities of the TAG-RULS DUR’s four working groups.”
“A WHO Global Framework to Guide Investigations Into Origins of Potentially Epidemic and Pandemic Pathogens”
The Scientific Advisory Committee for the Origins of Novel Pathogens (SAGO) and WHO SAGO Secretariat recently published this comment in Nature, writing in its introduction “In outbreak situations involving a novel pathogen timely and coordinated response is crucial. The WHO Scientific Advisory Group for the Origins of Novel Pathogens recently released a global framework to guide future scientific investigations into the origin of emerging pathogens.”
“Recent Virus Research Should Raise the Alarm”
W. Ian Lipkin and Ralph Baric recently published this opinion piece in The New York Times: “There’s a central question that many scientists face: How can scientific discoveries drive humanity’s progress without posing a dire risk to it? As virus experts, we’re committed to research that uncovers pandemic threats and helps protect people from them. But we are concerned about how some scientists are experimenting with viruses in ways that could put all of us in harm’s way.”
“From Inception to Fielding: Meeting the Challenges of Medical Countermeasure Development”
Sarah M. Wiles recently published this article in CBNW: “The U.S. Joint Program Executive Office for Chemical, Biological, Radiological and Nuclear Defense has a robust development process for new CBRN medical countermeasures. Sarah M. Wiles explains the process and its rationale.”
“Automated Grading for Efficiently Evaluating the Dual-Use Biological Capabilities of Large Language Models”
Bria Persaud, Ying-Chiang Jeffrey Lee, Jordan Despanie, Helin Hernandez, Henry Alexander Bradley, Sarah L. Gebauer, Greg McKelvey, Jr. recently published this RAND Corporation working paper: “The authors of this working paper developed a proof-of-concept automated grader and used it to assess large language models’ abilities to answer knowledge-based questions and generate protocols that explain how to perform common laboratory techniques that could be used in the creation of proxies for biological threats.”
“UNIDIR Empowers Emerging Leaders in Biological Disarmament and Biosecurity”
From UNIDIR: “As the world marks the 50th anniversary of the Biological Weapons Convention (BWC), UNIDIR alongside the DiploFoundation and the Fondation pour la Recherche Stratégique celebrates the successful completion of the inaugural BWC Advanced Education Course (BWCedu). This five-month advanced training programme – funded by the UK’s Foreign, Commonwealth & Development Office – brought together 25 emerging leaders from a diverse range of States, with a focus on participants from the Global South.”
“Seven Years Since Salisbury Was Centre of Novichok Attack”
Isabella Holliday recently authored this news article about the anniversary of the Novichok attack targeting the Skripals in Salisbury, UK. Read it in the Salisbury Journal here.
“Syria’s Caretaker Foreign Minister Addresses OPCW’s Executive Council”
From OPCW: “In a landmark visit to OPCW’s Headquarters in The Hague, caretaker Foreign Minister al-Shaibani reaffirmed the commitment of the new Syrian authorities to cooperate with the OPCW to eliminate the chemical weapons programme of the former Syrian regime”.
ICYMI: The Cost of Defunding PEPFAR and the Impact on the Fight Against HIV/AIDS
Brown’s Pandemic Center hosted this webinar in late February. Watch the recording here. Key topics included:
“Call for Action – How policymakers, philanthropists, and institutions can mobilize to address these urgent gaps.”
“PEPFAR Changes & Uncertainty – Concerns about funding gaps, particularly affecting pediatric HIV treatment, maternal health, and job losses in healthcare.”
“Impact on South Africa & Beyond – The success of PEPFAR in South Africa and the potential consequences of its reduction, including rising HIV cases and strain on health systems.”
“Future of Global Health Funding – Exploring alternative funding sources, the role of UNICEF, private sector involvement, and the need for governments to step up.”
NEW: Building Trust in the H5N1 Response: Perspectives from the Field
From NASEM: “Since avian influenza (H5N1) was first detected in dairy cattle in March 2024, H5N1 has resulted in human infections, diminished livestock production, and decimated wildlife populations. Uncoordinated policies at the national, state, and local levels have challenged mitigation efforts, and mistrust has hindered the urgent response needed for the rapidly evolving threat. The National Academies Forum on Microbial Threats will host a public webinar on March 27 where agricultural producers and workforce health specialists will explore strategies to build greater mutual trust and a coordinated One Health response.”
This webinar will take place on March 27 at 2 pm ET. Register here.
2025 Scowcroft Institute Pandemic Policy Summit
From the Scowcroft Institute: “The Scowcroft Institute of International Affairs at Texas A&M University invites you to attend the 2025 Scowcroft Institute Pandemic Policy Summit examining the ongoing H5N1 outbreak across the U.S. Dairy industry. This summit will bring together experts from government, academia, and industry to review the response efforts, discuss current challenges and opportunities, and identify options for moving forward. Listen to panels of subject matter experts, explore case studies from the field, and participate in networking opportunities.”
This event will take place on March 18 in Washington, DC. Learn more and RSVP here.
Sustainable Manufacturing: Building and Preserving a Resilient Medical Industrial Base
“Join industry and government partners for our second annual industry summit! During this event, leaders from IBMSC will share our strategic vision and organizational priorities. Speakers will also share potential opportunities for building and preserving the medical industrial base. This event will be in-person only and space is limited!”
This event will take place March 11-12 in Washington, DC. Learn more and register here.
Gaming Weapons of Mass Destruction Course – From Policy to Practice
From MORS: “Gaming Weapons of Mass Destruction (WMD – defined as Nuclear, Chemical, and Biological agents) will be a three-day course focused on developing and executing games related to WMD in all its forms. While the basics of WMD capabilities and game design will be discussed, this will be a course focused on the intersection of WMD and gaming. It will not be either a WMD or gaming course; for those topics see other offerings.”
“No prior experience is required for this course, though a basic familiarity with various agents and their effects would be helpful, as would a basic understanding of professional gaming and how it is used. The instructors will adapt in real time to class requirements (e.g., if the class is interested in animal and plant targets, the instructors have extensive experience in designing games on those subjects as well).”
This course will take place March 18-20 on Zoom. Learn more and register here.
NEW: Apply for the 2025 Youth for Biosecurity Fellowship
“The global norm against biological weapons cannot be maintained without the inclusion of youth voices in the multilateral discussions taking place in the framework of the Biological Weapons Convention (BWC). Youth perspectives are key to create innovative solutions and generate long-term engagement. There are benefits to including the perspectives of young people from developing countries, where over 90% of the world’s youth reside.”
“Organized by the United Nations Office for Disarmament Affairs in Geneva, in partnership with key international actors that empower youth in science diplomacy and global biosecurity, the Youth for Biosecurity Fellowship provides a unique learning and networking experience in the framework of the Biological Weapons Convention.”
“Launched in 2019 as a Biosecurity Diplomacy Workshop, the Youth for Biosecurity Initiative organized its first fellowship in 2023. For the third edition, the fellowship will provide the opportunity for 20 competitively selected young scientists from the Global South to join an online interactive training programme prior to a field visit during the meeting of the BWC Working Group on the Strengthening of the Convention in Geneva.”
NOFO, Addressing Agricultural Biorisk Evidence Base Gaps with Applied Research “There is a global recognition that the current evidence base to inform laboratory biological risk management has gaps, and that biosafety and biosecurity policies are not always based on evidence.1This notice of funding will support the design and implementation of applied biorisk research to address evidence gaps in working with high-consequence veterinary and agricultural pathogens as identified during the RAV3N Biorisk and Biosafety Gap Assessment Workshop2 or similar gap analysis like the WOAH working group agent specific biorisk gap analysis.1 ERGP is seeking proposals that address one or more key focus area components listed below. Each proposal will go through an internal ERGP and external expert review. Successful proposals should address at least one of the three key focus areas and at least one component under that area.”
“This funding opportunity aims at the design and implementation of applied biorisk research to address evidence gaps in working with high-consequence veterinary and agricultural pathogens.”
“This work will contribute to recommended guidance on laboratory biosafety and agricultural biosecurity, using research techniques to evaluate the application and effectiveness in operational contexts. All proposals must make a clear experimental plan for how the applicant will test the application and outcomes of their focus area(s)/component(s) in their facility.”
Learn more and submit application by April 14here.
This week’s Pandora Report covers the rush to find the former Assad regime’s hidden chemical weapons, a recent study on H5N1’s potential to become an efficient human pathogen, Nobel laureates’ call for the Senate to block RFK Jr. from becoming HHS Secretary, and more.
Assad Regime Falls
On Sunday, Syrian rebels continued their advance, taking the capital city of Damascus and forcing the country’s long-time leader, President Bashar al-Assad, to flee to Moscow. This ended the country’s 13-year-long civil war and toppled a brutal dictatorship known to have, among other things, used chemical weapons against its own civilians. Now, the country is strapped for cash and being led by opposition forces with limited experience in governance.
Adding to the chaos is the mad dash to locate the former Assad regime’s chemical weapons it hid from inspectors. Among the list of missing weapons are more than 360 tons of mustard gas that the Assad regime admitted to making, but never fully accounted for. There are also five missing tons of precursors for sarin that the Assad regime claimed were “Lost during transportation, due to traffic accidents.”
The OPCW said it is monitoring the situation, reaffirming its commitment to “clarifying gaps, discrepancies, and inconsistencies in Syrian chemical weapons declaration amidst political transition.” Rebels in the south of the country have reached out to the OPCW for support in safely disposing of a cache of CW they found. One US official told the press the US is working with other countries in the Middle East to prevent these weapons from falling into the wrong hands. Meanwhile, Israel reported that it has destroyed CW and other weapons caches while seizing areas along its shared border with the country it claims are part of a demilitarized buffer zone.
New Study Finds Single Mutation in Bovine Influenza H5N1 Hemagglutinin Switches Specificity to Human Receptors
A recent study in Science found that a single glutamine to leucine mutation in clade 2.3.4.4b-an H5N1 virus widespread in US dairy cattle that has caused a few mild human cases-at residue 226 of the virus hemagglutinin “was sufficient to enact the change from avian to human specificity.” This means that this virus that currently cannot infect humans very easily could be just one mutation away from being able to do so much more effectively. This finding alone does not mean that this mutation in nature would be guaranteed to make this virus an efficient human pathogen, but it might mean that this version of the virus has a higher zoonotic potential than other H5N1 viruses.
Investigation Launched into Queensland Lab Incident
An investigation has been launched by Australian authorities into the “major breach” of biosafety protocols that occurred at a state-run laboratory in Queensland in 2021. It was revealed that 323 virus samples-nearly 100 of which were live samples of Hendra virus-were missing. According to Health Minister Tim Nicholls, the incident was only discovered in August of 2023, and the lab is unable to confirm whether the materials were removed or destroyed, though there is no suggestion that they were taken or stolen from the lab.
Top Wuhan Virologist Says WIV Holds No Close Relatives to SARS-CoV-2
Shi Zhengli, the virologist leading coronavirus research at the Wuhan Institute of Virology (WIV) when the COVID-19 pandemic began, presented data on dozens of new coronaviruses collected from bats in southern China at a conference in Japan last week. Shi has said repeatedly that SARS-CoV-2 was never seen nor studied in her lab, but some have continued to insist that one of the bat coronaviruses collected by her team was closely related to it. As a result, Shi promised to sequence the genomes of the viruses stored in her freezers and release the resulting data.
The analysis presented at the conference has not been peer reviewed and includes data from the whole genomes of 56 new betacoronaviruses in addition to some partial sequences. All of these viruses were collected between 2004 and 2021. Shi explained at the conference that none of the viruses she has sequenced are the most recent ancestors of SARS-CoV-2 and that “We didn’t find any new sequences which are more closely related to SARS-CoV-1 and SARS-CoV-2.”
The known viruses that are closest to SARS-CoV-2 were found in bats in Laos and southern China. However, years (or decades) have passed since these viruses split from their common ancestor with SARS-CoV-2. Shi has long since collaborated with EcoHealth Alliance, which previously received US federal funding that was suspended because of inadequate oversight of research activities at the WIV. This collaboration has produced a larger analysis of more than 230 sequences that EcoHealth Alliance’s Peter Daszak says will be submitted for peer review and publication in the coming weeks.
75+ Nobel Laureates Urge Senate Not to Confirm RFK Jr.
77 winners of the Nobel Prize in Medicine, Chemistry, Physics, and Economics have signed a letter (below) urging the Senate not to confirm President-Elect Trump’s pick to lead HHS-Robert F. Kennedy Jr.. This is a rare example of Nobel laureates coming together against a US Cabinet choice, according to Sir Richard Roberts, winner of the 1993 Nobel Prize in Medicine and a drafter of the letter. The letter criticizes Kennedy’s lack of experience in public health in addition to his widely criticized opinions on topics like drinking water fluoridation and vaccines for measles and polio. The letter reads in part, “In view of his record, placing Mr. Kennedy in charge of DHHS would put the public’s health in jeopardy and undermine America’s global leadership in the health sciences, in both the public and commercial sectors…We strongly urge you to vote against the confirmation of his appointment as Secretary of the DHHS.”
Biodefense MS Student Lena Kropke discusses her experience at the 67th Annual Biosafety and Biosecurity Conference in this Pandora Report event summary, writing in part “Attending this conference not only reaffirmed that biosafety and biosecurity are vital components of international security, but also showcased the incredible dedication of professionals who work tirelessly toward this mission. Moreover, it offered an introduction to an amazing network of biosafety and security professionals.”
Read more about Lena’s time attending the conference in Phoenix here.
“Disincentivizing Bioweapons: Theory and Policy Approaches”
This NTI essay collection is “…designed to encourage the exploration and identification of potential solutions to disincentivize states from developing or using biological weapons,” and aims to “bridge theory and practical policy-relevant approaches to develop new approaches to invigorate international efforts to reduce biological threats.” Its fifth essay, “Two Competing Bioweapons Nonproliferation Policies: Deterrence by Denial and Discussion,” was authored by Sonia Ben Ouagrham-Gormley, Associate Professor at the Schar School.
Mitigating Arboviral Threat and Strengthening Public Health Preparedness: Proceedings of a Workshop
From NASEM: “Arboviruses, or viruses carried by arthropods like mosquitoes or ticks, are responsible for hundreds of thousands of deaths worldwide each year. As the climate changes globally, the geographic distribution of these diseases, including Zika, dengue, chikungunya, West Nile, and yellow fever, are steadily expanding. The National Academies Forum on Microbial Threats hosted a public workshop in December 2023 to explore avenues of threat reduction from known and emerging arboviral diseases in the context of public health preparedness and capacity building. The workshop featured talks from experts in entomology, public health, ecology, virology, immunology, disease modeling, and urban planning.”
Read this Proceedings of a Workshop for free here.
“The Current Pathogenicity and Potential Risk Assessment of Nipah Virus as Potential Cause of “Disease X”: A Narrative Review”
Mehnaz et al. recently published this article in Health Science Reports: “Background and Aims…The World Health Organization (WHO) recognized the potential for a severe international epidemic and introduced the term “Disease X” to classify pathogens that not yet identified. The Nipah virus (NiV) is highly dangerous due to its zoonotic nature, high mortality rate, and ability to cause severe clinical symptoms in humans. In this review, we gather the latest information on the NiV and its potential to become a significant candidate for Disease X.”
“Methods…We performed a thorough review of articles published in PubMed, Scopus, and Google Scholar using appropriate MeSH terms and keywords. Studies reported NiV infection were considered for this review.”
“Results…The NiV exhibits different epidemiological patterns in different countries that calls for customized prevention and control strategies. Genetic analysis highlights NiV’s ability to mutate that alters possible treatment options. Transmission typically involves bats as the primary reservoir, with humans becoming infected either through intermediate hosts or food. This shows NiV’s complex nature, including its ability to reach the central nervous system through the olfactory nerve. Promising treatment options, such as monoclonal antibodies, antivirals, and ongoing vaccine research, provide hope. However, the virus’s adaptability, human-to-human transmission, and the lack of specific antiviral therapy raise concerns about its potential to cause a global pandemic. The interconnection between animals, humans, and the environment stresses the need for a One Health approach to tackle emerging infectious disease by NiV.”
“Conclusion…Global collaboration, surveillance, and research investments are imperative for the preparation of future pandemics. The ongoing COVID-19 challenges underscoring the critical need for sustained scientific endeavors, global leadership, and recognition of the prominence of NiV as a candidate for the potential Disease X.”
“Engineering Biology Public Trust Survey Findings”
From the UK’s Department for Science, Innovation and Technology, these findings are the result of a survey on public perceptions of engineering biology in relation to five application areas: health, agriculture and food, low carbon fuels, chemicals and materials, and waste and environment. Key findings from this survey include “The majority of respondents felt comfortable with using new and emerging technologies on a day-to-day basis, but relatively few could explain what engineering biology is,” “There was a strong belief amongst respondents that applications of engineering biology could be useful. Similarly, the majority were comfortable with each of the specific applications and believe that they will be positive for society,” “There was broad agreement that the government is well placed to make decisions about the use of engineering biology but the public should also be involved in decision making,” and more.
“CSR Biodefense Scorecard: Winter 2024 Update”
From the Council on Strategic Risks: “In the fall of 2023, we kicked off our Biodefense Scorecard series to help inform the public on the progress and implementation status of past CSR recommendations on reducing biological risks. This update captures several areas of sustained positive action across pathogen early warning, diplomacy, and biomanufacturing.”
“Ignoring the Real Biowarfare Threat”
David Heslop and Joel Keep discuss the potential implications of recent renovations at Sergiev Posad-6 in this piece from the Lowy Institute, writing in part “While much attention has been paid to nuclear arms, Washington and Moscow must also address biological weapons, which both nations claimed to renounce many years ago. The fate of such programs is not only a matter for Russia and the United States, but for global health security at large.”
“Instrumentalising Biological Weapons-Related Allegations: Russia’s Compliance Politics and the Norms Against Biological Weapons”
Una Jakob recently published this working paper with CBWNet discussing Russia’s use of BWC compliance procedures and their effect on norms against BW. Jakob explains in part of the paper’s executive summary, “Seen in this light, the Russian activities may counterintuitively have contributed to strengthening the norms against biological weapons at the discursive level, as no actor has called them into question and as their validity has been reaffirmed repeatedly in the process, including by Russia itself. This stands in contrast, however, to Russia’s policy which may contest biological weapons norms at the action level. This discrepancy between the discursive and practical level and its implications for norm strength merit further theoretical attention. On a policy level, it will be important to increase transparency, counter disinformation, and strengthen the means to demonstrate, verify and enhance confidence in compliance with the BWC. This would also strengthen the possibilities to address biological weapons-related allegations, including those made in bad faith, and help sustain the norms against biological weapons comprehensively and in the long term.”
“Workshop on S&T Developments with Relevance for the CWC and BWC”
Anna Krin and Gunnar Jeremias edited this CBWNet working paper detailing a workshop hosted in June at Hamburg University focused on challenges and opportunities facing biological and chemical arms control. Jeremias explains in the introduction, “Throughout the workshop, four panels delved into key topics: the general concept and application of scientific and technological advice in arms control in general and particularly in chemical and biological arms control; current developments in science and technology that may necessitate attention; potential frameworks for organizing verification under the CWC and the prospects for institution building for S&T advice and verification within the BWC; and the technologies and governance methods that could be employed to enhance the efficacy of arms control measures…The insights gathered during these discussions aim to contribute to the ongoing discourse on arms control, ensuring that both the BWC and CWC remain vital in a landscape marked by rapid scientific change. This compendium encapsulates the collaborative efforts and perspectives of workshop participants, reflecting a shared commitment to advancing arms control in an increasingly complex world.”
“High-Impact, Low-Probability: NATO-EUROPOL Cooperation in Countering the CBRN Terrorist Threat to Europe”
This JCBRN Defence COE report by Mathias Katsuya “…draws on secondary-source research and insights provided by JCBRN Defence COE personnel as well as Europol’s CBRN-E Team Leader. An initial threat assessment is followed by a review of Europol’s CBRN capabilities, centring on the role of its European Counter-Terrorism Centre and inhouse CBRN-E Team as key nodes in law enforcement information-sharing, capacity-building, and operational coordination. Having identified key doctrinal and capability overlaps with NATO in addition to a stated commitment by Europol’s CBRN-E Team to enhance its civil-military relations, the report outlines a three-pillar approach to deepening connections between NATO and Europol: short-term measures to foster staff-level contacts in both organisations, a formalised relationship between Europol’s CBRN-E Team and NATO’s JCBRN Defence COE, and deeper institutional linkages to effectively confront current and emerging CBRN threats.”
“Hybrid Threats in the CBRN Environment: Challenges and Implications”
This JCBRN Defence COE paper by Paulina Frederike Gogacz discusses hybrid CBRN threats and their use by actors like Russia. Gogacz explains in the paper’s summary that “An analysis of the six strategic enablers outlined in NATO’s Chemical, Biological, Radiological and Nuclear (CBRN) Defence Policy (2022) indicates important steps to ameliorate current defences and prepare NATO and its member states for future hybrid CBRN threats, thereby increasing overall resilience. They include important aspects: robust intelligence-sharing mechanisms to ensure timely and accurate threat information; comprehensive exercises to simulate and prepare for various CBRN scenarios; strong partnerships both within the alliance and with external entities to foster cooperation and resource sharing; effective strategic communication to manage information and public perception; collaborative scientific research to advance technological capabilities and countermeasures; and the resilience of medical infrastructure to ensure a rapid and effective response to CBRN incidents. These steps collectively aim to bolster NATO’s preparedness and adaptability in the face of evolving hybrid CBRN threats.”
“Securing a Strategic Advantage in Biosecurity for NATO”
Max Breet and Lauren Ross recently authored this commentary for RUSI, writing in their summary “NATO should recognise the importance of biosecurity by understanding it as a new domain. This would allow the Alliance to more effectively leverage existing structures to defend itself against hybrid biological threats.”
“The Rise of Mpox in a Post-Smallpox World”
McQuiston et al. recently published this article in Emerging Infectious Diseases: “Reports of mpox are rising in Africa where the disease is endemic and in new countries where the disease has not been previously seen. The 2022 global outbreak of clade II mpox and an ongoing outbreak of the more lethal clade I mpox highlight the pandemic potential for monkeypox virus. Waning population immunity after the cessation of routine immunization for smallpox plays a key role in the changing epidemiologic patterns of mpox. Sustained human-to-human transmission of mpox is occurring widely in the context of insufficient population immunity, fueling genetic mutations that affect the accuracy of some diagnostic tests and that could lead to changing virulence. Additional research should address complex challenges for control of mpox, including improved diagnostics and medical countermeasures. The availability of vaccines should be expanded not only for outbreak response but also for broader routine use for persons in mpox-endemic countries.”
“Confronting Risks of Mirror Life”
Adamala et al. recently published this Science Policy Forum piece, writing in part, “All known life is homochiral. DNA and RNA are made from “right-handed” nucleotides, and proteins are made from “left-handed” amino acids. Driven by curiosity and plausible applications, some researchers had begun work toward creating lifeforms composed entirely of mirror-image biological molecules. Such mirror organisms would constitute a radical departure from known life, and their creation warrants careful consideration. The capability to create mirror life is likely at least a decade away and would require large investments and major technical advances; we thus have an opportunity to consider and preempt risks before they are realized. Here, we draw on an in-depth analysis of current technical barriers, how they might be eroded by technological progress, and what we deem to be unprecedented and largely overlooked risks (1). We call for broader discussion among the global research community, policy-makers, research funders, industry, civil society, and the public to chart an appropriate path forward.”
Bonus: Read Carl Zimmer’s discussion of this warning in The New York Times here.
NEW: OneLab Network Webinar
“Clinical laboratories must be alert for unusual and potentially infectious agents and immediately notify their Laboratory Response Network (LRN) reference laboratory if routine diagnostic testing results in the potential identification of rare and unusual infectious agents that may be used in a bioterrorist attack or other bio-agent incident. This webinar will describe the LRN and highlight the clinical laboratory’s role and responsibilities in initiating contact with their LRN. Join us as we share an example of a response, new tools, and valuable resources to aid in the clinical laboratory’s response.”
This event will take place on December 17 at 12 pm ET. Register for this event here.
NEW:Understanding the Introduction of Pathogens into Humans- Preventing Patient Zero: A Workshop
“The past few decades have seen the emergence of several diseases with drastic public health and economic consequences. Understanding routes of pathogen emergence and transmission is critical to preventing and mitigating disease spillover and amplification. The National Academies Forum on Microbial Threats will host a hybrid public workshop to address gaps in understanding of disease emergence, with a focus on human-animal interaction and laboratory biosafety. The workshop will explore how applications of existing policy structures, emerging technologies, and actionable research can improve biosecurity measures and prevention of future disease emergence.”
This event will take place on January 15 and 16. Learn more and register here.
NEW: Rise of the Zombie Bugs: The Surprising Science of Parasitic Mind-Control
Johns Hopkins APL’s colloquium will feature Mindy Weisberger, author of the upcoming book Rise of the Zombie Bugs: The Surprising Science of Parasitic Mind-Control: “Zombies are all around us—insect zombies, that is. In Rise of the Zombie Bugs, Mindy Weisberger explores the eerie yet fascinating phenomenon of real-life zombification in the insect class and among other invertebrates. Zombifying parasites reproduce by rewriting their victims’ neurochemistry, transforming them into the “walking dead”: armies of cicadas, spiders, and other hosts that helplessly follow a zombifier’s commands, living only to serve the parasite’s needs until death’s sweet release (and often beyond).”
From the Asia Centre for Health Security: “Studying viruses that could potentially cause outbreaks is one of the most effective ways to reduce the risk of pandemics. However, this type of research—especially when it involves collecting samples from the field and manipulating pathogens—can unintentionally lead to a pandemic if not managed carefully. Dr Lentzos will discuss her findings from the Pathogen Project, which brought together an international taskforce of scientists, biosecurity and public health experts, ethicists, and civil society leaders to seek consensus on this question: Can we agree on ways to manage research that carries pandemic risk as safely, securely and responsibly as possible?”
This event will take place on January 23 at 8 pm (GMT +8:00) via Zoom. RSVP here.
Preparedness in Rural Communities: National and State/Local Perspectives and Plans
From Penn State: “The COVID-19 pandemic and recent hurricanes have thrust the preparedness of rural communities into the national spotlight. At the federal level, the Administration for Strategic Preparedness and Response and the Centers for Disease Control and Prevention have recently released national goals and plans for preparedness of rural communities. The overall objective of this virtual, 2-day mini-symposium is to identify opportunities in public health and agricultural preparedness and response in rural communities. The mini-symposium will focus upon national perspectives on Thursday, January 30 and the state/local perspectives on Friday, January 31. Speakers include representatives of the Administration for Strategic Preparedness and Response, the Department of Homeland Security, US Department of Agriculture, the USA Center for Rural Public Health Preparedness, and state/local leaders.”
This event will take place on January 30 and 31, from 11 am to 2 pm ET each day. Learn more and register here.
Cyberbiosecurity Summit
From Johns Hopkins APL and Bio-ISAC: “Advancements in biomanufacturing and biotechnology drive the science we need to thrive, everything from apples to vaccines. The Cyberbiosecurity Summit 2025 convenes leading experts in biotechnology, biosecurity, and cybersecurity to explore the intersection of these fields and discuss the strategies to create a safe, secure future for us all.” This event will take place February 25-26 in Laurel, MD. Register here and review the call for sessions here (closes 12/12).
NEW: The Independent Panel Solicits Views and Insights on Pandemic Prevention, and Response Efforts
“The Independent Panel for Pandemic Preparedness and Response, co-chaired by HE Ellen Johnson Sirleaf and RH Helen Clark, welcomes you to share your insights and expertise on the status of international and regional pandemic-related reform processes and initiatives, and how progress can be continued and accelerated in the months and years ahead.”
Learn more about this survey and submit by December 20here.
This week’s edition of the Pandora Report covers news from the Biodefense Graduate Program, HHS’ announcement to cut federal funding to the EcoHealth Alliance, and more.
Biodefense Program Receives Gift from the CBRNE Industry Group
For the second year, the Schar School of Policy and Government at George Mason University received a generous gift from the CBRNE Industry Group, an association of organizations supporting chemical, biological, radiological, nuclear, and explosive defenses, to support the Biodefense Graduate Program. Program director Dr. Gregory Koblentz accepted the award on behalf of the Schar School and Biodefense Program at the CBRNE Industry Group’s annual dinner on May 15. The dinner’s keynote speaker was Rebecca Hersman, director of the Defense Threat Reduction Agency (DTRA).
Congratulations to Graduating Biodefense Students
Congratulations to the newly minted MS in Biodefense students who graduated from the Schar School this week: Abigail Danfora, Theresa Hoang, Emily Johnson, John Kisko, Nick Marko, Geoff Mattoon, Jack Moore, Miranda Nastasi, Brittany Novak, Olivia Parker, Max Towers and Jacob Wellerman. A special congratulations to Nick Marko for receiving the Outstanding Biodefense MS Student Award for his exemplary scholarship and to Olivia Parker for receiving the Frances Harbour Award in recognition of her community leadership in the Biodefense Program.
Program Director Dr. Gregory Koblentz and Dr. Nick Marko who received the Outstanding Biodefense MS Student AwardProgram Director Dr. Gregory Koblentz with graduating Biodefense students (some of whom are showing off their coveted Biodefense syringe pens)Graduation cap decorated by Biodefense student
Biden Administration Moves to Ban Funding for EcoHealth Alliance
Following a tense Congressional hearing and the release of a highly critical select subcommittee interim report earlier this month, the Department of Health and Human Services announced in a letter on Wednesday that it is moving forward with debarment proceedings and implementing a government-wide suspension of federal funding for EcoHealth Alliance. This includes active grants, three of which totaled $2.6 million in NIH funding for EcoHealth Alliance last year. The NIH cited multiple failures on the part of the organization that it first reported three years ago, including EcoHealth’s failure to “promptly report findings from studies on how well bat coronaviruses grow in mice…”
House Select Subcommittee on the Coronavirus Pandemic Chairman Brad Wenstrup (R-OH) said in a statement about the announcement, ‘“EcoHealth Alliance and Dr. Peter Daszak should never again receive a single penny from the U.S. taxpayer. Only two weeks after the Select Subcommittee released an extensive report detailing EcoHealth’s wrongdoing and recommending the formal debarment of EcoHealth and its president, HHS has begun efforts to cut off all U.S. funding to this corrupt organization. EcoHealth facilitated gain-of-function research in Wuhan, China without proper oversight, willingly violated multiple requirements of its multimillion-dollar National Institutes of Health grant, and apparently made false statements to the NIH. These actions are wholly abhorrent, indefensible, and must be addressed with swift action. EcoHealth’s immediate funding suspension and future debarment is not only a victory for the U.S. taxpayer, but also for American national security and the safety of citizens worldwide.”
‘“The Select Subcommittee’s investigation into EcoHealth and the origins of COVID-19 is far from over. Dr. Daszak and his team are still required to produce all outstanding documents and answer the Select Subcommittee’s questions, specifically related to Dr. Daszak’s potential dishonesty under oath. We will hold EcoHealth accountable for any waste, fraud, and abuse and are committed to uncovering any illegal activity, including lying to Congress, NIH, or the Inspector General,” he continued.
EcoHealth Alliance said in a statement that it “is disappointed by HHS’[s] decision today and we will be contesting the proposed debarment. We disagree strongly with the decision and will present evidence to refute each of these allegations and to show that NIH’s continued support of EcoHealth Alliance is in the public interest.”
“China and Medical AI: Implications of Big Biodata for the Bioeconomy”
Caroline Schuerger, Vikram Venkatram, and Katherine Quinn recently published this CSET Issue Brief: “China supports medical artificial intelligence development to achieve bioeconomy leadership. Countries that strategically prioritize medical AI could benefit from an economic advantage and set global norms for future developments. Our new report examines China’s stated goals for medical AI, which range from the collection and protection of vast amounts of biodata, to facilitating research and development, to supporting medical AI commercialization. China’s comprehensive actions to prioritize medical AI development have major implications for U.S. economic and technological competitiveness.”
“China’s Industrial Clusters: Building AI-Driven Bio-Discovery Capacity”
Anna Puglisi and Daniel Chou recently authored this CSET Data Brief: “China is banking on applying AI to biotechnology research in order to transform itself into a “biotech superpower.” In pursuit of that goal, it has emphasized bringing together different aspects of the development cycle to foster multidisciplinary research. This data brief examines the emerging trend of co-location of AI and biotechnology researchers and explores the potential impact it will have on this growing field.”
“China’s Hybrid Economy: What to Do About BGI?”
Anna Puglisi tackles China’s industrial policy and BGI (formerly Beijing Genomics Institute) in this CSET blog post: “As the U.S. government considers banning genomics companies from China in the Biosecure Act, it opens a broader question of how the U.S. and other market economies should deal with China’s national champions. This blog post provides an overview of BGI and how China’s industrial policy impacts technology development.”
“Science and Technology Advisory Mechanism for the Biological Weapons Convention, A Proof-of-Concept Exercise”
“The meeting, convened under the auspices of IAP and in coordination with the US National Academies of Sciences, Engineering, and Medicine (NASEM), brought together 38 technical experts from 32 countries. Their deliberations focused on the potential impact of Artificial Intelligence (AI) on global biosecurity and international cooperation within the framework of the BWC. Participants stressed the need for a continuous review process to monitor AI trends, especially its implications for biology relevant to the BWC. The report serves as the report of a putative Science Advisor to the BWC, summing up the expert deliberations from the proof of concept meeting.”
“The release of “Science and Technology Advisory Mechanism for the Biological Weapons Convention, A Proof-of-Concept Exercise”, deriving from the proof of concept meeting, marks a key moment in the journey towards establishing a scientific advisory body for the BWC.”
“USDA, FDA Turf Battles Hamper Responses to Outbreaks Like H5N1 Bird Flu”
Rachel Cohrs Zhang, Lizzy Lawrence, and Nicholas Florko discuss federal agencies’ turf battles in this STAT News piece that includes information derived from interviews with more than 20 former federal officials. They explain in part, “Because H5N1 is currently an animal disease, it’s clearly the USDA’s responsibility to test cattle and get a handle on the outbreak. But already, public health experts are concerned that the scope of that agency’s testing regime is too limited. The department is requiring farmers test only lactating cows before moving them across state lines.”
‘“There needs to be a better understanding of the scope and scale of the problem,” said Stephen Ostroff, a former deputy commissioner in charge of food safety at the FDA. “This seems like it’s not necessarily going to be able to identify problems that could occur within a state.”’
“As Bird Flu Looms, the Lessons of Past Pandemics Take On New Urgency”
John M. Barry discusses lessons learned from the 1918 flu pandemic and other pandemics and their significance as bird flu continues to spread in this New York Times opinion piece. He writes in part, “While much would still have to happen for this virus to ignite another human pandemic, these events provide another reason — as if one were needed — for governments and public health authorities to prepare for the next pandemic. As they do, they must be cautious about the lessons they might think Covid-19 left behind. We need to be prepared to fight the next war, not the last one…Two assumptions based on our Covid experience would be especially dangerous and could cause tremendous damage, even if policymakers realized their mistake and adjusted quickly.”
“Rise of Drug-Resistant Superbugs Could Make COVID Pandemic Look ‘Minor’, Expert Warns”
This piece from The Guardian discusses warnings from Prof Dame Sally Davies, England’s former chief medical officer and the UK’s current special envoy on AMR. It explains, “She paints a bleak picture of what could happen if the world fails to tackle the problem within the next decade, warning that the issue is “more acute” than climate change. Drug-resistant infections already kill at least 1.2 million people a year…“It looks like a lot of people with untreatable infections, and we would have to move to isolating people who were untreatable in order not to infect their families and communities. So it’s a really disastrous picture. It would make some of Covid look minor,” said Davies, who is also the first female master of Trinity College, Cambridge.”
“Dissecting Pandemic-Prone Viral Families, Volume 4: The Pneumoviridae”
This document by Amesh A. Adalja for Johns Hopkins Center for Health Security covers the pandemic threats posed by the Pneumoviridae family: “The Pneumoviridae viral family, formerly a subfamily of Paramyxoviridae, consists of 2 genera: Orthopneumovirus, the members of which infect mammals, and Metapneumovirus, which are specific for either mammals or birds.”
“Pneumoviridae poses a largely underappreciated pandemic threat. Only 2 known viral family members infect humans: human respiratory syncytial virus (HRSV, commonly RSV) and human metapneumovirus (HMPV).1 These 2 endemic respiratory viruses confer substantial morbidity and mortality on the human species, particularly among older adults and young children and across different sociodemographic strata.2 If a zoonotic or yet undiscovered viral family member acquired the ability to efficiently infect humans, it could spread prolifically, especially when faced with little immunity”
“Remarks by Dr. Liz Sherwood-Randall Assistant to the President for Homeland Security on Countering Bioterrorism in an Era of Technology Convergence”
Read Liz Sherwood-Randall’s remarks at the Ash Carter Exchange that focus on preventing bioterrorism and threats posed by rapidly advancing biotechnologies. She said in part, “And this frame of “preventive defense” – which identifies what we can do now to prevent far more pernicious threats from emerging in the future – is a guiding principle for me as we face the emergence of a whole new category of “A list” threats at the intersection of biology, engineering, and artificial intelligence.”
“Given my current duties as the President’s Homeland Security Advisor, this is a major concern because of the very real prospect that these technologies – which are largely out “in the wild” rather than controlled by governments – could be accessed and weaponized by terrorists with potentially catastrophic effects.”
“So, I chose to talk with you here today about what we can do to counter biological terrorism and other malicious uses of advances in biotechnology in this era of rapid technology convergence.”
“Getting Down to Science”
This USDA post by Stephanie Jacques discusses the work starting to take shape at the new National Bio and Agro-Defense Facility (NBAF). She writes in part “Science at NBAF is starting in phases. This phased process began with low-risk, common science practices that don’t involve infectious pathogens and is moving to more advanced or mission-focused science in later phases. As NBAF is ramping up science operations in Manhattan, Kansas, its predecessor — the Plum Island Animal Disease Center in New York — will continue protecting American agriculture until NBAF is ready to assume the center’s full mission.”
“Trumping Pandemic Preparedness”
Chelsea Cirruzzo and Ben Leonard recently published this piece in Politico that discusses former President Trump’s promise that, if re-elected, he will abolish the White House’s Office of Pandemic Preparedness and Response Policy. While they explain that he can not entirely get rid of the office on his own, they cover three ways he could undermine the office, including not appointing anyone to run or staff the office, asking Congress to overturn the law it passed creating the office, or reshaping the office to better suit his political interests.
“A ‘Plague’ Comes Before the Fall: Lessons from Roman History”
Colin Elliott discusses the effects of the Antonine plague in this piece, writing in part “The Pax Romana—the 200-year “golden age” of the Roman Empire—was a marvel of diversity, connectivity, and unchallenged hegemony. By the middle of the second century AD, imperial Rome ruled territory across three different continents. Roughly one-quarter of the Earth’s population, some 60 million people, lived under Rome’s vast aegis, and the emperors of the age—most notably Marcus Aurelius—enjoyed the consent of those they governed. The Empire’s elites—witnessing the disciplined legions, widespread religiosity, cultural efflorescence, and dominant economy—likely expected their world order to endure forever.”
“In the year 166 AD, however, seemingly eternal Rome was caught completely off-guard as a deadly novel disease swept across the Eurasian landmass. It ransacked Rome’s cities for at least a decade and preceded centuries of decline. This major biological event—now known as the Antonine plague—appears to have been the world’s first pandemic.”
“Chloropicrin and Its Alleged Use in the Ukrainian War”
JP Zanders breaks down the United States’ accusation that Russia used RCAs and chloropicrin against Ukrainian forces in this post on The Trench: “This three-part blog contribution analyses the publicly available information about RCA and chloropicrin use in the Russo-Ukrainian war. The first part summarises the chemical warfare allegations between 2014 and 2024. Part 2 investigates the reports of chloropicrin use, and the final part discusses how the international community can address the CW allegations through action in the Organisation for the Prohibition of Chemical Weapons (OPCW).”
What We’re Listening To🎧
The Arms Control Poseur, The US and the Chemical Weapons Convention with Laura J. Gross
“On the ninth episode of season 2, William is joined by Laura J. Gross to discuss the completion of the destruction of the US chemical weapons stockpile.”
“In order to understand the current commitments of the United States to the Chemical Weapons Convention (CWC), Laura J. Gross joins William to discuss the completion of the destruction of the US chemical weapons stockpile, which was announced on the 7th of July 2023. This destruction was then verified by the Organisation for the Prohibition of Chemical Weapons (OPCW). In this episode, Ms Gross discusses the challenges that were faced in the destruction of this stockpile, and outlines the achievement itself in light of upholding global norms on arms control and verifiability. However, various challenges remain regarding the implementation of the Convention’s provision, such as the conflict in Gaza, the potential possession of chemical weapons by the Syrian Arab Republic, and the war in Ukraine. Ms Gross explains how the US assists other countries in the destruction of their declared chemical weapons stockpiles. When looking towards the future of the CWC, Ms Gross also touches upon the renewed use of chemical weapons by Syria, Russia, and North Korea and what the US is undertaking to counter the return to such use.”
“Laura J. Gross is the director of the Office of Chemical and Biological Weapons Affairs, Bureau of Arms Control, Deterrence, and Stability, at the United States Department of State, and she is the Executive Director of the US National Authority for the CWC.”
NEW-Pandemic Accord: Partial Failure or Partial Success?
From Brown Pandemic Center: “On 23 May at 12:00PM ET the Pandemic Center will host a webinar titled Pandemic Accord: Partial Failure or Partial Success?”
“Member States of the World Health Organization have been negotiating a new pandemic treaty to address challenges in the response to and sub-optimal international coordination during the Covid-19 pandemic. A vote on the treaty is expected during the upcoming World Health Assembly, taking place 27 May through 1 June. This Pandemic Center webinar will convene an expert panel to assess the strengths and limitations of the current draft of the treaty and its prospects for adoption.”
NEW-Ready or Not 2024: Protecting the Public’s Health from Diseases, Disasters, and Bioterrorism
From TFAH: “Please join Trust for America’s Health (TFAH) for a virtual Congressional briefing and national webinar on our recent report, Ready or Not 2024: Protecting the Public’s Health from Diseases, Disasters, and Bioterrorism.”
“The report identifies gaps in national and state preparedness to protect residents’ health during emergencies and makes recommendations to strengthen the nation’s public health system and improve emergency readiness. As the nation experiences an increasing number of infectious disease outbreaks and extreme weather events, the report found that while emergency preparedness has improved in some areas, policymakers not heeding the lessons of past emergencies, funding cuts, and health misinformation are all putting decades of progress at risk.”
“A panel of subject matter experts will discuss the nation’s readiness for public health emergencies, examine the findings of the report, and discuss key recommendations for policymakers. The briefing will include time for Q&A from the audience.”
This event will take place on May 29 and 2 pm EST. Learn more and register here.
NEW-Optimizing Federal, State, and Local Response to Public Health Emergencies
From NASEM: “The National Academies of Sciences, Engineering, and Medicine’s Committee on Science, Technology, and Law cordially invites you to attend a virtual workshop to examine how legal authorities affected the ability of public health agencies and federal, state, and local governments to respond to the COVID-19 pandemic and explore approaches to ensure a more effective response to future public health crises. The allocation of legal authority has become an issue of immediate relevance as the United States confronts an H5N1 avian influenza outbreak in dairy cattle.”
“The workshop, which will highlight ideas for optimizing the response to future public health emergencies, will be held on Thursday, May 30, 2024 from 12:00 to 5:30 pm U.S. Eastern and Friday, May 31, 2024 from 12:00 to 4:30 pm U.S. Eastern. It will include the following sessions:
1) Optimizing Federal, State, and Local Public Health Preparedness 2) The COVID-19 Pandemic: What happened? What went right? What went wrong? 3) Public Health Emergency Authorities: What we know about them and how did we experience them before, during, and after the COVID-19 pandemic?
Case Study I: Pandemic Orders and Religious Liberty
Case Study II: New York City Vaccine Mandates: Who Has the Authority?
Case Study III: The Experience with Public Health Emergency Authorities Before, During, and After COVID-19
Case Study IV: The Future of Public Health Authority at the Federal, State, and Local Level
4) Exploring Routes and Barriers to Effective Public Health Response Efforts During the COVID-19 Pandemic 5) Looking to the Future: Where do we go from here? 6) Concluding Thoughts from Workshop Planning Committee”
“The story of how America fared under the Covid-19 pandemic is actually two stories. While the more well-known story is one of failure, confusion, and polarization, the other story is one of American ingenuity amidst profound uncertainty. State and local leaders were at the center of this untold story—in serving their communities they innovated, bridged divides, and illuminated America’s path during the Covid-19 pandemic’s darkest days. The American Democracy and Health Security Initiative spotlights these lamplighters and harvests their hard-won lessons, to ensure the most successful strategies can be sustained or replicated in future crises.”
“On June 5, the American Democracy and Health Security Initiative will publish its findings on what actionable steps are needed to advance our health security for the future. The event will feature leaders from across the country from Governors, advisors, and health leaders to community organizations, educators, businesses, and crisis managers. We will discuss urgent opportunities to make the country more resilient against future threats to our health security and to our democracy and identify national and local innovations that must be retained and playbooks that are needed to reinvigorate leadership, bipartisanship, and equitable access in the face of the next health emergency in America.”
This event will take place on June 5 at 2 pm ET. Register here.
Getting Ahead of Avian Influenza: Why Organizations Need to Prepare Today
From Bluedot: “Highly Pathogenic Avian Influenza A(H5N1), commonly referred to as bird flu, has been making headlines around the world, as the virus rapidly spreads to new animal species. Already the cause of a panzootic (global animal pandemic), last month a human H5N1 case was reported in the U.S. after likely contracting it from infected dairy cattle. The virus has now been detected in dairy herds across multiple states, with evidence to suggest it has been spreading more widely than previously thought — begging the question: Are we at risk for an avian influenza-instigated pandemic?”
“Join us for a deep dive into avian influenza as we explore why and how organizations should prepare to safeguard against bird flu. Together, through collaborative efforts and informed decision-making, we can mitigate the risk of increased transmission to humans. BlueDot’s experts have been closely monitoring the situation and potential risks, issuing multiple alerts on H5N1 — and other avian influenzas — over the past 15 months.”
This event will take place on May 23, at 11 am ET. Learn more and register here.
Addressing the Challenges Posed by Chemical and Biological Weapons: Intensive Online Introductory Course for Students of Technical Disciplines
“SIPRI and the European Union Non-Proliferation and Disarmament Consortium (EUNPDC) invite graduate and postgraduate students of the technical or natural science disciplines to apply for an intensive online introductory course on chemical and biological weapons—their proliferation, the efforts to eliminate them, the various mechanisms used to control their spread—and endeavours underway to reduce the risk of chemical or biological agents in terrorist attacks. The course will take place online, during four half-days on 28–31 May 2024, 14:00 to 18:00 Central European Summer Time (CEST).”
“The course will cover the fundamentals of chemical and biological weapons as well as of missiles and other means of delivery; the history of chemical and biological warfare; the evolution of international norms against these weapons; the threats associated with potential terrorist uses of chemical and biological material; bioweapons and other related scientific advances; the current challenges posed by chemical weapons; arms control treaties; and mechanisms to curb the spread of dangerous substances, including export controls.”
“The course will also discuss the role of the EU institutions and industry to address the challenges mentioned above. The course will be instructed by renowned experts on non-proliferation, arms control, disarmament, export controls, verification and related subjects from SIPRI, other European research centres, think tanks and international organizations.”
Registration is now open for the Global Health Security 2024 conference in Sydney, Australia. This iteration will take place 18-21 June, 2024. The call for abstracts is also still open. “The mission of the Global Health Security conference is to provide a forum where leaders, researchers, policy-makers, and representatives from government, international organisations, civil society, and private industry from around the world can engage with each other, review the latest research and policy innovations, and agree solutions for making the world safer and healthier. To that end, our mission is to help foster a genuinely multidisciplinary community of practice that is committed to working collaboratively to enhance global health security and eliminate disease, irrespective of its origin or source.”
SBA.3 International Synthetic Biology, and Biosecurity Conference in Africa
“Join us for the SBA.3 International Synthetic Biology and Biosecurity Conference in Africa, a groundbreaking event that brings together experts, researchers, and enthusiasts in the field of synthetic biology. This in-person conference will take place at the Laico Regency Hotel from Wed, Jul 17, 2024 to Friday, Jul 19, 2024.”
“Get ready to dive into the exciting world of synthetic biology and explore its potential applications in Africa. From cutting-edge research to innovative solutions, this conference offers a unique opportunity to learn, network, and collaborate with like-minded individuals.”
“Discover the latest advancements, trends, and challenges in synthetic biology through engaging keynote speeches, interactive workshops, and thought-provoking panel discussions. Immerse yourself in a vibrant atmosphere where ideas flow freely and new connections are made.”
“Whether you’re a seasoned professional or just starting your journey in synthetic biology, this conference provides a platform to expand your knowledge, exchange ideas, and contribute to the growth of the field in Africa.”
“Don’t miss out on this extraordinary event that promises to shape the future of synthetic biology and biosecurity in Africa. Mark your calendars and join us at the SBA.3 International Synthetic Biology and Biosecurity Conference in Africa!”
The International Biosecurity and Biosafety Initiative for Science (IBBIS) recently launched The Common Mechanism, “An open-source, globally available tool for DNA synthesis screening.” The organization explains on its website that “The Common Mechanism helps providers of synthetic DNA and RNA to effectively screen orders to prevent synthesis technology from being exploited. We provide free, distributed, open-source, automated software for screening sequences of nucleic acids (including DNA and RNA) as well as resources to facilitate customer screening.”
This week’s Pandora Report covers a new interim staff report from the House Select Subcommittee on the Coronavirus Pandemic, the new United States Government Policy for Oversight of Dual Use Research of Concern and Pathogens with Enhanced Pandemic Potential, the OPCW’s statement on Russia’s alleged use of toxic chemicals as weapons in Ukraine, and more.
GMU Biodefense Students Visit National Museum of Health and Medicine
“The 150-year-old museum is known for its collections that depict the human anatomy and everything that can befall it, in sometimes stark and gory detail. What else would you expect from a museum with a pathology guide with listings for “bilateral nephrolithiasis (kidney stones),” “liver, hydatid cyst from tape worm,” and an all-time-favorite, “trichobezoar (human hairball from stomach).”’
Read more about this visit here on the Schar School’s website.
GMU Biodefense students at the National Museum of Health and Medicine
Select Subcommittee on the Coronavirus Pandemic Interim Staff Report Calls for Daszak, EcoHealth Alliance Debarment
Earlier this month, the House Select Subcommittee on the Coronavirus Pandemic’s chairman, Rep. Brad Wenstrup (R-OH), released an interim staff report-“An Evaluation of the Evidence Surrounding EcoHealth Alliance, Inc.’s Research Activities”. The press release explains in part, “This report details the Select Subcommittee’s comprehensive investigation into the U.S. government’s funding and lack of oversight of gain-of-function research, EcoHealth Alliance (EcoHealth), and the Wuhan Institute of Virology (WIV). The report reveals serious, systemic weaknesses in the National Institute of Allergy and Infectious Diseases (NIAID) and National Institutes of Health’s (NIH) grant procedures and examines how these failures enabled EcoHealth President Dr. Peter Daszak to fund dangerous gain-of-function research in Wuhan, China without sufficient oversight.”
The select subcommittee’s recommendations include:
“The Select Subcommittee on the Coronavirus Pandemic recommends that EcoHealth Alliance and Dr. Peter Daszak are formally debarred and cut off from receiving any future U.S. taxpayer funding.”
“The Select Subcommittee also recommends that the U.S. Department of Justice conduct a formal investigation into Dr. Daszak.”
“Further, the Select Subcommittee recommends eight improvements to NIAID and NIH procedures that will improve grant compliance, increase biosafety and biosecurity of high-risk research, and advance transparency and accountability in America’s federal health agencies.”
Daszak testified before the select subcommittee on the day the report was released, which was covered by Matt Field in The Bulletin of the Atomic Scientists. Field explains in his coverage that Daszak was grilled by members of both major political parties during the subcommittee’s hearing on May 1, writing “On Wednesday, however, members of both US political parties came armed with blistering criticism for Peter Daszak, the head of the nonprofit EcoHealth Alliance, questioning his honesty in dealing with federal agencies and skewering his alleged conflicts of interests as he attempted to assume the role of a leading scientific voice on the pandemic’s origins. Beginning in 2014, EcoHealth ran a US-funded, multimillion-dollar project to identify hotspots where patterns of interaction between humans and animals could spark disease outbreaks.”
He later writes, “They hammered away on one of the plot points in the origins debate, EcoHealth’s transparency in reporting on its studies to the National Institutes of Health (NIH). Over the course of one five-year grant, EcoHealth was supposed to submit annual reports. One of those, covering 2018-2019, came two years late. Daszak claimed that EcoHealth had tried to submit the report, but the NIH had a problem with its computerized reporting platform. According to a report by the subcommittee’s Democrats, however, a forensic audit found no evidence for this assertion.”
Chairman Wenstrup said in a statement, ““EcoHealth Alliance President Dr. Peter Daszak is not a good steward of U.S. taxpayer dollars and should never again receive funding from the U.S. taxpayer. Dr. Daszak and his organization conducted dangerous gain-of-function research at the WIV, willfully violated the terms of a multi-million-dollar NIH grant, and placed U.S. national security at risk. This blatant contempt for the American people is reprehensible. It is imperative to establish higher standards of oversight at the NIH. The Select Subcommittee’s detailed and comprehensive report today holds Dr. Daszak and EcoHealth Alliance accountable and sheds light on severe shortcomings in our public health systems.”
US Agencies Set to Tighten Gain-of-Function Research Oversight
This White House announced this week the new United States Government Policy for Oversight of Dual Use Research of Concern and Pathogens with Enhanced Pandemic Potential and accompanying implementation guidance, following years of public debate and recommendations made by the National Science Advisory Board for Biosecurity. As the New York Times explains, “The new policy, which applies to research funded by the federal government, strengthens the government’s oversight by replacing a short list of dangerous pathogens with broad categories into which more pathogens might fall. The policy pays attention not only to human pathogens, but also those that could threaten crops and livestock. And it provides more details about the kinds of experiments that would draw the attention of government regulators.”
Read Max Kozlov’s summary and discussion of this new policy in Nature.
Emergent BioSolutions, the Gaithersburg-based company best known for producing Narcan, has announced it is shuttering its Maryland manufacturing facilities and laying off about 300 employees. This includes its Baltimore-Bayview Drug Substance manufacturing facility and its Rockville Drug Product facility, according to The Baltimore Banner. The company has also said it will eliminate 85 currently vacant positions. This is all on top of the more than 230 Maryland employees Emergent laid off last year.
Emergent drew national attention in the summer of 2021 after the company, which had secured a government contract to produce COVID-19 vaccines on behalf of Johnson & Johnson and AstraZeneca, came under Congressional scrutiny for potentially contaminating at least 75 million vaccine doses. Furthermore, as The New York Timeshighlighted at the time, “With its stock price cut in half, Emergent faces several shareholder lawsuits accusing it of securities fraud, and a pension fund filed a complaint last Tuesday claiming that some executives and board members — including several former federal officials — had engaged in insider trading by unloading more than $20 million worth of stock over the past 15 months.”
An investigation found that Emergent was forced to destroy or discard up to 400 million doses’ worth of ingredients for COVID-19 vaccines. ABC News explained in a piece about the report that “Congressional investigators probing the Maryland-based biotech company found that Emergent executives had privately raised urgent quality-control concerns even before the company began manufacturing the vaccines’ key ingredient — despite publicly expressing confidence in their ability to deliver on their multimillion-dollar government contract.”
‘”Despite major red flags at its vaccine manufacturing facility, Emergent’s executives swept these problems under the rug and continued to rake in taxpayer dollars,” House Oversight and Reform Committee Chairwoman Carolyn Maloney, D-N.Y., said of the report, which determined that the company’s “manufacturing failures and deceptive tactics” led to the large-scale waste of ingredients that could have helped make millions of vaccine doses.”
Emergent’s stock price did jump following the announcement of the layoffs, finishing yesterday at $4.37 up from $1.93 on May 1, a far cry from the $130 its shares were traded for in August 2020. According to The Baltimore Banner, “The company estimated that the restructuring will cost up to $21 million this year and save the company about $80 million annually. In a filing with the U.S. Securities and Exchange Commission, Emergent said most of those initial costs will be related to severance and benefits.”
OPCW Releases Statement on Ukraine
The OPCW released this week a statement about Russia’s alleged use of toxic chemicals as weapons in Ukraine. It reads in part “The Secretariat of the Organisation for the Prohibition of Chemical Weapons (OPCW) has been monitoring the situation on the territory of Ukraine since the start of the war in February 2022 in relation to allegations of use of toxic chemicals as weapons…The information provided to the Organisation so far by both sides, together with the information available to the Secretariat, is insufficiently substantiated.”
Mason Biodefense Graduate Program Director Discusses AI, Biological Weapons Risks with CNN
Biodefense Graduate Program Director Gregory Koblentz was recently interviewed in this May 5 CNN Newsroom segment covering AI and biological weapons proliferation risks. It was filmed ahead of the release of an episode of CNN’s “How It Really Happened” focused on the 2001 Amerithrax attacks.
“2024 U.S. Department of State Report on North Korea’s ‘Genetic Scissors’ Technology and Capabilities and Its National Security Implications”
This report from the Institute for National Security Strategy was co-authored by Biodefense PhD Program alumnus Hyun Jung Kim: “The recent U.S. State Department’s report, titled “2024 Adherence to and Compliance with Arms Control, Nonproliferation, and Disarmament Agreements and Commitments,” articulates that North Korea has acquired the capability to genetically engineer biological products utilizing CRISPR. This report raises alarms over the potential transformation of this genetic engineering technology into an offensive biological weapons program. CRISPR, often referred to as ‘genetic scissor’ technology, renowned for its ability to precisely cut and replace sections of the genome, holds promise for groundbreaking developments in medicine, agriculture, and energy sectors. However, this technology also faces several challenges, including ethical and institutional issues and safety concerns. The national security threats posed by the advancement of North Korea’s genetic engineering technology include unconventional warfare tactics such as terrorism and targeted assassinations, the potential leakage of genetically modified bioagents due to laboratory accidents, and the proliferation of weapons of mass destruction. Furthermore, the same report notes the development of ‘dual-use marine toxins’ by the Chinese People’s Liberation Army, which may imply possible strategic cooperation and coordination between China and North Korea in the development of biological toxins, posing a significant challenge to the international security landscape.”
“China, Biotechnology, and BGI: How China’s Hybrid Economy Skews Competition”
Anna Puglisiand Chryssa Rask recently published this issue brief with Georgetown’s Center for Security and Emerging Technology: “As the U.S. government considers banning genomics companies from China, it opens a broader question about how the United States and other market economies should deal with China’s “national champions.” This paper provides an overview of one such company—BGI—and how China’s industrial policy impacts technology development in China and around the world.”
“The National Blueprint for Biodefense: Immediate Action Needed to Defend Against Biological Threats”
This latest report from the Bipartisan Commission on Biodefense urges policymakers to adopt several measures to help sustain and grow US biodefense, including establishing a congressional working group focused on biodefense at the start of each Congress, making amendments to the Public Health Service Act in order to “produce a research and development plan for reducing pathogen transmission in built environments,” and replacing BioWatch.
In addition to the report linked above, Axios’ Alison Snyder has summarized the report and provided context to its recommendations here.
“Twenty Years of Preparedness: Reflecting on the Legacy of the Project BioShield Act of 2004”
Adey Pierce-Watkins and Tanima Sinha recently published this report for BDO: “This July 2, 2024, marks the 20th anniversary of The Project BioShield Act of 2004 (P.L. 108-276); legislation enacted in response to the anthrax attacks of September 2001, which revealed the need for development and acquisition of medical countermeasures (vaccines, therapeutics, and diagnostics) to protect the U.S. population from chemical, biological, radiological, and nuclear (CBRN) threats. This Act, and associated Congressional Appropriations, established a Special Reserve Fund (SRF) of $5.593B advanced funding available over a 10-year period for the advanced development and procurement of medical countermeasures with the intent of initiating a new posture of national preparedness.1 Simultaneously, this legislation created new market incentives for pharmaceutical and biotech companies to engage in the development of CBRN medical countermeasures and transformed the partnership between the federal government and industry into a shared responsibility for increasing preparedness against CBRN threats. As a result, this legislation and the SRF created a “guaranteed market” for pharmaceutical companies to produce CBRN medical countermeasures for which there previously was no commercial demand…In recognition of the 20th Anniversary of The Project BioShield Act, it is fitting to highlight the impact and milestones of this legislation based on its intended purpose and outcomes to date.”
“It Shouldn’t Be Easy to Buy Synthetic DNA Fragments to Recreate the 1918 Flu Virus”
Kevin M. Esvelt recently authored this piece for STAT News, writing in part “It should be hard — exceedingly hard — to obtain the synthetic DNA needed to recreate the virus that caused the deadly 1918 influenza pandemic without authorization. But my lab found that it’s surprisingly easy, even when ordering gene fragments from companies that check customers’ orders to detect hazardous sequences…Our experiment demonstrates that the immense potential benefits of biotechnology are profoundly vulnerable to misuse. A pandemic caused by a virus made from synthetic DNA — or even a lesser instance of synthetic bioterrorism — would not only generate a public health crisis but also trigger crippling restrictions on research.”
Applied Biosafety Special Issues on Biosafety and Biosecurity for Synthetic Genomics
Applied Biosafety‘s first and second special issues focused on biosafety and biosecurity for synthetic genomics is now available online. Articles include “Enhancing Gene Synthesis Security: An Updated Framework for Synthetic Nucleic Acid Screening and the Responsible Use of Synthetic Biological Materials,” “Developing a Common Global Baseline for Nucleic Acid Synthesis Screening,” Biosecurity Risk Assessment for the Use of Artificial Intelligence in Synthetic Biology,” “Biosecurity Assessments for Emerging Transdisciplinary Biotechnologies: Revisiting Biodefense in an Age of Synthetic Biology,” and more.
“Supporting Follow-Up Screening for Flagged Nucleic Acid Synthesis Orders”
Tessa Alexanian and Sella Nevo recently published this briefer with CSR’s Nolan Center, writing in part “Medical diagnostics, biomanufacturing, and many other parts of the bioeconomy rely on synthetic DNA and RNA purchases, which are ordered from commercial providers and shipped to laboratories around the globe. In addition to enabling beneficial biotechnology, affordable and accessible nucleic acid synthesis raises biosecurity concerns: some sequences can be used to reconstruct pathogen genomes or engineer dangerous biological agents, and it’s necessary to ensure those sequences are not misused by actors seeking to cause harm.”
“Most commercial synthesis providers screen the orders they receive to identify sequences of concern that could facilitate the construction of dangerous biological agents. When sequences in an order are flagged, follow-up screening determines whether the order is fulfilled. This screening centers on the customer: do they have a legitimate, peaceful purpose for obtaining the flagged sequences of concern?”
“This follow-up screening is the subject of this briefer. Between July and August 2023, we interviewed industry contacts and other policy and biosecurity experts. In the subsequent months, we conducted independent research and solicited expert feedback on report drafts. This process made clear that today, the follow-up screening process is ad-hoc. The customer service representatives, bioinformaticians, and security experts conducting follow-up screening often lack support for handling ambiguous cases, and there is little infrastructure to support information-sharing with other synthesis providers or law enforcement…”
“Developing a Customer Screening Framework for the Life Sciences”
A new report from Blueprint Biosecurity: “Since the 1970’s and the advent of recombinant DNA, biology has consistently become easier to engineer, and the pace of these advances is increasing. Many tools and capabilities for engineering biology are becoming more powerful, more affordable, and more widely available. These capabilities are critical for basic scientific research as well as advances in health, agriculture, and a wide range of applications in the burgeoning bioeconomy. However, access to these tools also raises the possibility that they could be accidentally or deliberately misused to cause harm by enabling development of toxins, pathogens, or other dangerous biological agents, including some not found in nature. Potential biological harms include high-consequence events such as the development and release of an engineered pathogen that causes a global catastrophe as well as a wide range of lower-consequence, higher-likelihood events. To prevent this type of misuse, policy experts have recommended expanding customer screening practices and policy frameworks to include a broad range of life sciences products, services, and infrastructure (Carter and DiEuliis, 2019a). Recent advances in artificial intelligence (AI) have increased this type of risk and have intensified these calls for action (Carter, et al., 2023; Helena, 2023).”
“To Combat Cow Flu Outbreak, Scientists Plan to Infect Cattle with Influenza in High-Security Labs”
Science’s Kai Kupferschmidt discusses current efforts to better understand H5N1 in this piece, writing in part “The avian influenza virus that has been infecting dairy cows and spreading alarm in the United States was expected to reach Germany this week. But that’s actually good news. A shipment of samples of the H5N1 virus from Cornell University virologist Diego Diel is destined for the Federal Research Institute for Animal Health in Riems, which has one of the rare high-security labs worldwide that are equipped to handle such dangerous pathogens in cattle and other large animals. There, veterinarian Martin Beer will use the samples to infect dairy cows, in search of a fuller picture of the threat the virus poses, to both cattle and people, than researchers have been able to glean from spotty data collected in the field.”
“Biodiversity Loss is Biggest Driver of Infectious Disease Outbreaks, Says Study”
This piece from The Guardian discusses the findings of a recent Naturemeta-analysis: “New infectious diseases are on the rise and they often originate in wildlife. In meta-analysis published in the journal Nature, researchers found that of all the “global change drivers” that are destroying ecosystems, loss of species was the greatest in increasing the risk of outbreaks. Biodiversity loss was followed by climate change and introduction of non-native species.”
“Washington Accuses Russia of Chemical Weapons Attacks in Ukraine”
Andrea Stricker and Anthony Ruggiero recently authored this piece for the Foundation for Defense of Democracies that summarizes the United States’ claim that Russia has used CW in Ukraine, writing in part “The United States last week accused Russia of using chemical weapons against Ukrainian troops and sanctioned 12 Russian entities and individuals associated with Vladimir Putin’s ongoing chemical weapons program. The finding points to yet another instance of Moscow’s violation of international norms and conventions through the continued possession, stockpiling, and use of chemical weapons.”
“The Alleged Use of Chemical Weapons in Ukraine: How the International Community Can Investigate”
Ahmet Üzümcü recently authored this commentary piece for the European Leadership Network, explaining in part “I have summarised above the different mechanisms employed in the recent past to investigate allegations of the use of chemical weapons. I believe that one of them might be activated to investigate reported incidents in Ukraine. Whichever is selected may not enjoy the support of the whole membership; however, if one of the options is chosen, it needs to be practical and produce concrete results despite the challenges associated with the ongoing conflict. One of the strengths of the OPCW’s robust verification and compliance regime has always been its level of expertise and objectivity in the area of chemical weapons. The international community could leverage these strengths to test the veracity of the allegations that have been levelled against Russia about chemical weapons use during the armed conflict in Ukraine. The States Parties to the Chemical Weapons Convention should support such an initiative for two reasons: first, to provide a deterrent effect against further alleged uses of chemical weapons, and second, to uphold the integrity and credibility of the Chemical Weapons Convention, which is one of the pillars of the rules-based international order.”
ICYMI: Biological Weapons Convention Scientific and Technological Advisory Mechanism
From the UN Institute for Disarmament Research: “The Friends of the Chair, together with UNIDIR and @unitednations_disarmament, organized this informal webinar on a BWC scientific and technological advisory mechanism. This webinar was designed to support ongoing activities of the BWC Working Group and to stimulate thinking and discussion around a mechanism during the intersessional period. The event consisted of an expert panel followed by a moderated question-and-answer session with the audience.”
NEW-Slaves to the Bomb: The Role & Fate of N. Korea’s Nuclear Scientists
“The Committee for Human Rights in North Korea (HRNK) is delighted to invite you to the rollout of its latest report, Slaves to the Bomb: The Role & Fate of North Korea’s Nuclear Scientists by Robert Collins. The event will be open to the press and on the record. The report will be published on HRNK’s website on the day of the report rollout.”
This event will take place on May 17, at 3 pm EST. Learn more and RSVP here.
NEW-Getting Ahead of Avian Influenza: Why Organizations Need to Prepare Today
From Bluedot: “Highly Pathogenic Avian Influenza A(H5N1), commonly referred to as bird flu, has been making headlines around the world, as the virus rapidly spreads to new animal species. Already the cause of a panzootic (global animal pandemic), last month a human H5N1 case was reported in the U.S. after likely contracting it from infected dairy cattle. The virus has now been detected in dairy herds across multiple states, with evidence to suggest it has been spreading more widely than previously thought — begging the question: Are we at risk for an avian influenza-instigated pandemic?”
“Join us for a deep dive into avian influenza as we explore why and how organizations should prepare to safeguard against bird flu. Together, through collaborative efforts and informed decision-making, we can mitigate the risk of increased transmission to humans. BlueDot’s experts have been closely monitoring the situation and potential risks, issuing multiple alerts on H5N1 — and other avian influenzas — over the past 15 months.”
This event will take place on May 23, at 11 am ET. Learn more and register here.
Biosafety and the Origin of the COVID-19 Pandemic: Evidence and Policy Implications
From Brookings: “The world just lived through the COVID-19 pandemic, with more than 7 million reported direct deaths globally, more than 775 million reported cases, more than 14 million indirect excess deaths, and likely millions more unreported deaths. Despite the devastating effects on people and economies around the world, we still do not know with certainty how the pandemic originated, with the two most likely hypotheses either a natural spillover from an animal host or a research lab leak. Finding an answer to this question is not just a matter of doing justice to the millions of victims of COVID-19—it will have significant ramifications for policy implementation to help prevent the next pandemic.”
“Importantly, the catastrophic impact of the COVID-19 disease has shown us that preventing the next pandemic and biosafety in general should be top of mind for researchers, regulators, policymakers and public health officials, and it will likely require an array of measures by private, public, and nongovernmental organizations. This includes reconsidering our early warning systems for emergent diseases from the natural world, and taking a closer look at research with dangerous pathogens in biolabs. Identifying the origins of the recent pandemic can help target those efforts.”
“On May 14, the Brookings Center on Regulation and Markets will address these complex questions. First, Alina Chan, scientific advisor at the Broad Institute, and Alison Young, Curtis B. Hurley chair in public affairs reporting at the University of Missouri School of Journalism, will explain why the origin of the SARS-CoV-2 virus matters for public policy. Then, a balanced expert panel will debate the two most likely origins: natural spillover or a leak from a lab. A final panel of biosafety experts will discuss what measures would be best suited to improve biosafety and reduce the risks for research-related lab incidents as well as future pandemics. This event is a part of the CRM series on Reimagining Modern-day Markets and Regulations.”
This online event will take place on May 14 at 1:30 pm EDT. Learn more and access the event here.
Addressing the Challenges Posed by Chemical and Biological Weapons: Intensive Online Introductory Course for Students of Technical Disciplines
“SIPRI and the European Union Non-Proliferation and Disarmament Consortium (EUNPDC) invite graduate and postgraduate students of the technical or natural science disciplines to apply for an intensive online introductory course on chemical and biological weapons—their proliferation, the efforts to eliminate them, the various mechanisms used to control their spread—and endeavours underway to reduce the risk of chemical or biological agents in terrorist attacks. The course will take place online, during four half-days on 28–31 May 2024, 14:00 to 18:00 Central European Summer Time (CEST).”
“The course will cover the fundamentals of chemical and biological weapons as well as of missiles and other means of delivery; the history of chemical and biological warfare; the evolution of international norms against these weapons; the threats associated with potential terrorist uses of chemical and biological material; bioweapons and other related scientific advances; the current challenges posed by chemical weapons; arms control treaties; and mechanisms to curb the spread of dangerous substances, including export controls.”
“The course will also discuss the role of the EU institutions and industry to address the challenges mentioned above. The course will be instructed by renowned experts on non-proliferation, arms control, disarmament, export controls, verification and related subjects from SIPRI, other European research centres, think tanks and international organizations.”
Registration is now open for the Global Health Security 2024 conference in Sydney, Australia. This iteration will take place 18-21 June, 2024. The call for abstracts is also still open. “The mission of the Global Health Security conference is to provide a forum where leaders, researchers, policy-makers, and representatives from government, international organisations, civil society, and private industry from around the world can engage with each other, review the latest research and policy innovations, and agree solutions for making the world safer and healthier. To that end, our mission is to help foster a genuinely multidisciplinary community of practice that is committed to working collaboratively to enhance global health security and eliminate disease, irrespective of its origin or source.”
SBA.3 International Synthetic Biology, and Biosecurity Conference in Africa
“Join us for the SBA.3 International Synthetic Biology and Biosecurity Conference in Africa, a groundbreaking event that brings together experts, researchers, and enthusiasts in the field of synthetic biology. This in-person conference will take place at the Laico Regency Hotel from Wed, Jul 17, 2024 to Friday, Jul 19, 2024.”
“Get ready to dive into the exciting world of synthetic biology and explore its potential applications in Africa. From cutting-edge research to innovative solutions, this conference offers a unique opportunity to learn, network, and collaborate with like-minded individuals.”
“Discover the latest advancements, trends, and challenges in synthetic biology through engaging keynote speeches, interactive workshops, and thought-provoking panel discussions. Immerse yourself in a vibrant atmosphere where ideas flow freely and new connections are made.”
“Whether you’re a seasoned professional or just starting your journey in synthetic biology, this conference provides a platform to expand your knowledge, exchange ideas, and contribute to the growth of the field in Africa.”
“Don’t miss out on this extraordinary event that promises to shape the future of synthetic biology and biosecurity in Africa. Mark your calendars and join us at the SBA.3 International Synthetic Biology and Biosecurity Conference in Africa!”
The International Biosecurity and Biosafety Initiative for Science (IBBIS) recently launched The Common Mechanism, “An open-source, globally available tool for DNA synthesis screening.” The organization explains on its website that “The Common Mechanism helps providers of synthetic DNA and RNA to effectively screen orders to prevent synthesis technology from being exploited. We provide free, distributed, open-source, automated software for screening sequences of nucleic acids (including DNA and RNA) as well as resources to facilitate customer screening.”
This week covers the updated Doomsday Clock time, new HHS cybersecurity performance goals for the health sector, a podcast episode with our own Sonia Ben Ouagrham-Gormley covering her work on barriers to biological weapons, new publications, and more!
Bulletin of the Atomic Scientists Science and Security Board Leaves Doomsday Clock at 90 Seconds to Midnight
The Bulletin of the Atomic Scientists Science and Security Board recently announced that it left the Doomsday Clock at 90 seconds to midnight this year, based on threats like nuclear risk, climate change, biological threats, and disruptive technologies. In its statement, the board said in part “Ominous trends continue to point the world toward global catastrophe. The war in Ukraine and the widespread and growing reliance on nuclear weapons increase the risk of nuclear escalation. China, Russia, and the United States are all spending huge sums to expand or modernize their nuclear arsenals, adding to the ever-present danger of nuclear war through mistake or miscalculation.”
“In 2023, Earth experienced its hottest year on record, and massive floods, wildfires, and other climate-related disasters affected millions of people around the world. Meanwhile, rapid and worrisome developments in the life sciences and other disruptive technologies accelerated, while governments made only feeble efforts to control them.”
In its in-depth explanation of biological risks that factored into this decision, the board explains that “The revolution in the life sciences and associated technologies continues to accelerate and expand in scope, enabling an increasing number of individuals, in groups and alone, to pose threats arising from both accidental and deliberate misuse. During the past six months, the potential for artificial intelligence tools to empower individuals to misuse biology has become far more apparent.”
The same sidebar also explains that “Two other types of biological risks remain causes for concern: accidental release of organisms from laboratories and naturally occurring infectious diseases, especially those with pandemic potential. Deforestation, urbanization, and climate change continue to destabilize microbe-host relationships and facilitate the emergence of infectious diseases. Meanwhile, high-biosafety-level laboratories have proliferated around the world, as has risky research motivated by interests in controlling these diseases. Despite the importance of understanding and countering naturally occurring biological threats, it isn’t clear that all of these high-biosafety-level laboratories or high-risk experiments are needed for achieving these goals. As the number of laboratories and amount of risky research increases, and the failure to standardize safe laboratory practices and to institute adequate research oversight persists, the risk of accidental release of dangerous pathogens worsens.”
HHS Announces New Voluntary Performance Goals, Resources for Health Sector Cybersecurity
This week, the Department of Health and Human Services announced via the Administration for Strategic Preparedness and Response (ASPR) that it is releasing “voluntary health care specific cybersecurity performance goals (CPGs) and a new gateway website to help Health Care and Public Health (HPH) sector organizations implement these high-impact cybersecurity practices and ease access to the plethora of cybersecurity resources HHS and other federal partners offer.”
The statement further explained “As outlined in the recent HHS Health Care Sector Cybersecurity concept paper, HHS is publishing the CPGs to help health care organizations, and health care delivery organizations in particular, prioritize implementation of high-impact cybersecurity practices. The HPH CPGs are designed to better protect the healthcare sector from cyberattacks, improve response when events occur, and minimize residual risk. HPH CPGs include both essential goals to outline minimum foundational practices for cybersecurity performance and enhanced goals to encourage adoption of more advanced practices.”
“Sonia Ben Ouagrham-Gormley on Barriers to Bioweapons”
From Hear This Idea: “Sonia Ben Ouagrham-Gormley is an associate professor at George Mason University and the deputy director of their biodefense program. Sonia has written extensively on the proliferation and non-proliferation of bioweapons, being one of the key voices to have emphasized the challenges that organizations, tacit knowledge, and other factors have caused for states and terrorists that have attempted to acquire weapons of mass destruction.”
Misconceptions around the ease of bioweapon production — how and why bioweapons programs face unique challenges compared to nuclear weapons programs
The crucial role of tacit knowledge in bioweapons production
Will AI make bioweapons much easier to develop, or will human expertise remain a major bottleneck?
Case studies of bioweapons programs, illustrating the practical difficulties and failures encountered even by well-resourced state actors.
(How) has Biological Weapons Convention prevented bioweapon proliferation?
Do global political trends point towards proliferation, even without AI?”
“How Reliable is ISIS’s Claiming Responsibility for Deadly Attacks in Iran?”
Schar School associate professor Mahmut Cengiz recently authored this piece for Homeland Security Today, in which he writes in part “These discrepancies related to the twin blasts bring up a question of how reliable ISIS is when the group claims responsibility for terrorist attacks. Terrorist groups aim to take credit when a group spokesperson, on behalf of the organization, states that the group is the perpetrator of the attack. They tend to claim responsibility for attacks—targeting state institutions and the military rather than civilians— when they aim to gain publicity and when the backlash from the government is not likely. As opposed to terrorist attacks that claimed most responsibility in the 1980s and 1990s, every one of seven attacks has been recorded claiming responsibility since 2018. According to the Global Terrorism and Trends Analysis Center (GTTAC) Records of Incidents Database (GRID), the attacks by ISIS and its affiliated organizations steadily increased from 2018 to 2022. They conducted 873 attacks in the first ten months of 2023. Contrary to increasing attacks, its attacks of claiming responsibility slightly increased between 2018 and 2020 and dropped in 2021 and 2022. ISIS groups claimed responsibility in its 161 attacks. “
“Beyond Borders, Beyond Biases: Building a Biosecure Future with Diverse Voices”
Aparupa Sengupta, Senior Program Officer for Global Biological Policy and Programs at NTI, discusses the importance of diversity and inclusion in biosafety and biosecurity governance in this piece for NTI. She writes in part “At NTI, we believe the greatest risk of these catastrophic effects is from the accidental or intentional misuse of a bio-engineered agent. Therefore, we focus on developing stronger biosafety and biosecurity policies and practices to protect against these manmade risks. This work requires global cooperation and shared responsibility, and an understanding that diverse perspectives and experiences are essential. Without them, we will face widening knowledge gaps and international resentment, ultimately sabotaging our ability to collectively address bio threats.”
“Recently, the Center for Security and International Studies (CSIS) published a report recommending actions to strengthen global biosafety and biosecurity. As someone with more than 15 years of experience working in the interface of science, technology, and biosafety/security, I endorse all eight recommendations in the report but suggest adding a ninth one to the list: “Prioritize diversity and inclusion for effective global biosafety and biosecurity governance.”’
“Did China Keep the COVID Virus Sequence Secret for Weeks?”
Matt Field breaks down questions surrounding China’s sharing of the SARS-CoV-2 genetic sequence in the early days of COVID-19 in this piece for the Bulletin of the Atomic Scientists: “In outbreak response, speed is critical as authorities seek to quickly determine the cause of a disease and prevent it from spreading. A new report is now raising fresh questions about China’s early response to COVID-19. The Wall Street Journalrevealed Wednesday that a researcher in Beijing attempted to upload the genetic sequence SARS-CoV-2, the virus that causes COVID, to a US-based public database about two weeks before the Chinese government publicized the pathogen’s sequence, a lag that potentially robbed scientists and health officials of valuable time.”
“Investigating the Potential Strategic Implications of COVID-19 for Biological Weapons Pursuit: A New Expert Simulation”
Ackerman et al. recently published this article in Health Security: “To investigate the impact of the COVID-19 pandemic on the strategic decisionmaking of leaders with respect to biological weapons, this study employed a prospective simulation technique called Asynchronous Strategic Dynamics Red Teaming. Using an immersive, multimedia simulation conducted remotely and asynchronously, the effort engaged 240 carefully selected and curated expert participants in either biological weapons or the countries of interest (as well as 60 naïve participants). Across our sample of 30 countries, simulated interest in pursuing some type of biological weapons program (defensive or offensive) remained low to moderate. While such interest increased after the simulated onset of the COVID-19 pandemic, it was limited overall, with only a handful of states showing salient increases in offensive biological weapon interest. When directly referencing why their countries might have changed their post-COVID-19 interest in biological weapons, the most commonly cited reasons were: (1) COVID-19 demonstrated the power of biological weapons to disrupt societies and cause large-scale economic harm, and (2) the pandemic revealed either the state’s own or its rivals’ vulnerability to diseases like COVID-19, as well as an inability to efficiently respond and contain such diseases. In sum, despite a global pandemic with massive consequences, the simulation revealed that most states are not likely to dramatically change their strategic posture regarding pursuit of offensive biological weapons.”
“Catalogue of Civil Society Assistance for BWC States Parties”
From the Stimson Center: “The Catalogue of Civil Society Assistance to States Parties annually highlights the contributions of civil society to the BWC and States Parties and to the enhancement of biological safety and security. From Ottawa to Hamburg, there are civil society assistance programs across the world that are available to support the implementation of the BWC. The catalogue includes organization and project descriptions and points of contact for each program, which aims to facilitate stronger connections between civil society and State Parties in need of assistance.”
“The Operational Risks of AI in Large-Scale Biological Attacks”
New from RAND: “The rapid advancement of artificial intelligence (AI) has far-reaching implications across multiple domains, including concern regarding the potential development of biological weapons. This potential application of AI raises particular concerns because it is accessible to nonstate actors and individuals. The speed at which AI technologies are evolving often surpasses the capacity of government regulatory oversight, leading to a potential gap in existing policies and regulations.”
“In this report, the authors share final results of a study of the potential risks of using large language models (LLMs) in the context of biological weapon attacks. They conducted an expert exercise in which teams of researchers role-playing as malign nonstate actors were assigned to realistic scenarios and tasked with planning a biological attack; some teams had access to an LLM along with the internet, and others were provided only access to the internet. The authors sought to identify potential risks posed by LLM misuse, generate policy insights to mitigate any risks, and contribute to responsible LLM development. The findings indicate that using the existing generation of LLMs did not measurably change the operational risk of such an attack.”
“Implementing The Bioeconomy Executive Order: Lessons Learned And Future Considerations”
Nazish Jeffrey breaks down the Federations of American Scientists’ Bioeconomy EO Tracker in this piece, writing “With the U.S. bioeconomy valued at over $950 billion and predicted to steadily increase, the potential for significant economic impact is unmistakable. To leverage this economic opportunity, the 2022 Bioeconomy Executive Order (EO) took a significant step towards addressing the complexities of the bioeconomy and creating a whole-of-government approach. The scope of the EO was vast, assigning around 40 tasks to many different federal agencies, in order to create a national framework to leverage bio-based innovations for sustainable economic growth.”
“To track the numerous tasks assigned by the EO, the Federation of American Scientists have put together a living Bioeconomy EO tracker to monitor the progress of these tasks, enhance accountability and to allow stakeholders to stay informed on the state of the U.S. bioeconomy as it evolves. This FAS tracker was inspired by the initial tracker created by Stanford University when the EO was first published.”
“Public Health Preparedness: HHS Emergency Agency Needs to Strengthen Workforce Planning”
In this new Government Accountability Office report, GAO recommends that “ASPR (1) establish specific goals and performance measures to use for its new hiring office once it is fully operational, (2) develop tailored strategies for recruiting and hiring human capital staff for the new office, (3) identify the critical areas that need workforce assessments and develop plans to implement them, and (4) conduct an agency-wide workforce assessment. HHS neither agreed nor disagreed with the first two recommendations and agreed with the last two recommendations. GAO believes actions are needed to address all of the recommendations.”
“Dissecting Pandemic-Prone Viral Families Volume 2: The Paramyxoviridae”
Amesh A. Adalja covers the Paramyxoviridae family in this volume of Johns Hopkins Center for Health Security’s Dissecting Pandemic-Prone Viral Families,” writing in part “Paramyxoviridae is a large viral family that contains many once common and wellknown human pathogens, such as measles and mumps, as well as other pathogens that pose concerns for their potential to cause epidemic or pandemic disease.1″
“This family of viruses infects a wide variety of species, ranging from reptiles to rodents and fish to birds. While diseases such as measles and mumps cause little morbidity and mortality in advanced societies today—because of high levels of vaccine-induced immunity—other members of this viral family have considerable burdens of infection with attendant morbidity and mortality risks. Also, within this family, there is one genus of consequence – Henipavirus – that has already been responsible for a number of serious emerging infectious diseases. The table below summarizes key genera and viruses of this family.1”
“The Overlooked Bacterial Pandemic”
Moriel et al. recently published this work in Seminars in Immunopathology: “The COVID-19 pandemic had a significant economic and health impact worldwide. It also reinforced the misperception that only viruses can pose a threat to human existence, overlooking that bacteria (e.g., plague and cholera) have severely haunted and shaped the course of human civilization. While the world is preparing for the next viral pandemic, it is again overlooking a silent one: antimicrobial resistance (AMR). This review proposes to show the impact of bacterial infections on civilization to remind the pandemic potential. The work will also discuss a few examples of how bacteria can mutate risking global spread and devastating outcomes, the effect on the global burden, and the prophylactic and therapeutic measures. Indeed, AMR is dramatically increasing and if the trend is not reversed, it has the potential to quickly turn into the most important health problem worldwide.”
“Etymologia: Ring Vaccination”
Sharma et al. recently published this short piece covering ring vaccination’s etymology in Emerging Infectious Diseases: “Ring Vaccination [rɪŋ-væk-sɪ′-neɪ-ʃn] Ring vaccination (expanding ring, surveillance and containment) is a public health measure designed to prevent spread of disease from infected persons to others. This approach targets persons who have had close contact with confirmed or suspected cases and are at a higher risk of infection by vaccinating them first (Figure).”
“Russian Military Thought and Doctrine Related to Non-strategic Nuclear Weapons: Change and Continuity”
William Alberque tackles Russian nuclear doctrine in this report for the International Institute for Strategic Studies: “Russian nuclear doctrine, especially regarding its large stockpile of non-strategic nuclear weapons, has become one of the most pressing issues in Euro-Atlantic security. This report aims to build an understanding of Russia’s strategic nuclear weapons doctrine through empirical research, including by examining the continuities and discontinuities in doctrine across time, through the Cold War, to the collapse of the Soviet Union, to Russia’s annexation of Crimea, and in Russia’s ongoing war on Ukraine.”
Global Partnership Against the Spread of Weapons and Materials of Mass Destruction Newsletter
The Global Partnership Against the Spread of Weapons and Materials of Mass Destruction’s newsletter is published quarterly and is available for subscription here. This quarter’s edition focuses on Italy’s upcoming Global Partnership presidency, the Partnership’s 2023 Programming Annex, featured articles, community updates, and more.
“UNITAD – Key Investigations as UN Mechanism Reaches Its Final Reporting Year”
Sam Biden covers the work of the UN Investigate Team to Promote Accountability Crimes Committed by Da’esh/ISIL (UNITAD), providing an overview of its key investigations in the last two years in this piece for the Human Security Centre. This includes UNITAD’s work on biological and chemical weapons, under which Biden explains in part, “2023 marked a significant stride in the relentless pursuit of accountability for ISIL’s chemical and biological weapons program. The investigation during this reporting period yielded substantial evidence from earlier inquiries strategies regarding the production and delivery of the weapons themselves. These key lines of inquiry harnessed new collaborations with technical experts, including those from the Mine Action Service, provided essential insights into a wide array of attacks. UNITADs work extended to collecting and preserving evidence linked to 12 attacks yet continued to focus on gathering further evidence from the 2016 attack on Tazah Khurmatu. This ultimately led to the collection of new battlefield evidence and files, shedding light on ISIL’s operations in Kirkuk and implicating specific persons of interest. A comprehensive report focused on the 2016 attack on Tazah Khurmatu was shared with the Iraqi judiciary, encapsulating critical findings from the ongoing investigation.”
ICYMI-“Event Summary: U.S.–UK Strategic Dialogue on Biosecurity”
“On January 16, the Council on Strategic Risks (CSR) hosted senior government leaders for the launch of the U.S.–UK Strategic Dialogue on Biosecurity at the historic National Academy of Sciences Building in Washington, D.C.”
“Building upon decades of partnership between the two countries, the Strategic Dialogue is a core component of the Atlantic Declaration—the new bilateral economic partnership established in 2023 to adapt, reinforce, and reimagine the U.S.-UK alliance for the challenges of the twenty-first century. Following the event, the U.S. National Security Council and the UK Cabinet Office released a joint statement outlining the Strategic Dialogue’s intent, including coordination to uphold global norms and commitments to lead on innovation in biotechnology and biosecurity.”
NEW: AI Rewards, Risks, and the Future of Biosecurity by Design (Pandemic Center Webinar)
From the Brown School of Public Health: “On January 24th at 1:00 PM EST the Pandemic Center will host a webinar titled AI Rewards, Risks, and the Future of Biosecurity by Design.”
“This event will bring together experts in biosecurity, global health, and pandemic prevention and response. Together, they will discuss the relationship between AI and biosecurity, with a focus on benefits, risks, and pragmatic solutions.”
“This event will be hosted and moderated by Beth Cameron, PhD, Professor of the Practice and Senior Advisor to the Pandemic Center.”
NEW: Kazakhstan’s Actions to Address Nuclear and Biological Risks
From the Cargenie Endowment for International Peace: “Upon the 1991 collapse of the Soviet Union, Kazakhstan found itself in possession of the world’s fourth-largest nuclear weapons stockpile and the former union’s most significant biological weapons factory. Kazakhstan’s subsequent decision to return and dismantle these weapons has solidified its position as a leader in nuclear and biological risk reduction. For the last thirty years, Kazakhstan’s actions have served as a core model for regional and international security.”
“Please join the Carnegie Endowment and the Council on Strategic Risks for a hybrid panel on Kazakhstan’s increasingly global role in the changing threat landscape of weapons of mass destruction. The discussion will feature Kazakhstan’s Ambassador to the United States of America Yerzhan Ashikbayev, the Honorable Andrew Weber, and Dr. Toghzan Kassenova. It will be moderated by Shannon Green, senior fellow at the Council on Strategic Risks.”
This event will take place on January 30 at 1:30 pm EST. Learn more and RSVP here.
NEW: WEBINAR: State Department 2023 Global Terrorism Data: Trends & Warnings
From Homeland Security Today: “Join HSToday for a Law Enforcement-only analysis of global terrorism trends from 2023 and threat forecasts for 2024. The Department of State’s yearly Annex of Statistical Information Reports uses The Global Terrorism Trends and Analysis Center (GTTAC) database.”
“Dr. Mahmut Cengiz, a senior data analyst at GTTAC since 2018, will discuss terrorism trends from 2023 and areas of concern for law enforcement in the United States (US). More specifically, his analyses will focus on HAMAS and Iran-backed terror groups targeting American facilities in the Middle East, Al Qaeda- and ISIS-affiliated organizations actively involved in terrorist attacks worldwide, increasing far-right terrorism and emerging lone actor threats in the US and Europe. The Terrorism, Transnational Crime and Corruption Center (TraCCC) is the first center in the United States devoted to understanding the links among terrorism, transnational crime and corruption, and to teach, research, train and help formulate policy on these critical issues. TraCCC is a research center within the Schar School of Policy and Government at George Mason University. TraCCC also houses the innovative and highly-respected Anti-Illicit Trade Institute (AITI).”
This event will take place on February 8 at 2 pm EST. Learn more and register here.
AI Executive Order Report Card Reviewing the First 90 Days
“On October 30, 2023, the Biden Administration issued a call to action outlining a host of requirements and deliverables for U.S. government agencies on artificial intelligence. The executive order touched on a range of AI-relevant issues, including testing and evaluation of new AI systems, developing a healthy and capable U.S. AI workforce, and ensuring U.S. competitiveness in the years to come.”
“Join CSET researchers on January 31, 2024, for a discussion of what the U.S. Government has accomplished so far, what have we learned, and what’s left to do to complete the EO’s ambitious goals.”
This online event will begin at 12 pmEST. Learn more and register here.
GP Nonproliferation and Strategic Trade Hub Virtual Launch & Demo
“The Strategic Trade Research Institute (STRI) invites you to participate in the Global Partnership Nonproliferation and Strategic Trade Hub Virtual Launch and Demo event taking place on February 27, 2024, from 9:00-10:00 am EST.”
“Please join us to learn about the main features of the Hub, how to use it, and how it can be useful and impactful for nonproliferation and export control professionals. The event will feature Andrea Viski, Director of STRI, as well as introductory remarks from the Hub’s sponsor, the United Kingdom’s Counter-proliferation and Arms Control Center (CPACC).”
International Conference, CBRNE Research & Innovation
“The last 40 years have demonstrated that both military and civilian populations could be exposed to highly hazardous CBRNE agents following conflicts, natural outbreaks and disasters, industrial incidents or terrorist attacks.”
“Worldwide, researchers, responders and industrial capacities have been commited to provide adapted response to these challenges.”
“Building on the success of the first 5 International Conferences « CBRNE Research and Innovation » which took place in Antibes (2015), Lyon (2017), Nantes (2019), on line (2021) and Lille (2022), we want to give you a new opportunity to build up or strengthen collaborative networks in Strabourg (March 19th – 21rst 2024).”
“The CBRNE R&I Conference is specifically devoted to scientific updates, responders’ feedbacks and expression of needs. It also includes workshops and demonstrations of innovative materials, technologies and procedures, according to the following themes: DETECTION – IDENTIFICATION, PROTECTION – DECONTAMINATION, MEDICAL COUNTERMEASURES, RISKS & CRISIS MANAGEMENT.”
“Looking forward to your proposals for communication and to welcoming you at Strasbourg in March 2024!”
Registration is now open for the Global Health Security 2024 conference in Sydney, Australia. This iteration will take place 18-21 June, 2024. The call for abstracts is also still open. “The mission of the Global Health Security conference is to provide a forum where leaders, researchers, policy-makers, and representatives from government, international organisations, civil society, and private industry from around the world can engage with each other, review the latest research and policy innovations, and agree solutions for making the world safer and healthier. To that end, our mission is to help foster a genuinely multidisciplinary community of practice that is committed to working collaboratively to enhance global health security and eliminate disease, irrespective of its origin or source.”
Happy New Year! This week covers reports of over 450 chemical attacks by Russia since the invasion of Ukraine in 2022, the fifth anniversary of DHS’ CWMD Office, and several recent publications.
Ukraine Reports Hundreds of Chemical Attacks by Russia Since Start of Invasion
In late December, the Kyiv Post published an article explaining a post from Ukraine’s Armed Forces Support Forces Command, which “claims that Russian troops have conducted 465 chemical attacks in Ukraine since the initiation of the full-scale invasion, with over 80 such attacks in December 2023, including one grenade containing a new, unknown chemical agent…The command notes an escalating trend in the use of such weapons by Russian forces, highlighting eight chemical attacks on Dec. 19 alone.”
The article continues, explaining “The commonly used weapons include grenades like K-51, RGR, and Drofa-PM gas hand grenades dropped from unmanned aerial vehicles (UAVs). Additionally, improvised explosive devices equipped with irritant substances and artillery shelling containing chemically dangerous substances are being employed.”
“The report mentions that 28 cases involving dangerous chemicals were documented and forwarded for investigative actions as part of criminal proceedings by groups of radiation, chemical, and biological intelligence from the military units of the Support Forces Command, working in collaboration with the Security Service of Ukraine (SBU).”
In case you missed it: Last summer, the Royal United Services Institute published an article on this topic, exploring the reported limited use of riot control agents and broader deployment of CW by Russia could mean in this war. The piece offers insight into Russia’s potential ogic in using these kinds of weapons in Ukraine, making it helpful in understanding this latest reporting.
DHS Celebrates Five Years of the Countering Weapons of Mass Destruction Office
In late December, the Department of Homeland Security celebrated the fifth anniversary of the founding of the Countering WMD Office. In an email update from the Department, Assistant Secretary for the Countering Weapons of Mass Destruction Office, Mary Ellen Callahan, was quoted saying “The threat of weapons of mass destruction terrorism is real. Five years ago, in the face of a dynamic, evolving threat environment, legislators recognized that the U.S. needed a more holistic approach to countering chemical, biological, radiological, and nuclear threats to the Homeland…By authorizing CWMD, the legislators enabled us to enhance and coordinate the chemical, biological, radiological, and nuclear detection efforts of federal, state, local, tribal, and territorial governments to improve preparedness and response capabilities throughout the United States. We look forward to continuing this essential mission to protect the American people.”
The update further explained “Congress established the CWMD Office in 2018 to elevate, consolidate, and streamline DHS efforts to protect the Homeland from weapons of mass destruction (WMD) and chemical, biological, radiological, and nuclear (CBRN) threats. CWMD serves as the DHS nexus for WMD and CBRN coordination, which includes providing direct financial and operational support nationwide to government and industry partners for full-time biological detection, illicit nuclear material detection, training, and exercises. Additionally, as part of the President’s Executive Order on AI signed in October 2023, President Biden tasked CWMD with helping to evaluate and mitigate the potential for AI to be used to develop WMDs, such as through AI-enabled misuse of synthetic nucleic acids to create biological weapons. The President directed the CWMD Office to evaluate the potential for AI to lower the barriers to entry for developing WMD and to develop a framework to evaluate and stress test synthetic-nucleic acid screening, creating a standardized set of expectations for third parties that audit AI systems to prevent the risk of abuse and proliferation by malicious actors.”
Defense Dossier Issue 38: “Pandemic Preparedness and Biodefense”
The American Foreign Policy Council’s December Defense Dossier is focused on biodefense and pandemic preparedness, featuring an article-“Parsing the Great Gain of Function Debate”-co-authored by Biodefense PhD Program alumni Yong-bee Lim and Saskia Popescu. It also includes other articles like “China’s Evolving Thinking About Biotechnology,” and “Understanding the Cyberbiosecurity Threat.” Read here.
“Virology-the Path Forward”
Rasmusen et al. recently published this commentary article in the Journal of Virology. They write in their abstract, “In the United States (US), biosafety and biosecurity oversight of research on viruses is being reappraised. Safety in virology research is paramount and oversight frameworks should be reviewed periodically. Changes should be made with care, however, to avoid impeding science that is essential for rapidly reducing and responding to pandemic threats as well as addressing more common challenges caused by infectious diseases. Decades of research uniquely positioned the US to be able to respond to the COVID-19 crisis with astounding speed, delivering life-saving vaccines within a year of identifying the virus. We should embolden and empower this strength, which is a vital part of protecting the health, economy, and security of US citizens. Herein, we offer our perspectives on priorities for revised rules governing virology research in the US.”
“Interpreting the Biological Weapons Convention – What Are “Necessary Measures” Under Article IV of the Convention?”
Sally Longworth recently published this report with the Swedish Defence Research Agency. She explains in her summary, “Article IV of the Biological Weapons Convention 1972 (BWC) requires States Parties to implement national implementation measures to prohibit and prevent the development, production, stockpiling, retention, acquisition, transfer, and use of biological agents, toxins and weapons in violation of the Convention. No definition of “national implementation measures” is included in the treaty, but there has been over 50 years of State practice in implementing this obligation, which can provide guidance on how States Parties interpret the obligations under Article IV. The Final Declarations agreed by consensus by States Parties at the Convention Review Conferences held every five years are particularly useful tools in understanding what measures are required and what, if any, development there has been in interpreting Article IV. Using legal methods to interpret international treaties, this memo first analyses the obligations set out in Article IV and then considers the interpretative value of the Final Declarations in relation to the BWC. It goes on to highlight a number of measures identified by the States Parties considered necessary in the implementation of the obligations contained in Article IV and important developments in what must be covered.”
“Vision, Needs, and Proposed Actions for Data for the Bioeconomy Initiative”
The National Science and Technology Council recently released this report from the Interagency Working Group on Data for the Bioeconomy. Its executive summary explains in part, “To realize a thriving bioeconomy, the Data Initiative identifies strategic investments and opportunities to leverage and build upon existing resources. The goal is to create an interwoven data fabric that connects data with the infrastructure and computational resources necessary to analyze, synthesize, and use those data for the widest audience. This vision depends on creation and adoption of community-driven standards, both for data and for repositories to enable interoperability and integration; training and education to build the bioeconomy data workforce of tomorrow; efforts to limit and mitigate security risks; and ongoing coordination to ensure efforts keep pace with transformations in data science, computing, biotechnology and biomanufacturing. While additional data are needed, government coordination and investment in infrastructure are also needed to make best use of the existing and anticipated data.”
Furthermore, in identifies seven Core Action areas the Data Initiative indicates requires “consistent whole-of-government coordination and investments”:
Dedicated long-term funding mechanisms for data and computational resources and infrastructure;
Standards to establish common best practices that foster and strengthen a shared U.S. bioeconomy data ecosystem;
Biodata Catalog to identify extant data and metadata;
Security practices and policies that secure the data landscape while supporting innovation;
Workforce to drive U.S. leadership in the bioeconomy of the future;
Strategically Targeted Areas for Rapid Transformation (START) to determine viability and impact and chart a course for larger investments; and
Coordination of intergovernmental investments, efforts, and resources.
“FACT SHEET: Biden-Harris Administration Releases Global Health Security Partnerships Annual Progress Report Demonstrating Results from United States Investments”
The White House recently released this fact sheet along with the release of its Global Health Security Partnerships Annual Progress Report. The fact sheet explains in its introduction, “The Biden-Harris Administration continues to prioritize global health security as a critical component of national biodefense. The COVID-19 pandemic, as well as HIV/AIDS, Ebola, mpox and other outbreaks in recent years, has demonstrated the catastrophic impacts infectious diseases can have on health, economies, and societies, regardless of where they start. The United States partners with countries around the world to build stronger global health security capacity – the ability to prevent, detect, rapidly respond to, and recover from new and emerging public health threats and prevent their spread across borders. Partnering with countries to stop infectious disease threats at their source, including by strengthening equitable health systems in their own countries and across regions, effectively protects the health of Americans and people across the world.”
“Exploring Actions for Epidemic and Pandemic Preparedness”
The National Academies recently released this Proceedings of a Symposium-in Brief: “Investing in pandemic preparedness ahead of disease outbreaks can greatly reduce the toll of epidemics and pandemics when they occur. Although several tools exist for assessing pandemic preparedness at an epidemiological and operational level, less information and fewer approaches are available to guide the prioritization of preparedness investments at the country level. The National Academies of Sciences, Engineering, and Medicine held an international, virtual symposium series in May and June 2023 to explore possible strategies for evidence-based prioritization of global health capabilities to prepare for future epidemics and pandemics. Speakers and participants discussed assessment tools for national action planning; country and organizational decision-making about funding priorities; effective approaches for disease surveillance and risk communication; governance structures that support robust and reliable systems for global health investments; and specific actions for tools and resource prioritization for preventing and preparing for future epidemics and pandemics. This publication summarizes the presentation and discussions of the symposium.”
“America Should Be More Like Operation Warp Speed”
Gary Hamel and Michele Zanini recently published this Ideas piece in The Atlantic focused on how OWS offers lessons for the rest of the government in achieving goals. They write in their introduction, “The U.S. government can achieve great things quickly when it has to. In November 2020, the Food and Drug Administration granted emergency-use authorization to the Pfizer-BioNTech vaccine for COVID-19. Seven days later, a competing vaccine from Moderna was approved. The rollout to the public began a few weeks later. The desperate search for a vaccine had been orchestrated by Operation Warp Speed, an initiative announced by the Trump administration that May. Developing, testing, manufacturing, and deploying a new vaccine typically takes a decade or more. OWS, which accomplished the feat in months, belongs in the pantheon of U.S. innovation triumphs, along with the Manhattan Project and the Apollo moon-landing program. It’s a case study in how the U.S. government can solve complex, urgent problems, and it challenges the narrative that public institutions have lost their ability to dream big and move fast.”
“Why the World Needs Its Own Immune System”
Atul Gawande, USAID’s Assistant Administrator for Global Health, recently published this opinion piece in The New York Times. He writes in part, “This is now the pattern: one emergency after another, often overlapping, diverting focus away from longer-term public health goals. And there’s no sign of this letting up. Displacement and activities like deforestation have increased contact between humans and wildlife — and thus the incidence of animal diseases leaping to humans. (The Ebola virus, for example, has been linked to bats as a possible source of spread.) The risk of outbreak-causing laboratory accidents is a significant concern as labs proliferate and safety measures lag. On average, between 1979 and 2015, more than 80 laboratory-acquired infections were reported per year, several involving transmission beyond those initially infected, and underreporting is rife. The growing field of synthetic virology has simultaneously generated lifesaving new treatments (mRNA vaccines, for example) and made it easier for bad actors to turn infectious diseases into weapons of mass destruction.”
“But we can break the pattern. Longer-range investment in local preparedness for such events — in building what I think of as a global immune system — could reduce the threat these crises pose and even reduce dependence on foreign aid to weather them. As dangers rise, so can our capacity to get ahead of them. With the right strategy, we could use the mishaps, malefactors and shocks we face to strengthen our capacity to adapt. This is not about developing resilience (the ability to recover from crisis) or robustness (the ability to resist crisis). It is about developing what the writer Nassim Nicholas Taleb has called antifragility — the ability to become stronger from crisis.”
“The OPCW and Civil Society: Considerations on Relevant Themes and Issues”
Alexander Ghionis recently published this working paper for CBWNet. He explains in its executive summary, “This paper explores some key elements of the relationship between the Organisation for the Prohibition of Chemical Weapons (OPCW) and civil society, with the specific and limited aim of supporting ongoing discussions being held within the OPCW regarding options and mechanisms to enhance that relationship. The paper is designed to be practical, providing readers from State Parties, the Technical Secretariat, civil society, and other stakeholders, with some initial perspectives, ideas, and considerations that could inform discussions.”
The paper addresses “The composition and focus of accredited civil society organisations (CSOs); How CSOs have engaged with the OPCW so far and what alternative modes of engagement may be beneficial; and, What foundational aspects can strengthen the relationship between the OPCW and civil society moving forward.”
“The Altered Nuclear Order in the Wake of the Russia-Ukraine War”
Rebecca Davis Gibbons, Stephen Herzog, Wilfred Wan, and Doreen Horschig recently published this research paper with the American Academy of Arts & Sciences. They explain in their executive summary: “On February 24, 2022, Russia invaded nonnuclear-armed Ukraine and leveraged threats with its nuclear arsenal as a “shield” to deter third-party intervention. The well-publicized horrors on the ground in Ukraine are, unfortunately, not the only consequences of Russia’s full-scale invasion of its neighbor. The war is having unmistakable effects on how governments, scholars, and the public think about nuclear arms. Not only has Moscow reintroduced the world to the often-unsavory realities of nuclear deterrence, but its suspension of the New Strategic Arms Reduction Treaty (START) and deratification of the Comprehensive Nuclear-Test-Ban Treaty (CTBT) have been setbacks for arms control and disarmament. Meanwhile, vulnerable states around the globe may be further incentivized to develop nuclear weapons or seek protection from nuclear-armed patrons to avoid being invaded like Ukraine.”
“Given these changing geopolitical circumstances, how might the Russian war on Ukraine affect the global nuclear order? The authors in this publication conclude that the United States and the broader international community must now more seriously engage with alternatives to traditional arms control, nonproliferation, and disarmament endeavors. Specifically, the authors discuss the increasing prominence of approaches such as the Treaty on the Prohibition of Nuclear Weapons (TPNW)—popularly known as the Nuclear Ban—and risk reduction measures. They assess whether these initiatives can have an impact in reducing nuclear dangers. Additionally, they examine temptations for states to pursue more forceful counterproliferation measures and describe the risks of doing so.”
NEW: “When Medicine Stops Saving Us: The Antimicrobial Resistance Crisis”
“Interim Dean Abel Valenzuela and the UCLA Division of Social Sciences present an exclusive screening of a new documentary from the team behind the award winning NETFLIX documentary, RESISTANCE. This genre-bending short film, HOLOBIOME, features the harrowing story of UCLA graduate Bradley Burnam’s personal encounter with a deadly superbug. Through a variety of creative elements, HOLOBIOME examines the need for innovation in AMR and questions the overall human relationship with infectious disease and the microbial world. The screening will be followed by an interdisciplinary panel discussing the looming AMR crisis through the lenses of sociology, public policy, industry, and public health.”
This event will be moderated by Biodefense PhD Program alumna Jomana Musmar. It will take place on January 22, at 5 pm PST. Learn more and register here.
NEW: AI Executive Order Report Card Reviewing the First 90 Days
“On October 30, 2023, the Biden Administration issued a call to action outlining a host of requirements and deliverables for U.S. government agencies on artificial intelligence. The executive order touched on a range of AI-relevant issues, including testing and evaluation of new AI systems, developing a healthy and capable U.S. AI workforce, and ensuring U.S. competitiveness in the years to come.”
“Join CSET researchers on January 31, 2024, for a discussion of what the U.S. Government has accomplished so far, what have we learned, and what’s left to do to complete the EO’s ambitious goals.”
This online event will begin at 12 pmEST. Learn more and register here.
International Conference, CBRNE Research & Innovation
“The last 40 years have demonstrated that both military and civilian populations could be exposed to highly hazardous CBRNE agents following conflicts, natural outbreaks and disasters, industrial incidents or terrorist attacks.”
“Worldwide, researchers, responders and industrial capacities have been commited to provide adapted response to these challenges.”
“Building on the success of the first 5 International Conferences « CBRNE Research and Innovation » which took place in Antibes (2015), Lyon (2017), Nantes (2019), on line (2021) and Lille (2022), we want to give you a new opportunity to build up or strengthen collaborative networks in Strabourg (March 19th – 21rst 2024).”
“The CBRNE R&I Conference is specifically devoted to scientific updates, responders’ feedbacks and expression of needs. It also includes workshops and demonstrations of innovative materials, technologies and procedures, according to the following themes: DETECTION – IDENTIFICATION, PROTECTION – DECONTAMINATION, MEDICAL COUNTERMEASURES, RISKS & CRISIS MANAGEMENT.”
“Looking forward to your proposals for communication and to welcoming you at Strasbourg in March 2024!”
Registration is now open for the Global Health Security 2024 conference in Sydney, Australia. This iteration will take place 18-21 June, 2024. The call for abstracts is also still open. “The mission of the Global Health Security conference is to provide a forum where leaders, researchers, policy-makers, and representatives from government, international organisations, civil society, and private industry from around the world can engage with each other, review the latest research and policy innovations, and agree solutions for making the world safer and healthier. To that end, our mission is to help foster a genuinely multidisciplinary community of practice that is committed to working collaboratively to enhance global health security and eliminate disease, irrespective of its origin or source.”
Vote: 2023 Arms Control Person(s) of the Year Nominees
“Since 2007, the independent, nongovernmental Arms Control Association has nominated individuals and institutions that have, in the previous 12 months, advanced effective arms control, nonproliferation, and disarmament solutions and raised awareness of the threats posed by mass casualty weapons.”
“In a field that is often focused on grave threats and negative developments, the Arms Control Person(s) of the Year contest aims to highlight several positive initiatives—some at the grassroots level, some on the international scale—designed to advance disarmament, nuclear security, and international peace, security, and justice.”
“Voting will take place between Dec. 8, 2023, and Jan. 11, 2024. The results will be announced on Jan. 12, 2024. Follow the discussion on social media using the hashtag #ACPOY2023.”
Happy first day of winter! This week we are covering updates on Russia’s actions in Ukraine, anthrax outbreaks in parts of Africa, efforts to get the Pandemic and All-Hazards Preparedness Act reauthorized, and OpenAI’s plan to manage threats posed by its AI platforms. This is the last issue of the Pandora Report for 2023. We will see you next year but, until then, have a happy rest of the holiday season!
Russia Tear Gases UkrainianForces
Recent reporting from CNN explained that, in addition to using wave after wave of convicts-turned-recruits, Russia has increasingly begun to use CS gas on Ukrainian forces: “Those fighting in besieged Ukrainian trenches say they now face another threat: the use of gas as a weapon. Nine incidents have been recorded in recent weeks in this area, one Ukrainian combat medic told CNN, in which a caustic and flammable gas had been dropped by drones onto Ukrainian lines, causing one fatality. The gas is used to cause panic and followed by conventional shelling or drone attacks, soldiers impacted said…A Ukrainian intelligence official told CNN the substance deployed by the Russians was a form of CS gas.”
CS (chlorobenzylidenemalononitrile) gas, commonly referred to colloquially as tear gas, is used as a riot control agent. According to the CDC, these agents “…are chemical compounds that temporarily make people unable to function by causing irritation to the eyes, mouth, throat, lungs, and skin.” Use of these agents in war is prohibited under the Chemical Weapons Convention.
The same CNN report later explained that “Two soldiers who survived a gas attack showed CNN medical reports indicating they had been poisoned. “At first I saw smoke,” one told CNN. “We ran out from the trench and the gas suddenly caught fire. The trench was in flames. This gas burns, blinds you, you can’t breathe, shoots down your throat immediately. We didn’t even have a second.”‘
“The alleged use of chemical agents on the battlefield marks another sign of the brutality and mendacity of Russia’s renewed fight for the terrain it lost. Ukraine had hoped for greater advances during the summer toward the Azov Sea, yet now must defend its minor gains.”
Russian Troops Reportedly Dying from “Mouse Fever”
Russian troops in Ukraine’s Kharkiv region are reportedly suffering an outbreak of “mouse fever,” a hemorrhagic fever. Ukraine’s Main Directorate of Intelligence of the Ministry of Defence of Ukraine (HUR) recently reported that “dissatisfaction is growing in the units of the Russian occupation army due to inadequate provision of winter clothing and a complete lack of medical care,” likely contributing to the rapid spread of this disease.
The Kyiv Post also explained that HUR reports that complaints about the outbreak on the front lines fell on deaf ears, with Russian leadership viewing them as “…another manifestation of attempts to avoid combat operations.” HUR has also reported that the disease initially presents with flu-like symptoms, and that it is a viral disease transmitted to humans from rodents via contact with bodily fluids. As the same Kyiv Post article explains, “Symptoms of mouse fever include severe headache, fever up to 40 degrees, rashes and redness, low blood pressure, hemorrhages in the eyes, nausea, and vomiting several times a day. The disease also affects the kidneys, a person infected with mouse fever experiences intense low back pain and will have serious difficulty urinating.”
HUR’s reporting on the outbreak did not identify a specific pathogen, though it did suggest this could be hemorrhagic fever with renal syndrome (HFRS), driving online speculation that this outbreak was caused by a hantavirus despite some outlets reporting it was caused by the bacterial rat-bite fever. The WHO explains that HFRS is “…an acute interstitial nephropathy characterized by high fever and varying degrees of renal insufficiency and hemorrhage. HFRS is caused by viruses belonging to the old world lineage of the Hantavirus genus of the family Bunyaviridae.”
The WHO further explains that “Various haemorrhagic fevers with a very similar syndrome have been reported throughout Europe and Asia, notably HFRS in the former Soviet Union, Songo fever in China, epidemic nephritis or epidemic haemorrhagic fever in Eastern Europe and Japan, and Hantaan virus in Korea. Several rodents and other small mammals harbor hantaviruses, and in urban areas, where rodent control is feasible, efforts can be made to reduce contact between humans and rodent excreta.”
Regardless of what is causing this outbreak, this is a tale as old as time. War and disease go hand-in-hand, highlighting the importance of maintaining sanitary practices, particularly when turning to trench warfare. Russia’s military has historically struggled with maintaining sanitary conditions, as noted by Amnesty International in the late 1990s and Russia’s own inspectors in the early 2010s, all of which has conicided with persistent challenges in professionalizing the military and maintaining supply lines during the current conflict.
Five African Countries Report Anthrax Outbreaks
The WHO has confirmed that five countries in eastern and southern Africa are experiencing outbreaks of anthrax, with at least 20 related deaths reported since the start of 2023. There are currently over 1,160 presumed anthrax cases in Kenya, Malawi, Uganda, Zambia, and Zimbabwe, though only 35 have been confirmed by laboratory testing. Zambia is currently fighting its largest anthrax outbreak since 2011, with nine of its ten provinces impacted. Though experts say this all is not unusual nor unreasonable, it is notable that, in Uganda, many of the presumed cases have tested negative for anthrax, potentially indicating a different disease is circulating.
The WHO explained in its December 11 press release on the matter that, “The outbreaks are presenting varied patterns in the affected countries. In Kenya, three deaths have been reported this year compared with zero fatalities from over 200 suspected cases in 2022. While the disease is endemic in animals in Malawi, the country reported its first ever human case this year. Human anthrax cases have been reported in three districts in Uganda, with 13 deaths compared with two deaths in 2022. The high case fatality ratio is due to patients reporting late to health facilities. In Zimbabwe, human cases have been reported every year since 2019, underscoring the need for stronger preventive actions.”
“Joint multidisciplinary teams have deployed at country level to support assessments, identify gaps and take measures to strengthen the outbreak response. WHO is also working closely with the Food and Agriculture Organization of the United Nations (FAO), United Nations Environment Programme and World Organisation for Animal Health to coordinate response in the affected countries leveraging the One Health Platforms…The outbreaks are likely being driven by multiple factors, including climatic shocks, food insecurity, low risk perception and exposure to the disease through handling the meat of infected animals.”
115 Organizations Urge Congress to Reauthorize PAHPA
A list of 115 organizations is formally calling on Congress to reauthorize the bipartisan Pandemic and All-Hazards Preparedness Act (PAHPA), according to a press release from the Senate Health, Education, Labor and Pensions (HELP) Committee. PAHPA expired on September 30 and has yet to be reauthorized by Congress, though the HELP Committee did pass legislation to reauthorize it in a 17-3 vote this summer.
The HELP Committee explained in its statement “Congress first enacted PAHPA in 2006, largely to address the failures of the federal response following Hurricane Katrina. The legislation sought to support states, local governments, and hospitals so they would be better prepared for future emergencies. It established the Office of the Assistant Secretary for Preparedness and Response (ASPR) and the Biomedical Advanced Research and Development Authority (BARDA). It also made improvements to the National Disaster Medical System and other resources to improve medical surge capacity during an emergency. PAHPA was previously reauthorized on a bipartisan basis in 2013 and 2019.”
A list of the 115 organizations involved is available at the link above.
OpenAI Unveils Plan for Managing AI Dangers
OpenAI, the company perhaps most famous for its ChatGPT chatbot, recently announced how it plans to prepare for what it believes to be potential threats posed by the technology it develops. A recent article from The Washington Post explains the plan, reading “OpenAI’s “Preparedness” team, led by MIT AI professor Aleksander Madry, will hire AI researchers, computer scientists, national security experts and policy professionals to monitor the tech, continually test it and warn the company if it believes any of its AI capabilities are becoming dangerous. The team sits between OpenAI’s “Safety Systems” team, which works on such existing problems as infusing racist biases intoAI, and the company’s “Superalignment” team, which researches how to ensure AI doesn’t harm humans in an imagined future where the tech has outstripped human intelligence completely.”
“The preparedness team is hiring national security experts from outside the AI world who can help OpenAI understand how to deal with big risks. It is beginning discussions with organizations, including the National Nuclear Security Administration, which oversees nuclear technology in the United States, to ensure the company can appropriately study the risks of AI, Madry said.”
“The team will monitor how and when OpenAI’s tech can instruct people to hack computers or build dangerous chemical, biological and nuclear weapons, beyond what people can find online through regular research. Madry is looking for people who “really think, ‘How can I mess with this set of rules? How can I be most ingenious in my evilness?’”
“Dr. Jomana Musmar, MS, PhD – Designated Federal Officer and Executive Director – PACCARB”
Check out this conversation with Biodefense PhD Program alumna Jomana Musmar on the Progress, Potential, and Possibilities YouTube channel: “Dr. Jomana Musmar, MS, PhD, is the Designated Federal Officer and Executive Director of the Presidential Advisory Council on Combating Antibiotic Resistant Bacteria ( https://www.hhs.gov/ash/advisory-comm… ), and Senior Public Health Advisor within the Office of Infectious Diseases and HIV/AIDS Policy ( https://www.hhs.gov/oidp/index.html ), at the U.S. Department of Health and Human Services (HHS).”
“The Presidential Advisory Council on Combating Antibiotic-Resistant Bacteria ( PACCARB – https://www.hhs.gov/ash/advisory-comm… ) is a US federal advisory committee that provides advice, information, and recommendations to the U.S. Secretary of Health and Human Services (HHS Secretary). The council supports and evaluates U.S. government activities focused on fighting antimicrobial resistance (AMR) in human health, animal health, and environmental health. Using this One Health approach, members of the PACCARB have expertise from a range of backgrounds, including academia, industry, public health, advocacy, veterinary, and agricultural production.”
“Dr. Musmar has been managing the PACCARB since its establishment in 2015, during which time she has hosted 24 public meetings and overseen the development of seven reports providing recommendations on a range of issues related to antimicrobial-resistance (AMR) for both human and animal health.”
“Dr. Musmar has over 10 years of Federal Advisory Committee experience, with a focus on the areas of public health, biodefense, and AMR. Her graduate degrees include a Master’s in Biomedical Science Policy from Georgetown University School of Medicine and a Doctorate in Biodefense and Homeland Security from George Mason University.”
“The Health Security Outcomes of APEC and the Biden-Xi Dialogue”
Recent Biodefense MS grad Sophie Hirshfield just published this piece for CSIS, addressing key global health questions following the APEC summit and Biden-Xi meeting. She explains in her introduction, “From November 14 to 16, leaders from the 21-member Asia-Pacific Economic Cooperation (APEC) group met in San Francisco to discuss promoting trade and economic growth across the Pacific region. On the sidelines of the forum, Presidents Joe Biden and Xi Jinping convened for their first in-person meeting in a year. While the meetings provided an opportunity to keep public health priorities on the diplomatic agenda, they led to few meaningful new commitments on U.S.-China health security cooperation.”
“Public Health Agencies Are Using AI Chatbots to Ease Workloads. Is It a Good Idea?”
Biodefense PhD Student Kimberly Ma recently published this piece with The Bulletin of the Atomic Scientists. In it, she explains in part, “There’s a real risk that large-language models like ChatGPT contribute to online disinformation and misinformation. In a call earlier this year for the safe and ethical use of AI, the World Health Organization (WHO) worried that AI responses “can appear authoritative and plausible to an end user” but be “completely incorrect or contain serious errors, especially for health-related” matters. Similarly, the organization warned AI may be “misused to generate and disseminate highly convincing disinformation in the form of text, audio or video content that is difficult for the public to differentiate from reliable health content.” Just as media organizations have been caught publishing AI-generated content riddled with inaccuracies, public health workers need to ensure they are not accidentally producing well-intentioned deliverables with critical errors. And in an environment when adversarial countries, antivaxxers, and politicians operate individually or in networks to spread disinformation online, public health agencies will be up against bad actors with the same technology they have.”
“Preparing for the Next Pandemic Response Through Strengthened Collaboration”
Donnel Harvin, a member of the Schar School faculty, recently co-authored this white paper for NEMA: “This report synthesizes the insights from the National Emergency Management Association (NEMA) Pandemic Workshop hosted in June of 2023. The Centers for Disease Control and Prevention (CDC) funded the project. The workshop brought together emergency management directors and state public health officers from eight states to discuss their collaborative response to the COVID-19 pandemic in the very early phases of the response, January 2020 – January 2022. The particular focus was on the identification of friction points, successes, and opportunities for increased collaboration. Federal partners were invited to discuss issues with federal integration into state COVID-19 response efforts. The discussions highlighted a range of complex issues encompassing roles and authorities, data collection and sharing, equity concerns, and communication, with an emphasis on state and local levels as well as rural and urban experiences.”
“Advancing Governance Models for Frontier for AIxBIO: Key Takeaways and Action Items from the Johns Hopkins Center for Health Security Metting with Industry, Government, and NGOs, 29 November 2023”
Johns Hopkins Center for Health Security recently published a “…summary of high-level findings that identify concrete next steps needed following its recent convening of leading AI labs, executive branch officials, and biosecurity experts…” that “was informed by discussions during a not-for-attribution meeting hosted by the Center. The meeting was attended by around 50 participants, including those from 6 different leading AI companies as well as government officials from the White House and several government agencies with responsibility for managing potential AIxBio risks.”
The report calls for “…the creation of an ongoing public-private forum to facilitate the sharing of important information related to biosecurity risks; a regulatory framework that defines mandatory practices, reporting, and oversight of highly capable AI models; and a legal accountability framework to incentivize developers and deployers of models to adequately address emergent risks.”
“Generative AI and Weapons of Mass Destruction: Will AI Lead to Proliferation?”
Ian Stewart unpacks potential proliferation threats posed by LLMs in this Medium post, writing in part “Large Language Models (LLMs) caught popular attention in 2023 through their ability to generate text based on prompts entered by the user. LLMs have also proven capable of generating code, summarizing text, and adding structure to unstructured text, among others. There remain questions around the real-world usefulness of LLMs in many domains, particularly given some of the difficulties in solving limitations of LLMs such as hallucination. Nonetheless, some have raised concerns about the ability of LLMs to contribute to nuclear, chemical and biological weapons proliferation (CBRN). Put simply, could a person learn enough through an interaction with an LLM to produce a weapon? And if so, would this differ from what the individual could learn by scouring the internet?”
“Poll: Voters Support Bringing EU-Style AI Regulations to the US, Prioritizing Safety Over Speed in Research”
New from the Artificial Intelligence Policy Institute: “A new poll conducted by the Artificial Intelligence Policy Institute (AIPI) shows that the American public supports the passage of the European Union’s AI Act by nearly a 4:1 margin, and 64% support similar regulation in the United States.”
“The survey showed strong public support for a slowdown of AI research and skepticism of tech companies; respondents decisively back federal regulation that curbs rapid AI research and development by private companies. By a 2:1 margin, respondents agree that it is the role of the government to make sure companies don’t go too fast when developing AI models. 75% say the government should restrict what private companies can do when training AI models.”
“AIPI also surveyed public opinion on risky research initiatives across AI development and dangerous virus research—particularly relevant as scientists and the federal government look to revise guidelines on potential pandemic pathogens. 83% of the public is in agreement that the federal government should implement renewed oversight protocols on research experiments using dangerous viruses. When prompted about AI being in such research, 68% say that we should be concerned that bad actors could use AI to create biological weapons.”
“Shaping the Future US Bioeconomy Through Safety, Security, Sustainability, and Social Responsibility”
Attal-Juncqua et al. recently published this article in Trends in Biotechnology: “Biomanufacturing practitioners and researchers describe the norms that should govern the growing, global field, to include safety, security, sustainability, and social responsibility. These ‘4S Principles’ should be broadly adopted so that the future of the field may provide the greatest benefits to society.”
“Stability of Pathogens on Banknotes and Coins: A Narrative Review”
Meister et al. recently published this article in the Journal of Medical Virology: “For the prevention of infectious diseases, knowledge about potential transmission routes is essential. Pathogens can be transmitted directly (i.e. respiratory droplets, hand-to-hand contact) or indirectly via contaminated surfaces (fomites). In particular, frequently touched objects/surfaces may serve as transmission vehicles for different clinically relevant bacterial, fungal, and viral pathogens. Banknotes and coins offer ample surface area and are frequently exchanged between individuals. Consequently, many concerns have been raised in the recent past, that banknotes and coins could serve as vectors for the transmission of disease-causing microorganisms. This review summarizes the latest research on the potential of paper currency and coins to serve as sources of pathogenic viral, bacterial, and fungal agents. In contrast to the current perception of banknotes and coins as important transmission vehicles, current evidence suggests, that banknotes and coins do not pose a particular risk of pathogen infection for the public.”
What We’re Watching 🍿
The Biological Weapons Convention and the Need for a Compliance and Verification Mechanism
New from the Geneva Center for Security Policy: “The GCSP’s Head of Arms Control and Disarmament speaks to three experts on biological security from King’s College London about the start of discussions by the States Parties to the Biological Weapons Convention (BWC) on compliance and verification. They discuss why a compliance and verification mechanism is needed, what can be learned from the previous verification efforts in other contexts, and what has changed in how verification is done since this was last discussed in the BWC framework over 20 years ago. The experts also discuss what the key elements of any mechanism will need to be, what are the most important bio security incidents, and how countries are working on their preparedness to respond to such incidents. The GCSP will be following the discussions in the BWC closely and stands ready to be a platform to bring together all stakeholders to generate new thinking to strengthen the BWC to respond to today’s bio security challenges.”
What We’re Listening To 🎧
PODCAST | Rethinking Our Defense Against Unknown Biothreats
“Dr. Harshini Mukundan, Program Manager and Scientist for Chemical and Biological Technologies at the Office of National and Homeland Security, Lawrence Berkeley National Laboratory, and visiting Scientist at Los Alamos National Laboratory sat down with host and AAAS STPF fellow Adejare (Jay) Atanda to discuss her research on pathogen agnostic disease detection and diagnostics, why this is important for biodefense against unknown biothreats, the role of technological innovations in pathogen agnostic detection and diagnostics, limitations of existing technological tools, and the vital importance of public-private partnerships in transforming this field. This conversation also covered the challenges women, people of color and immigrants face as scientists, the importance of mentorship in mitigating these challenges and her own mentorship and advocacy work to educate young girls about STEM careers as a AAAS IF/THEN STEM Ambassador and guest on CBS’s “Mission Unstoppable” among other efforts.”
Poisons and Pestilence: 20 Bonus Episode: No Fire No Thunder with Alastair Hay
Check out this episode with Alastair Hay, discussing his work as a toxicologist as it relates to the prohibition of chemical weapons.
61st ISODARCO Course: Nuclear Order and International Security after Ukraine
“The war in Ukraine has had an enormous impact on global security, reviving nuclear fears, undermining the prospects for arms control, and shattering many of the norms and constraints that were the foundation of European security. ISODARCO 2024 will examine the global nuclear order in light of the Ukraine war, focusing on the states, the policies and the technologies that will shape the future in a much more difficult environment. How will we cope with this more dangerous world?”
This course will take place January 7-14, 2024, at the University of Trento. Learn more and register here.
International Conference, CBRNE Research & Innovation
“The last 40 years have demonstrated that both military and civilian populations could be exposed to highly hazardous CBRNE agents following conflicts, natural outbreaks and disasters, industrial incidents or terrorist attacks.”
“Worldwide, researchers, responders and industrial capacities have been commited to provide adapted response to these challenges.”
“Building on the success of the first 5 International Conferences « CBRNE Research and Innovation » which took place in Antibes (2015), Lyon (2017), Nantes (2019), on line (2021) and Lille (2022), we want to give you a new opportunity to build up or strengthen collaborative networks in Strabourg (March 19th – 21rst 2024).”
“The CBRNE R&I Conference is specifically devoted to scientific updates, responders’ feedbacks and expression of needs. It also includes workshops and demonstrations of innovative materials, technologies and procedures, according to the following themes: DETECTION – IDENTIFICATION, PROTECTION – DECONTAMINATION, MEDICAL COUNTERMEASURES, RISKS & CRISIS MANAGEMENT.”
“Looking forward to your proposals for communication and to welcoming you at Strasbourg in March 2024!”
Registration is now open for the Global Health Security 2024 conference in Sydney, Australia. This iteration will take place 18-21 June, 2024. The call for abstracts is also still open. “The mission of the Global Health Security conference is to provide a forum where leaders, researchers, policy-makers, and representatives from government, international organisations, civil society, and private industry from around the world can engage with each other, review the latest research and policy innovations, and agree solutions for making the world safer and healthier. To that end, our mission is to help foster a genuinely multidisciplinary community of practice that is committed to working collaboratively to enhance global health security and eliminate disease, irrespective of its origin or source.”
Vote: 2023 Arms Control Person(s) of the Year Nominees
“Since 2007, the independent, nongovernmental Arms Control Association has nominated individuals and institutions that have, in the previous 12 months, advanced effective arms control, nonproliferation, and disarmament solutions and raised awareness of the threats posed by mass casualty weapons.”
“In a field that is often focused on grave threats and negative developments, the Arms Control Person(s) of the Year contest aims to highlight several positive initiatives—some at the grassroots level, some on the international scale—designed to advance disarmament, nuclear security, and international peace, security, and justice.”
“Voting will take place between Dec. 8, 2023, and Jan. 11, 2024. The results will be announced on Jan. 12, 2024. Follow the discussion on social media using the hashtag #ACPOY2023.”
This week covers the FDA’s ongoing investigation into contaminated applesauce, the passing of Gao Yaojie-an activist responsible for bringing to light the extent of China’s AIDS epidemic-, and more.
Biodefense MS Graduates Riley Flynn and Sophie Hirshfield at GMU’s 2023 Winter Commencement Ceremony
FDA Leadership Says Tainted Applesauce Pouches May Have Been Intentionally Contaminated
Cinnamon applesauce pouches available Weis, WanaBanana, and Schnucks have been pulled from shelves after they were found to be contaminated with lead. Dozens of children in the United States have been sickened by the tainted products. Now, the FDA’s Deputy Commissioner for Human Foods, Jim Jones, says they may have been intentionally contaminated.
In an interview with Politico, Jones said “We’re still in the midst of our investigation. But so far all of the signals we’re getting lead to an intentional act on the part of someone in the supply chain and we’re trying to sort of figure that out.” All of the pouches in question were linked to a manufacturing facility in Ecuador that the FDA is currently inspecting.
‘“My instinct is they didn’t think this product was going to end up in a country with a robust regulatory process,” Jones said. “They thought it was going to end up in places that did not have the ability to detect something like this.”’
Politico further explained that “The FDA continues to investigate a number of theories for how the pouches became contaminated, and has not drawn any conclusions about the way the lead was added, why or by whom. The FDA says it currently believes the adulteration is “economically motivated.” That generally refers to ingredients being altered in order to make products appear higher in value, often so companies can produce a cheaper item and sell it at an elevated price.”
“The agency and the Centers for Disease Control and Prevention have collaborated with state and local health authorities as well as Ecuadorian authorities to trace the origin of the cinnamon in the applesauce pouches, which is believed to be the source of the lead contamination. More than 60 U.S. children under the age of 6 have tested positive for lead poisoning after consuming the pouches — some at levels more than 500 times the acceptable threshold for lead, according to The Washington Post.”
Gao Yaojie, Chinese Physician and Self-Exiled AIDS Activist, Dead at 95
Gao Yaojie, a gynecologist and well-known AIDS activist, died on December 10 in New York City. Gao, formerly based in China’s Henan province, was famous for her work to expose the outbreak of HIV/AIDS in the country in the 1990s and 2000s. The outbreak was large in scale and primarily driven by the country’s Plasma Economy, which arose because of restrictions on foreign imports of blood products in the 1990s. This resulted in blood plasma donation becoming a way for rural populations to make money in government-supported plasma donation centers. However, unsafe practices like repeated use of unsterilized needles and pooling multiple donors’ blood during the plasmapheresis allowed HIV to spread widely.
Because of the Chinese government’s efforts to suppress reporting on this epidemic, poor rural populations were left largely unaware of the dangers of plasma donation and the public in general was unaware of the severity of the crisis. Gao was one of the first to speak publicly about the outbreak, helping draw the attention of media outlets. She later told documentary filmmakers about her motivations for doing this, saying, “My driving thought is: how can I save more people from dying of this disease? We each only live one life.”
It is estimated that at least one million Chinese were infected with HIV during this epidemic, highlighting the importance of Gao’s and others’ bravery. For this, she garnered praise from the United Nations, several Western organizations, and even Hillary Clinton. This rising fame led to her being placed under house arrest in 2007, with about 50 police preventing her from traveling to the United States to accept an award recognizing her work. In response to this, she told NPR “I think they feel I got in the way of their political achievements and their official careers…Otherwise, why would they put me under house arrest? What law did I break to warrant mobilizing all these police?”
NPR further explained her activities later in life in their article on her passing, writing: “Despite pressure from Henan provincial authorities to stop publicizing the AIDS crisis, she continued her work, using all the proceeds from her books and pamphlets to support AIDS families, especially children orphaned by the disease or the many suicides that it caused.”
“Restrictions on her movement began hindering in work in China, however, and in 2009, she abruptly fled to the US, after fearing she would be put under house arrest again. Many admirers continued to visit her apartment in West Harlem, including a group of young Chinese students who kept her company in the loneliness of exile.”
‘”Many Chinese regarded her as a hero, and when they came to New York, if they didn’t know how to contact her , [sic] they would ask me. I would ask them for an email written in Chinese and would forward it to her. So far as I know, she always wrote back to those people and welcomed them to come visit,” remembers Andrew Nathan, a political science professor at Columbia University who handled much of Gao’s affairs in New York.”
“The Biological and Toxin Weapons Convention in 2023: Glimmers of Progress Set Against a Troubled Geopolitical Landscape”
Experts at CSR’s Nolan Center, including Biodefense PhD Program alumna and current faculty member Saskia Popescu, recently authored this blog post focused on the BWC’s potential for success in verification, universalization and effective implementation in Africa, and the creation of an International Agency for Biological Safety. They explain in their introduction: “For nearly two decades, efforts to strengthen the Biological and Toxin Weapons Convention (BWC) were in stasis, with opportunities missed and States Parties unable to agree to definite action. States Parties arrived at the Review Conference last year facing a growing biological weapons threat—augmented by rapidly converging complimentary technologies—coupled with a status quo in the BWC that was insufficient for the task. Yet nations drove a breakthrough: the consensus achieved at last year’s Review Conference proved that action is still possible despite the challenging international security environment.”
“In a world in which biological threats and vulnerabilities are exceedingly complex, there is a critical need to reinforce relationships among global experts, national governments, and civil society. Over the past two weeks, these stakeholders have met to identify, examine, and develop specific and effective measures to strengthen the Convention. An unwavering theme throughout the Meeting of States Parties underscored that preparedness and resilience are investments, rather than costs, reinforcing the deterrence by denial efforts CSR continues to promote. Although the challenging international security environment continues to hinder progress there are glimmers of genuine progress across several fronts…”
“Biosecurity in the Americas: Regional Threat Assessment”
A new from UMD’s START, co-authored by Biodefense MS Program alumna Alexandra Williams: “This publication, currently available in Spanish, provides a breadth and depth of focuses as a high-level assessment of the Central and South America regions and introduction to key topics as:
The needed expansion of understanding of the differences and areas of collaboration between the concepts of biosafety and biosecurity,
Existing international obligations to biosecurity through the BWC and UNSC Resolution 1540,
How biosecurity applies to and may differ in application across a variety of facility types that engage in biological research or production, whether private or public laboratories, agricultural or university-based facilities,
Biosecurity risks that include proliferation, bioterrorism, agroterrorism, and biocrime,
The five pillars and mechanisms of biosecurity,
Lastly, the application of biosecurity in the Central and South American regions.”
“NTI|Bio Convenes Workshop on Disincentivizing State Bioweapons Development and Use”
From NTI: “A week ahead of the Biological Weapons Convention (BWC) Working Group meetings in Geneva, Switzerland, NTI | bio convened a workshop on “Disincentivizing State Bioweapons Development and Use.” This two-day workshop on November 29 and 30 brought together academics, diplomats, biosecurity experts, and government policy makers to begin developing a cross-disciplinary thought and practice community to explore and develop potential disincentivizing solutions. Current thinking and policy on disincentivizing bioweapons acquisition and use is underdeveloped—especially by comparison with the nuclear security field.”
‘“We launched this effort because we see the need for more rigorous thinking on effective approaches to making bioweapons unattractive to nation-states,” said NTI | bio Vice President Jaime Yassif. “NTI’s goal is to bridge theory and practical policy-relevant approaches to develop new ideas that can invigorate international efforts to reduce biological threats.”’
Biodefense Graduate Program Director Gregory Koblentz and Associate Professor Sonia Ben Ouagrham-Gormley both participated in this workshop. Read more about it here.
“Great Powers and the Norms of the BW Prohibition Regime”
A new working paper from CBWNet: “The United States of America and the Soviet Union were instrumental in creating the biological weapons prohibition regime more than 50 years ago. This has left the regime with a big gap in its normative structure related to the verification of treaty compliance. The working paper by Alexander Kelle and Eva Siegmann analyses great power involvement in several areas of regime implementation and concludes that none of the great powers, including China, has supported the addition of declaration and inspection norms. While recent US and Chinese initiatives could still lead to a strengthening of the regime in different areas, Russian policies, most notably false accusations against the US and others, threaten to undermine the regime.”
“AI and Biorisk: An Explainer”
A new explainer from Georgetown’s CSET: “Recent government directives, international conferences, and media headlines reflect growing concern that artificial intelligence could exacerbate biological threats. When it comes to biorisk, AI tools are cited as enablers that lower information barriers, enhance novel biothreat design, or otherwise increase a malicious actor’s capabilities. In this explainer, CSET Biorisk Research Fellow Steph Batalis summarizes the state of the biorisk landscape with and without AI.”
“Bio X AI: Policy Recommendations For A New Frontier”
Jeffrey et al. discuss the work of the Federation of American Scientists’ Bio x AI Policy Development Sprint in this piece, explaining in their introduction: “Artificial intelligence (AI) is likely to yield tremendous advances in our basic understanding of biological systems, as well as significant benefits for health, agriculture, and the broader bioeconomy. However, AI tools, if misused or developed irresponsibly, can also pose risks to biosecurity. The landscape of biosecurity risks related to AI is complex and rapidly changing, and understanding the range of issues requires diverse perspectives and expertise. To better understand and address these challenges, FAS initiated the Bio x AI Policy Development Sprint to solicit creative recommendations from subject matter experts in the life sciences, biosecurity, and governance of emerging technologies. Through a competitive selection process, FAS identified six promising ideas and, over the course of seven weeks, worked closely with the authors to develop them into the recommendations included here. These recommendations cover a diverse range of topics to match the diversity of challenges that AI poses in the life sciences. We believe that these will help inform policy development on these topics, including the work of the National Security Commission on Emerging Biotechnologies.”
“Push to Improve Biosecurity in the Age of Genetic Engineering”
Wilmot James recently authored this opinion piece for Business Day, explaining in part “The possibility of using AI to develop bioweapons raises additional concerns, and remains uncharted territory. While the intersection of AI and biotechnology holds immense potential for positive applications in healthcare, research and diagnostics, it also poses risks if misused. AI algorithms could be employed to analyse vast genetic data sets and identify specific sequences for manipulation. This could accelerate the process of genetic engineering, allowing for the creation of more efficient and potentially harmful pathogens…To safeguard against such threats, multilateral and public-private sector agreements and regulations to govern the ethical use of AI in science, emphasising the prohibition of bioweapon development, should be established, with strong oversight committees responsible for assessing the ethical implications at the intersection of AI and biotechnology. These committees should include experts in AI, virology, bioethics and global health security.”
“Sounding the Alarm on Anti-Science”
Margaret Winchester provides background and overview of Peter Hotez’s latest book-The Deadly Rise of Anti-Science-in this piece for Health Affairs: “In his book, The Deadly Rise of Anti-Science, Hotez, professor and dean of the National School of Tropical Medicine at Baylor College of Medicine, and co-director of the Center for Vaccine Development at Texas Children’s Hospital, paints a bleak picture of public science denial during the pandemic, embedded in historic context. He tells the story of systematic anti-science efforts from his view in the trenches—and as a personal target for anti-science activists. This book, and his commentary in our December issue of Health Affairs on global lessons from COVID-19, highlight the very real effects of this movement, including lives lost, undermined public health efforts, foregone vaccinations, social schisms, and more, that will be felt for generations to come. As he writes, “anti-science now kills more Americans than global terrorism, or other deadly societal forces and social determinants.” Drawing from multiple sources, he estimates that approximately 200,000 people needlessly died in the US after COVID-19 vaccines became widely available.”
EU vs Disinfo Disinformation Review
The most recent edition of EU vs Disinfo’s Disinformation Review is now available and features multiple sections focused on Russia’s continued use of alleged US biological weapons laboratories as a bogeyman. Be sure to check it out for fantastic lines such as “If the only tool that you have is a hammer, everything looks like a biolab,” and “At a staged event, Putin mumbled out an announcement to veterans and the wider public that his regime would continue to rule over Russia after an orchestrated ritual not to be confused with an event known as an ‘election’ in the free world.”
2023 State of the Bioeconomy
From BIOISAC: “We have a lot to celebrate as we close 2023 and just over 12 months since the Executive Order calling for a safe, secure bioeconomy. Join us as we recap the activity, publications, outcomes, and – we will of course share a glimpse of the “behind the scenes” conversations from our 3 regional events and our one-day “Closing the Knowledge Gaps” event, our two-day table top training and the resulting “Going Viral: Bioeconomy Defense TTX” report, and, of course, the industry-demanded outputs from our hardware/software device security workgroup report and supplements, “Fortifying the Bioeconomy” as well as the Bioeconomy Security Questionnaire and Instrument Disposal Guide. We also have a lot left to do! We plan to share a few of our goals for 2024 and our upcoming regional events schedule.”
“Join us December 19th at 2pm Eastern-US for a live discussion.” Register here.
Presidential Advisory Council on Combating Antibiotic-Resistant Bacteria (PACCARB) Virtual Meeting
“The Presidential Advisory Council on Combating Antibiotic-Resistant Bacteria (PACCARB) provides advice, information, and recommendations to the U.S. Secretary of Health and Human Services (HHS Secretary). The council supports and evaluates U.S. government activities focused on fighting antimicrobial resistance (AMR) in human health, animal health, and environmental health. Using this One Health approach, members of the PACCARB have expertise from a range of backgrounds, including academia, industry, public health, advocacy, veterinary, and agricultural production.”
“As a federal advisory committee, the PACCARB looks to engage with the public and all AMR stakeholders. The council holds several public meetings every year both in-person and live streamed on the HHS.gov website. These meetings are open to anyone with an interest in combating AMR. See how to get involved!”
This virtual meeting will take place on December 20 from 9-4 EST. Learn more here.
61st ISODARCO Course: Nuclear Order and International Security after Ukraine
“The war in Ukraine has had an enormous impact on global security, reviving nuclear fears, undermining the prospects for arms control, and shattering many of the norms and constraints that were the foundation of European security. ISODARCO 2024 will examine the global nuclear order in light of the Ukraine war, focusing on the states, the policies and the technologies that will shape the future in a much more difficult environment. How will we cope with this more dangerous world?”
This course will take place January 7-14, 2024, at the University of Trento. Learn more and register here.
International Conference, CBRNE Research & Innovation
“The last 40 years have demonstrated that both military and civilian populations could be exposed to highly hazardous CBRNE agents following conflicts, natural outbreaks and disasters, industrial incidents or terrorist attacks.”
“Worldwide, researchers, responders and industrial capacities have been commited to provide adapted response to these challenges.”
“Building on the success of the first 5 International Conferences « CBRNE Research and Innovation » which took place in Antibes (2015), Lyon (2017), Nantes (2019), on line (2021) and Lille (2022), we want to give you a new opportunity to build up or strengthen collaborative networks in Strabourg (March 19th – 21rst 2024).”
“The CBRNE R&I Conference is specifically devoted to scientific updates, responders’ feedbacks and expression of needs. It also includes workshops and demonstrations of innovative materials, technologies and procedures, according to the following themes: DETECTION – IDENTIFICATION, PROTECTION – DECONTAMINATION, MEDICAL COUNTERMEASURES, RISKS & CRISIS MANAGEMENT.”
“Looking forward to your proposals for communication and to welcoming you at Strasbourg in March 2024!”
Registration is now open for the Global Health Security 2024 conference in Sydney, Australia. This iteration will take place 18-21 June, 2024. The call for abstracts is also still open. “The mission of the Global Health Security conference is to provide a forum where leaders, researchers, policy-makers, and representatives from government, international organisations, civil society, and private industry from around the world can engage with each other, review the latest research and policy innovations, and agree solutions for making the world safer and healthier. To that end, our mission is to help foster a genuinely multidisciplinary community of practice that is committed to working collaboratively to enhance global health security and eliminate disease, irrespective of its origin or source.”
WHO Announces Proposed Members of Technical Advisory Group on Response Use of the Life Sciences and Dual-Use Research
The WHO recently announced its proposed membership of its Technical Advisory Group on Responsible use of the life sciences and dual-use research (TAG-RULS DUR). According to WHO, “As per WHO processes, there will be now a two-week public consultation period for WHO to receive feedback on the proposed TAG-RULS DUR members and set in place the modalities for the TAG-RULS DUR’s first meeting, which is planned to take place following this consultation period…The final membership to the TAG-RULS DUR is subject to the above-mentioned public consultation period and relevant WHO practices and procedures.”
The proposed membership and instructions for providing commentary on the individuals included are both available here.
Vote: 2023 Arms Control Person(s) of the Year Nominees
“Since 2007, the independent, nongovernmental Arms Control Association has nominated individuals and institutions that have, in the previous 12 months, advanced effective arms control, nonproliferation, and disarmament solutions and raised awareness of the threats posed by mass casualty weapons.”
“In a field that is often focused on grave threats and negative developments, the Arms Control Person(s) of the Year contest aims to highlight several positive initiatives—some at the grassroots level, some on the international scale—designed to advance disarmament, nuclear security, and international peace, security, and justice.”
“Voting will take place between Dec. 8, 2023, and Jan. 11, 2024. The results will be announced on Jan. 12, 2024. Follow the discussion on social media using the hashtag #ACPOY2023.”
This week includes coverage of updates to Japan’s End User List, the Taliban’s newly declared war on polio, Biomemory’s $1k DNA storage cards, new publications, upcoming events, and more.
Japan Revises End User List, Includes 101 Chinese Organizations and Institutions
Japan’s Ministry of Economy, Trade, and Industry has revised the country’s End User List, which provides “…exporters with information on foreign entities for which concern cannot be eliminated regarding involvement in activities such as the development of weapons of mass destruction (WMDs) and other items, for the purpose of enhancing the effectiveness of the catch-all control on cargos and other loads relating to WMDs and other items.”
The updated list, which takes effect on Monday, now includes 706 organizations in 15 countries and regions, according to Nikkei. This is an increase of 36 over last year’s list and, notably, it includes the China Academy of Engineering Physics (CAEP)-the main center for Chinese research on and manufacturing of nuclear weapons. Seven total Chinese entities were added to the list, about 90% of which are thought to be involved in missile development. Nikkei notes that “Many universities, academies and research institutes are also listed, which reveals the extent of Xi Jinping’s Military-Civilian Fusion policy. Machine tools produced by Japanese companies and others are suspected of being used by the CAEP, according to a Nikkei investigation.”
223 Iranian organizations and institutions are on the list, in addition to 153 North Korean ones, and 101 each from China and Pakistan. Nikkei further explains that “Japan aims to prevent the outflow of civilian technology that could be diverted to military use. Exporters are required to get approval from the Minister of Economy, Trade and Industry to export products to the listed organizations unless it is clear that the materials will not be used to develop WMDs such as nuclear weapons or missiles.”
“The economy ministry makes the list to enhance the effectiveness of its “catch-all” control system, which obliges exporters to apply for an export license for goods that may be used for the development of WMDs even if the goods are not subject to export restrictions under international agreements. The list has been issued since catch-all controls were introduced in April 2002 and is revised about once a year. It is not an embargo list.”
Taliban Announces Polio Eradication Campaign
Naturally acquired polio remains endemic in just two countries today- Afghanistan and Pakistan- in part because, as Radio Azadi explains, “Islamic militants often target polio-vaccination teams, falsely claiming the vaccination campaigns are a Western conspiracy to sterilize children.” During its 20-year struggle to regain power, the Taliban often banned door-to-door vaccination efforts. In 2021, nationwide door-to-door polio vaccinations were allowed to resume after the Taliban and the United Nations/World Health Organization reached an agreement.
Now, as explained by a recent article in The Washington Post, the Taliban is “declaring war” on polio in an apparent complete reversal of its previous stance. The article explains “Vaccinators in the country’s northeast, the center of the poliovirus outbreak, search cars for unvaccinated children at roadside checkpoints manned by Taliban soldiers. With no deadly attacks on public health campaigners reported in Afghanistan this year, they also feel increasingly comfortable venturing into remote virus hot spots that were previously far beyond their reach.”
The country’s health ministry announced the continuation of its annual polio vaccination campaign in March of this year, marking the second year the program has continued to operate under the Taliban’s rule. The ministry indicated it aimed to reach approximately 9 million children with the campaign, as Afghanistan and neighboring Pakistan continue to struggle with endemic polio due in large part to accessibility difficulties, displacement, regional instability, and concerns about external interference. Pakistan suspended its anti-polio drive in multiple districts this year after police escorting vaccination teams were repeatedly attacked.
French Start-Up Announces Sales of DNA Storage Cards,BIO-ISAC Joins DNA Data Storage Alliance Amid Growing Interest, Concerns
Multiple news outlets have covered the French start-up Biomemory‘s release of $1,000 pairs of DNA cards that promise a “minimum” 150-year lifespan of data storage. The Verge’s Emma Roth explains “DNA has emerged as a theoretical alternative to hard drives, SSDs, and other forms of digital data storage, namely because of its impressive lifespan. Science estimates the technology could potentially last hundreds of thousands of years if stored in a cool, dry environment. That’s a heck of a lot longer than the lifespan of your average hard drive, which typically tops out at around five years.”
However, Biomemory’s cards currently offer just one kilobyte of storage, or about one email according to Wired. The data stored on the card is retrieved by mailing the cards to Eurofins Genomics, who then return the stored information using strings of DNA’s nucleotide bases-adenine (A), cytosine (C), guanine (G) and thymine (T). Users can then use Biomemory’s DNA translation feature to decode the stored information. The card is not returned afterward. The company expects to begin shipping orders from its waitlist in January.
‘”The launch of our DNA Cards represents a significant milestone in the evolution of data storage technology,” Erfane Arwani, CEO of Biomemory, said about the pioneering development. “After years of talk about the potential of molecular computing, we are incredibly proud to bring the first DNA data storage product to market, that not only pushes the boundaries of innovation but also aligns with our commitment to environmental sustainability and efficiency.”‘
This news has coincided with the announcement that the Bioeconomy Information Sharing and Analysis Center, an international organization that aims to address threats unique to the bioeconomy, has joined the DNA Data Storage Alliance. The organization explained in a statement: “This year BIO-ISAC created the Genomic Data Workgroup, informing the National Cybersecurity Center of Excellence at National Institute of Standards and Technology efforts to launch the Cybersecurity Framework Profile for Genomic Data and the forthcoming text on the Privacy Framework Profile for Genomic Data. Prioritizing workgroup efforts to apply and implement this work, BIO-ISAC pursued membership and presentation opportunities with aligned organizations and audiences.”
“Founded in 2020, the DNA Data Storage Alliance was built to create and promote an interoperable storage ecosystem based on DNA as a data storage medium. The organization seeks to educate the public and raise awareness about this emerging technology and its vast power to preserve our digital legacy. As the methods of commercially viable DNA storage become better understood, the Alliance will consider recommending the creation of specifications and standards (e.g., encoding, reliability, retention, file systems) which enable end-users to add interoperable DNA-based storage solutions to their existing storage hierarchies.”
On a more fun note, Biomemory’s homepage does include a DNA Translate feature at the bottom which shows users how lines of text may be converted to strings of As, Cs, Gs, and Ts, so we tested it out: AGAGAGACAGTCTCACAGTCAGAGACTCACACAGAGACACAGTCACAGAGTCTGTCAGTCAGACAGTCTGTGAGTGACTCAGTCACAGACTCACACAGAGACTCAGTCAGAGAGTGACACAGTCTGTGAGTGACTCAGTGAGACACTCACACAGTCTCAGAGTGACTGACTCACACAGTGAGACAGTCTCACAGTCAGAGACTCACACAGTCACTCAGTCAGAGAGTGACTGAGTGAGACACTCACACAGTCTGTCAGTCAGAGAGTGCCGAAGTGACTGAGTCTGACAGTCAGAGAGTGAGACAGTGAGACAGTCAGAGAGTGACTCCCGAACAG
The page lacks a feature allowing users to translate their string of nucleotide bases back to regular text, so take our word for it: The Pandora Report is the best newsletter!
WHO Weekly Epidemiological Record One Health-Focused Issue
“The Weekly Epidemiological Record (WER) serves as an essential instrument for the rapid and accurate dissemination of epidemiological information on cases and outbreaks of diseases under the International Health Regulations and on other communicable diseases of public health importance, including emerging or re-emerging infections.”
“Henry Kissinger Supported Wars and Coups. He Also Played a Little-Known Role in Eliminating Bioweapons”
Matt Field recently authored this piece about the late Henry Kissinger in The Bulletin of the Atomic Scientists, writing in part: “By the late 1960s, incidents with chemical weapons—including an accident with VX nerve agent in Utah that killed some 6,000 sheep—had focused Congress’s attention on the US chemical and biological warfare operation. Internationally, there were efforts to begin arms control negotiations around these weapons of mass destruction. And Kissinger led internal government deliberations over what to do with the US program. At one point, according to Tucker and Mahan, Kissinger, unhappy with a policy paper that contained both arguments in favor and against retaining biological weapons, produced his own paper that cut the points in favor of the offensive program. He included his personal recommendation to restrict the US program to biological defense, which involves the development of countermeasures such as vaccines.”
“Insights from BARDA Industry Day 2023”
Tanima Sinha, Director of Life Science Product Development and Government Contracts at the Biomedical Advanced Research and Development Authority (BARDA), recently authored this post covering BARDA Industry Day 2023 and upcoming insights from the conference that will be made available. She explains in part, “Here we will take a quick glimpse at ASPR (Administration for Strategic Preparedness and Response) and BARDA’s programs to enhance the nation’s biomedical industrial base and supply chain capacity. The COVID-19 pandemic brought to light the inadequate availability of essential medical needs. In response to these deficiencies, the USG/ HHS (Health and Human Services) (Health and Human Services) is expanding the public health industrial base through innovative solutions.”
Fortifying the Bioeconomy
From BIO-ISAC: “Standardizing tools for assessing, remediating, and disposing of hardware and software instruments has been a recurring problem in our sector, reducing our ability to operate in a safe, secure way. Earlier this year, BIO-ISAC took action to address this need.” “Fortifying the Bioeconomy, an in-depth resource about shared responsibility in hardware and software lifecycle management, is now available. This resource includes additional materials including a standardized vendor questionnaire and an instrument disposal guide.”
“We hope these materials guide industry and offer us a safe, secure path forward for our nation’s labs, biomanufacturers, growers, and innovators.”
“Country Reports on Terrorism 2022 is submitted in compliance with Title 22 of the United States Code, Section 2656f (the “Act”), which requires the Department of State to provide to Congress a full and complete annual report on terrorism for those countries and groups meeting the criteria of the Act.”
This report includes “Chapter 3 — The Global Challenge of Chemical, Biological, Radiological, or Nuclear Terrorism,” explaining the status of CBRN materials and expertise as terrorist threats and the United States’ efforts to counter them in 2022.
“New Information Tool on Nuclear Weapons Seeks to Identify the Next Arms Control Strategies”
Andrew Facini recently authored this piece for The Bulletin of the Atomic Scientists discussing the Council on Strategic Risks’ recently-launched Nuclear Weapons System Project. He explains, “For those of us seeking to cultivate nuclear policies geared toward enhancing strategic stability, the current trend reflects a worrying loss of perspective—a forgetting of the hard-earned lessons of the Cold War. To help put today’s trends in their historical context, a team of the Council on Strategic Risks (CSR) developed a new visualization tool and information system that maps every type of nuclear weapon fielded by the five nuclear weapons states (P5) under the Nuclear Non-Proliferation Treaty (NPT)—China, France, Russia, the United Kingdom, and the United States—from their inception to present day.”
What We’re Listening To 🎧
Technologically Speaking Podcast Ep. 6, Science is Messy
New from the Department of Homeland Security: “Host John Verrico sits down with Dr. Nick Bergman, director of S&T’s National Biodefense Analysis and Countermeasures Center (NBACC). Dr. Bergman is a bit of a germaphobe, but it’s hard not to be when you run a Biosecurity Level 4 lab that studies pathogens for which no vaccine or treatment exists. Hear an insider’s perspective of the COVID pandemic, find out how NBACC regularly helps the FBI, and meet a guy living a “pretty typical life” of helping save us all from superbugs.”
New from the Dutch Ministry of Health, Welfare and Sport: “This film provides an introduction into eight pillars of good practice for biosecurity, that are important when implementing biosecurity control measures.”
“These control measures are necessary to protect high-risk biological materials against theft or misuse by malicious parties.”
“The biosecurity aspects in these eight pillars of good practice are explained, which can help you to implement biosecurity within your organisation. This film is focussed on organisations that work with high risk biological materials.”
Mitigating Arboviral Threats and Strengthening Public Health Preparedness
“Arboviruses are a broad group of viruses that are spread by arthropods, such as ticks and mosquitoes. Diseases caused by arboviruses, like dengue, chikungunya, Zika, and yellow fever, present a significant public health burden and threaten billions of people worldwide. Despite the global recognition of the devastating health and economic impacts of these diseases, the need persists for improved integration of mitigation efforts into public health systems and environmental and urban planning.”
“The National Academies Forum on Microbial Threats will conduct a two-day workshop that will identify lessons learned from previous outbreaks, outline current arbovirus surveillance capacities, and describe novel approaches to arbovirus mitigation. The workshop will include perspectives from researchers, public health practitioners, and environmental management experts from across the globe.”
This event will take place on December 12 and 13. Learn more here.
Presidential Advisory Council on Combating Antibiotic-Resistant Bacteria (PACCARB) Virtual Meeting
“The Presidential Advisory Council on Combating Antibiotic-Resistant Bacteria (PACCARB) provides advice, information, and recommendations to the U.S. Secretary of Health and Human Services (HHS Secretary). The council supports and evaluates U.S. government activities focused on fighting antimicrobial resistance (AMR) in human health, animal health, and environmental health. Using this One Health approach, members of the PACCARB have expertise from a range of backgrounds, including academia, industry, public health, advocacy, veterinary, and agricultural production.”
“As a federal advisory committee, the PACCARB looks to engage with the public and all AMR stakeholders. The council holds several public meetings every year both in-person and live streamed on the HHS.gov website. These meetings are open to anyone with an interest in combating AMR. See how to get involved!”
This virtual meeting will take place on December 20 from 9-4 EST. Learn more here.
61st ISODARCO Course: Nuclear Order and International Security after Ukraine
“The war in Ukraine has had an enormous impact on global security, reviving nuclear fears, undermining the prospects for arms control, and shattering many of the norms and constraints that were the foundation of European security. ISODARCO 2024 will examine the global nuclear order in light of the Ukraine war, focusing on the states, the policies and the technologies that will shape the future in a much more difficult environment. How will we cope with this more dangerous world?”
This course will take place January 7-14, 2024, at the University of Trento. Learn more and register here.
International Conference, CBRNE Research & Innovation
“The last 40 years have demonstrated that both military and civilian populations could be exposed to highly hazardous CBRNE agents following conflicts, natural outbreaks and disasters, industrial incidents or terrorist attacks.”
“Worldwide, researchers, responders and industrial capacities have been commited to provide adapted response to these challenges.”
“Building on the success of the first 5 International Conferences « CBRNE Research and Innovation » which took place in Antibes (2015), Lyon (2017), Nantes (2019), on line (2021) and Lille (2022), we want to give you a new opportunity to build up or strengthen collaborative networks in Strabourg (March 19th – 21rst 2024).”
“The CBRNE R&I Conference is specifically devoted to scientific updates, responders’ feedbacks and expression of needs. It also includes workshops and demonstrations of innovative materials, technologies and procedures, according to the following themes: DETECTION – IDENTIFICATION, PROTECTION – DECONTAMINATION, MEDICAL COUNTERMEASURES, RISKS & CRISIS MANAGEMENT.”
“Looking forward to your proposals for communication and to welcoming you at Strasbourg in March 2024!”
Registration is now open for the Global Health Security 2024 conference in Sydney, Australia. This iteration will take place 18-21 June, 2024. The call for abstracts is also still open. “The mission of the Global Health Security conference is to provide a forum where leaders, researchers, policy-makers, and representatives from government, international organisations, civil society, and private industry from around the world can engage with each other, review the latest research and policy innovations, and agree solutions for making the world safer and healthier. To that end, our mission is to help foster a genuinely multidisciplinary community of practice that is committed to working collaboratively to enhance global health security and eliminate disease, irrespective of its origin or source.”
“Biodefense Budget Breakdown: Data Visualization of U.S. Biodefense Investments”
New from Council on Strategic Risks: “In recent years, U.S. strategies and policies have advanced greatly in addressing biological risks from all sources. We at CSR have marked several areas of progress through writings and analysis: the beginning of a pivot toward pathogen-agnostic approaches, requiring annual exercises on biological risks, and the creation of the Biodefense Council within the Department of Defense, and more…In September, CSR launched a scorecardprocess to track signs of implementation of stronger U.S. biodefense and biosecurity policies. CSR’s Biodefense Budget Breakdown will accompany the scorecard, tracking trends in resources and investments.”
“Before the launch of this tool, no publicly-accessible resource provided a detailed analysis of the total budget across the federal biodefense enterprise. By creating the Biodefense Budget Breakdown, we hope to provide a robust and user-friendly resource for the government, key stakeholders, and the general public.”
“This tool is intended to provide focused analyses of the biodefense budget, with multiple interfaces to understand and analyze the federal biodefense portfolio. This tool starts with the cumulative U.S. biodefense totals for each fiscal year dating back to 2019, progresses to agency-specific drill-downs, and culminates with a detailed line item index for biodefense budgets across key agencies. This tool reports biodefense investments across three steps in the budget cycle: requested (R), enacted (E), and actual (A) levels of funding.”
Call for Applications: Ecological Security Fellowship
“The Council on Strategic Risks is pleased to announce a call for applications for its Ecological Security Fellowship, a key part of its broader Ecological Security Program.”
“Tackling complex, converging risks arising from ecological degradation requires the development of resilient leaders spanning international, national, state, and local levels. This program will familiarize participants with novel ways of conceptualizing the security risks posed by ecological disruption driven by human activities, climate change, and other stressors. Participants will acquire expertise and build professional development through networking with experts and practitioners in different areas of ecological security.”
This week covers a wide range of topics, including chemical weapons, indictments for those involved in running the illegal laboratory in Reedley, CA, and more. Several new publications follow, as well new upcoming events and newly-available resources in the announcement section.
George Mason University’s Biomedical Laboratory Receives $12 Million in Funding from NIH
From GMU: “Farhang Alem, Interim Director of the Biomedical Research Laboratory, Institute for Biohealth Innovation, and Aarthi Narayanan, Professor, Biology, will receive more than $12 million from the National Institute for Health to support development of Mason’s Biomedical Research Laboratory, advancing the university’s research capabilities for infectious diseases.”
“George Mason University’s Biomedical Laboratory (BRL) is one of 12 Regional Biocontainment Laboratories (RBLs) established through the National Institute of Allergy and Infectious Diseases. The BRL offers Biosafety Level 3 (BSL-3) facilities that conduct cutting edge pathogen research and serve as resources to rapidly address emerging infectious disease outbreaks.”
“Funding will support a number of facility improvements including the implementation of a comprehensive BSL-3 facilities preventative maintenance and upgrade plan to ensure continuity of operations, compliance with federal regulations, and a safe and secure facility. Funding will also enhance safety and quality of BSL-3 laboratory practices and create two new research cores in high containment.”
DOD Chemical and Biological Defense Program Celebrates 30th Anniversary
The Department of Defense recently reached the 30-year anniversary of the formation of its Chemical and Biological Defense Program. “Congress created the DOD wide chemical and biological defense program in November 1993, after a government report noted U.S. forces were not sufficiently prepared to address Iraq’s chemical and biological warfare capabilities…Prior to the creation of the program under the Office of the Secretary of Defense, the military services were each responsible for developing their own chemical and biological defense capabilities.”
“The Conference decided that the continued possession and use of chemical weapons by the Syrian Arab Republic, and its failures to submit an accurate and complete declaration and to destroy all its undeclared chemical weapons and production facilities, have caused serious damage to the object and purpose of the Chemical Weapons Convention.”
“In adopting the decision, States Parties condemned “in the strongest possible terms the use of chemical weapons by anyone, under any circumstances, emphasising that any use of chemical weapons anywhere, at any time, by anyone, and under any circumstances is unacceptable and contravenes international norms and standards”. States Parties reaffirmed their determination to continue to take action to address threats related to chemical weapons in Syria and elsewhere.”
“Today’s decision seeks to implement for the first time Paragraph 3 of Article XII of the Convention, which refers to measures States Parties can take in order to ensure compliance.”
Syrian Network for Human Rights Statement On the Day of Remembrance For All Victims of Chemical Warfare
The Syrian Network for Human Rights released its statement yesterday on the Day of Remembrance for all Victims of Chemical Warfare, highlighting CW attacks perpetrated by the Assad regime and the ongoing struggle for victims to hold the regime accountable. The statement is available below.
OPCW Director-General Amb. Fernando Arias and the Mayor of the Municipality of The Hague, Mr. Jan van Zanen, announced last week the three recipients of the 2023 OPCW-The Hague Award. These recipients are the Spiez Laboratory in Switzerland, Dr. Syeda Sultana Razia at the Bangladesh University of Engineering and Technology, and Mr. Hubert K. Foy at the African Centre for Science and International Security in Ghana.
‘“All three of these recipients have demonstrated that everyone has a role to play in ridding the world of chemical weapons and preventing their re-emergence,” said OPCW Director-General, Ambassador Fernando Arias. “We must together strive to continue to ensure that toxic chemicals are never used as instruments of harm and that our populations are protected.”’
Read more about the recipients and their work here.
NTI, NextGen, iGEM, SynBio Africa, GHSN, and 80,000 Hours Announce Winners of 7th Annual Next Generation for Biosecurity Competition
The winners of the Seventh Annual Next Generation for Biosecurity Competition were recently announced. They are Gupreet Dhaliwal, Ph.D. candidate in Synthetic Biology and Immunology at the University of Cambridge, Askar Kleefeldt, Ph.D. candidate in Synthetic Biology at the MRC Laboratory of Molecular Biology and the University of Cambridge, and Alexandra Klein, Ph.D. candidate in Science, Technology, Engineering and Public Policy at the University College London and research assistant at the Centre for the Study of Existential Risk, University of Cambridge.
“In their winning paper, Biosecurity-By-Design to Safeguard Emerging Bioeconomies: Integrating Biosecurity Considerations into the Full Biotechnology Innovation and Development Pipeline, the team proposes a ‘biosecurity-by-design’ approach to ensure that biosecurity is integrated into every stage of the life science research and development pipeline, especially project conceptualization. The three authors outline a set of recommendations to achieve this goal, including fostering a culture of responsibility among scientific communities through the adoption of the Tianjin Biosecurity Guidelines for Codes of Conduct for Scientists as a global standard in emerging bioeconomies. The authors emphasize the importance of engaging with the private sector and encourage governments to incentivize biosecurity in product design by using levers such as market access regulations or reputational rewards through seals of approval. The authors also propose that States Parties at the Biological Weapons Convention adopt a systematic review mechanism for science and technology to raise awareness of emerging biotechnology risks. Overall, these recommendations aim to make biosecurity an integral part of biotechnology innovation while allowing the bioeconomy to flourish.”
No Cost COVID-19 Tests Available in United States Again
The US Government is once more offering four at-home viral tests delivered via the US Postal Service. Those who did not order any in September can order up to eight of them during this round. Order tests at COVIDtests.gov.
ICYMI: Select Committee on the CCP Releases Report on Reedley Lab, DOJ Announces Indictment of Operator
Last month “Chairman Mike Gallagher (R-WI) of the House Select Committee on the Chinese Communist Party unveiled a report on its investigation into the illegal People’s Republic of China-tied biolab discovered in Reedley, CA. The members were joined by Rep. Jim Costa (D-CA), whose district includes Reedley, CA, Former Speaker Kevin McCarthy (R-CA), Rep. Dan Newhouse (R-WA), and Rep. Neal Dunn (R-FL).”
According to the report, the Committee’s main findings were:
“The illegal biolab was run by a PRC citizen who is a wanted fugitive from Canada with a $330 million Canadian dollar judgment against him for stealing American intellectual property.
This PRC citizen was a top official at a PRC-state-controlled company and had links to military-civil fusion entities.
The illegal biolab received millions of dollars in unexplained payments from PRC banks while running the illegal biolab.
The illegal biolab contained thousands of samples of labeled, unlabeled, and encoded potential pathogens, including HIV, malaria, tuberculosis, and Covid.
The illegal biolab also contained a freezer labeled “Ebola,” which contained unlabeled, sealed silver bags consistent with how the lab stored high risk biological materials. Ebola is a Select Agent with a lethality rate between 25-90%.
The biolab contained nearly a thousand transgenic mice, genetically engineered to mimic the human immune system. Lab workers said that the mice were designed “to catch and carry the COVID-19 virus.”
After local officials who discovered the lab sought help from the CDC and others, the CDC refused to test any of the samples.”
Meanwhile, the Department of Justice announced a three-count indictment against operators of the lab, saying in a press statement “A federal grand jury returned a three-count indictment today against Jia Bei Zhu, aka Jesse Zhu, Qiang He, and David He, 62, a citizen of China who formerly resided in Clovis, charging him with distributing adulterated and misbranded medical devices in violation of the federal Food, Drug, and Cosmetic Act and for making false statements to the Food and Drug Administration (FDA), U.S. Attorney Phillip A. Talbert announced.”
“According to court documents, between January 2020 and March 2023, through the companies Universal Meditech Incorporated (UMI) and Prestige Biotech Incorporated (PBI), Zhu sold hundreds of thousands of COVID-19 test kits to companies throughout the United States. UMI and PBI were based in Fresno and Reedley and did not obtain pre-market approval, pre-market clearance, emergency use authorization, or other applicable exemption from the FDA as was required. UMI and PBI received millions of dollars for the sales of the test kits.”
“When questioned by FDA officials, Zhu made several false statements to them, including that (1) his name was Qiang “David” He, (2) he was hired by UMI as a COVID-19 consultant in 2021, (3) he was hired by PBI just a couple of weeks prior to meeting with the FDA to communicate with government agencies on PBI’s behalf, and (4) he did not know anything about the manufacturing or distribution histories for UMI or PBI.”
“This case is the product of an investigation by the FDA Office of Criminal Investigations with assistance from the Federal Bureau of Investigation and the California Department of Public Health – Food and Drug Branch. Assistant U.S. Attorneys Joseph D. Barton, Arelis M. Clemente, and Henry Z. Carbajal III are prosecuting this case.”
“Why AI-Assisted Bioterrorism Became a Top Concern for Open AI and Anthropic”
Louise Matsakis covers the now constant concern about the potential for AI to aid in bioterrorism, explaining in her introduction “In the spring of 1995, U.S. lawmakers were becoming concerned that material uploaded to the nascent internet might pose a threat to national security. The Oklahoma City bombing had happened several weeks earlier, drawing attention to publications circulating online like The Big Book of Mischief, which included instructions on how to build homemade explosives.”
“Worried the information could be used to orchestrate another attack, then-Senator Dianne Feinstein pushed to make publishing bomb recipes on the internet illegal. The effort sparked a national debate about “Open Access vs. Censorship,” as one newspaper headline put it at the time.”
“Nearly 30 years later, a similar debate is now unfolding about artificial intelligence. Rather than DIY explosives, some U.S. officials and leading AI companies say they are increasingly worried that large language models could be used to develop biological weapons. The possibility has been repeatedly cited as one reason to be cautious about making AI systems open source.”
Matsakis interviewed George Mason’s Sonia Ben Ouagrham-Gormley as well in writing this piece, writing ‘“With new technologies, we tend to project in the future as though their development was linear and straightforward, and we never take into consideration the challenges and the contingencies of the people using them,” said Sonia Ben Ouagrham-Gormley, an associate professor at George Mason University who has interviewed former scientists in both the U.S. and Soviet Union’s now-defunct biological weapons programs.”
And later: “Ben Ouagrham-Gormley said her research has shown that achieving each of these steps requires employing different, highly-trained experts, including people who specialize in the exact type of pathogen being used. An AI model might be able to replace some of their work in the future, but she argued it can’t replicate the hands-on wisdom that comes from working in a laboratory.”
‘“This kind of tacit knowledge exists everywhere, but in the bio field, it’s really important because of the fragility of the raw material,” Ben Ouagrham-Gormley said.”
“Artificial Intelligence and Synthetic Biology Are Not Harbingers of Doom”
David Bray provides an optimistic outlook on the potential of AI and synthetic biology in this policy memo for the Stimson Center. Bray writes, “Contrary to many people’s fears, artificial intelligence (AI) can be a positive force in advancing biological research and biotechnology. The assumption that AI will super-empower the risks that already exist for the misuse of biotech to develop and spread pathogens and fuel bioterrorism misses three key points. First, the data must be out there for either an AI or a human to use it. Second, governments stop bad actors from using bio for nefarious purposes by focusing on the actors’ precursor behaviors. Third, given how wrong large language models (LLMs) often are and their risk of hallucinations, any would-be AI intended to provide advice on biotech will have to be checked by a human expert. In contrast, AI can be a positive force in advancing biological research and biotechnology — and insights from biology can power the next wave of AI for the benefit of humankind. Private and public-sector leaders need to make near-term decisions and actions to lay the foundation for maximizing the benefits of AI and biotech. National and international attention should focus on both new, collective approaches to data curation and ensuring the right training approaches for AI models of biological systems.”
“Going Viral: Bioeconomy Defense”
This report from Johns Hopkins’ Applied Physics Lab summarizes the findings of a May tabletop exercise:
“The May tabletop exercise at APL revealed four key areas of action to ensure a safe and secure bioeconomy.
Trust in lab equipment performance and data is foundational to the bioeconomy. Recommendations include developing digital security standards for lab equipment, hardening waypoints at each step in the data life cycle, and introducing a system of tiered levels of compliance.
Awareness of vulnerabilities, cyber and physical, and the steps for prevention and intervention are needed. Recommendations include additional exercises to strengthen intra-agency coordination and training and extending this activity to private sector companies.
Responsibility for responding to threats in the bioeconomy, and the roles for each team member, need to be defined with a process workflow, using a shared responsibility model, and teams need regular training opportunities to practice.
Preparedness is lacking, and threat-mitigation strategies specific to the bioeconomy need to be identified, tested and distributed. The exercise pushed the limits of participants’ traditional threat-mitigation strategies and identified the need for assessments of critical infrastructure and functions, cross-domain training, and the establishment of policies and procedures for an inter-agency group to rapidly respond to threats.”
“Security Considerations At the Intersection of Engineering Biology and Artificial Intelligence”
New from the Engineering Biology Research Consortium: “This white paper describes three areas at the intersection of engineering biology and artificial intelligence that may yield significant security concerns: de novo biological design, closed-loop autonomous laboratories, and natural language Large Language Models. It describes each area, identifies potential security concerns, and offers ideas for the potential mitigation of those concerns, ultimately calling for an international forum to continually address this evolving issue.”
“Pascale Ferrier and the Threat of Bioterror”
Markus K. Binder recently published this piece in NCT’s CBNW: “Drawing upon the START CBRN Data Suite and other research, Markus Binder considers the five ricin bio-attacks directed at the U.S. President and other officials that have taken place since 2013 to assess what, if anything, they can tell us about bioterrorism.”
“Americans’ Trust in Scientists, Positive Views of Science Continue to Decline”
New work from the Pew Research Center has found that “…the share of Americans who say science has had a mostly positive effect on society has fallen and there’s been a continued decline in public trust in scientists.”
“Overall, 57% of Americans say science has had a mostly positive effect on society. This share is down 8 percentage points since November 2021 and down 16 points since before the start of the coronavirus outbreak.”
“About a third (34%) now say the impact of science on society has been equally positive as negative. A small share (8%) think science has had a mostly negative impact on society.”
“A Systematic Review Of COVID-19 Misinformation Interventions: Lessons Learned”
Smith et al. recently published this article with Health Affairs: “Governments, public health authorities, and social media platforms have employed various measures to counter misinformation that emerged during the COVID-19 pandemic. The effectiveness of those misinformation interventions is poorly understood. We analyzed fifty papers published between January 1, 2020, and February 24, 2023, to understand which interventions, if any, were helpful in mitigating COVID-19 misinformation. We found evidence supporting accuracy prompts, debunks, media literacy tips, warning labels, and overlays in mitigating either the spread of or belief in COVID-19 misinformation. However, by mapping the different characteristics of each study, we found levels of variation that weaken the current evidence base. For example, only 18 percent of studies included public health–related measures, such as intent to vaccinate, and the misinformation that interventions were tested against ranged considerably from conspiracy theories (vaccines include microchips) to unproven claims (gargling with saltwater prevents COVID-19). To more clearly discern the impact of various interventions and make evidence actionable for public health, the field urgently needs to include more public health experts in intervention design and to develop a health misinformation typology; agreed-upon outcome measures; and more global, more longitudinal, more video-based, and more platform-diverse studies.”
“Coffee As a Dietary Strategy to Prevent SARS-CoV-2 Infection”
Wu et al.‘s recent article in Cell & Bioscience offers further validation for coffee drinkers (as if we needed it): “Background: To date, most countries lifted the restriction requirement and coexisted with SARS-CoV-2. Thus, dietary behavior for preventing SARS-CoV-2 infection becomes an interesting issue on a daily basis. Coffee consumption is connected with reduced COVID-19 risk and correlated to COVID-19 severity. However, the mechanisms of coffee for the reduction of COVID-19 risk are still unclear.”
“Results: Here, we identified that coffee can inhibit multiple variants of the SARS-CoV-2 infection by restraining the binding of the SARS-CoV-2 spike protein to human angiotensin-converting enzyme 2 (ACE2), and reducing transmembrane serine protease 2 (TMPRSS2) and cathepsin L (CTSL) activity. Then, we used the method of “Here” (HRMS-exploring-recombination-examining) and found that isochlorogenic acid A, B, and C of coffee ingredients showed their potential to inhibit SARS-CoV-2 infection (inhibitory efficiency 43–54%). In addition, decaffeinated coffee still preserves inhibitory activity against SARS-CoV-2. Finally, in a human trial of 64 subjects, we identified that coffee consumption (approximately 1–2 cups/day) is sufficient to inhibit infection of multiple variants of SARS-CoV-2 entry, suggesting coffee could be a dietary strategy to prevent SARS-CoV2 infection.”
“Conclusions: This study verified moderate coffee consumption, including decaffeination, can provide a new guideline for the prevention of SARS-CoV-2. Based on the results, we also suggest a coffee-drinking plan for people to prevent infection in the post-COVID-19 era.”
“WHO: ‘Collective Action’ Needed to Effectively Reduce Antimicrobial Resistance”
CIDRAP’s Chris Dall covers WHO officials’ answers to questions about AMR in this piece written in recognition of World AMR Awareness Week. Dall explains “Encouraging the medical community, world leaders, and other stakeholders to do their part in staving off that grim future is one of the goals of World AMR Awareness Week, a global campaign of the World Health Organization (WHO) this week aimed at raising public awareness and promoting practices that help mitigate the threat posed by drug-resistant infections…CIDRAP News recently submitted a series of questions to WHO officials about the themes of this year’s World AMR Awareness Week, their assessment of the progress that countries have made in addressing AMR, and the challenges that lay ahead. Responses were provided by Sarah Sheppard, the WHO’s communications lead for Medicines, Health Products & AMR.”
“The World’s Chemical-Weapons Stockpiles Are Gone – But a New Challenge Looms”
Peter J. Hotchkiss, science policy adviser to the OPCW’s Scientific Advisory Board, recently published this World View piece with Nature. He explains in part, “In 2019, the OPCW’s 193 member states decided unanimously, for the first time in history, to add compounds to the schedules, the lists of chemicals that are regulated under the convention. The four entries comprise toxic nerve agents with no known civilian use: three cover phosphorus-based agents (in the ‘novichok family’), and the fourth is a family of carbamates, another kind of nerve agent. The convention already prohibited using these (or any chemical) to intentionally kill or harm people through toxicity. Now, their production, transfer and storage are subject to stringent verification by the OPCW, through declarations and on-site inspections.”
“Yet some states have been reticent to share data on these chemicals with the OPCW. The lack of information on the newly scheduled chemicals is in jarring contrast to what we have on other weapons listed in the convention and on their precursors. To ensure the health and safety of staff members during inspections, the OPCW needs the best understanding of these chemicals’ properties, the types of personal protective equipment and medical countermeasures that are effective against them and the analytical methods for detecting them. These data would also help us to provide the best information and training to all member states, ensuring that they are prepared in the event that any of these chemicals are used as a weapon.”
“29 Morally Bankrupt Governments, Headed by Russia, Voted Against the OPCW’s Resolutions”
The Syrian Network for Human Rights recently released this report “…emphasizing that many states worldwide must bring cases against the Syrian regime before the International Criminal Court (ICC) over the regime’s repeated violations of the Chemical Weapons Convention (CWC).”
“In the 15-page report, SNHR notes that the Syrian regime has carried out 184 chemical attacks since ratifying the Convention in September 2013. The report outlines the decisions adopted by the Organization for the Prohibition of Chemical Weapons (OPCW), identifying the states that voted against those decisions, or in other words the states that support the continuation of the Syrian regime’s chemical weapons program. Through this action, it notes, these states are, in effect, encouraging the regime to use weapons of mass destruction – chemical weapons – and emboldening it to carry out more chemical weapons attacks against the Syrian people.”
“Scientific Experts Provide Key Recommendations on Biotoxin Analysis to the OPCW”
“The Scientific Advisory Board (SAB) of the Organisation for the Prohibition of Chemical Weapons (OPCW) endorsed a report outlining key recommendations on biotoxin analysis and investigations of their alleged use as weapons submitted by a SAB Temporary Working Group (TWG) earlier this year.”
“Biotoxins are toxic chemicals produced by living organisms, which vary widely in properties such as structure, size, and mechanisms of toxicity. Some biotoxins can be more toxic than traditional nerve agents. There are two biotoxins subject to stringent verification measures under the Chemical Weapons Convention – ricin and saxitoxin – with many others also posing safety and security concerns.”
“The risk of misuse of biotoxins as weapons requires the OPCW to be prepared to conduct various investigations and missions related to their alleged use. To ensure the Organisation’s readiness to do so, the TWG’s report makes critical recommendations to the OPCW…”
“2023 Catalogue of Civil Society Activities Supporting the Chemical Weapons Convention”
The Stimson Center recently released its 2023 Catalogue of Civil Society Activities Supporting the Chemical Weapons Convention, “a catalogue of civil society capacity-building, assistance, and/or research programs supporting the Chemical Weapons Convention (CWC). The catalogue highlights all interested parties, including the CWC States Parties, the Organisation for the Prohibition of Chemical Weapons (OPCW), the Global Partnership Against the Spread of Weapons and Materials of Mass Destruction, international organizations, and industry stakeholders, civil society’s contributions to strengthen reducing the threat of chemical weapons and promoting the peaceful use of chemistry. By providing a uniform product, interested parties will be able to easily identify programs, experts, and organizations that support the CWC and related chemical weapons nonproliferation instruments.”
“Emerging and Re-Emerging Chemical Threats (Part 2)”
MRIGlobal continues their discussion of CW threats with “Chemical Threats on the Battlefield and Home Front” in this blog post, explaining in part “Today’s conflicts around the world highlight the current and pressing need for continued research to help ensure the safety of anyone in danger. And though we touched on “Emerging and Re-emerging Chemical Threats” earlier in the year, because emerging and re-emerging chemical threats pose an ever-present challenge to both warfighters and civilians, we are revisiting the topic to share additional expertise. To learn more, we visited with Cristina Youngren and Evan Durnal, subject matter experts in MRIGlobal’s Integrated Defense Solutions division.”
“What Does a French Arrest Warrant Mean for Normalization With Assad?”
Julia Neumann discusses what France’s arrest warrants for Bashar al-Assad and several associates mean in practice and for regional normalization in this piece for Syria Direct.
“Why Cheap Drones Pose a Significant Chemical Terrorism Threat”
Zachary Kallenborn recently published this piece with The Bulletin of the Atomic Scientists, writing in part “Relatively cheap drones are becoming a mainstay of conflicts, from the war in Ukraine to the Israel-Hamas conflict in Gaza. Though drones were once the purview of rich and powerful militaries, it’s now possible to use cheap consumer drones in battle. With a few tweaks, they can whistle past even sophisticated air defenses. As Al-Bared’s case highlights, they may also present a significant chemical terrorism threat. Drones can be equipped with sprayers to deliver chemical weapons, or they could be used in an attack on a chemical plant. They could also provide critical attack support, helping with reconnaissance to plan out and conduct an attack, monitor law enforcement response, and create propaganda to highlight terrorist activities.”
“Stanford Emerging Technology Review: Reporting on Key Technology Areas and Their Policy Implications”
“Emerging technologies are transforming societies, economies, and geopolitics. This moment brings unparalleled promise and novel risks. In every era, technological advances buoy nations that develop and scale them—helping to save lives, win wars, foster greater prosperity, and advance the human condition. At the same time, history is filled with examples where slow-moving governments stifled innovation in ways policymakers never intended, and nefarious actors used technological advances in ways that inventors never imagined. Technology is a tool. It is not inherently good or bad. But its use can amplify human talent or degrade it, uplift societies or repress them, solve vexing challenges or exacerbate them. These effects are sometimes deliberate but often accidental.”
“The stakes of technological developments today are especially high. Artificial intelligence (AI) is already revolutionizing industries, from music to medicine to the military, and its impact has been likened to the invention of electricity. Yet AI is just one among many technologies that are ushering in profound change. Fields like synthetic biology, materials science, and neuroscience hold potential to vastly improve health care, environmental sustainability, economic growth, and more. We have experienced moments of major technological change before. But we have never experienced the convergence of so many technologies with the potential to change so much, so fast.”
“The Stanford Emerging Technology Review(SETR) is the first product of a major new Stanford technology education initiative for policymakers. Our goal is to help both the public and private sectors better understand the technologies poised to transform our world so that the United States can seize opportunities, mitigate risks, and ensure that the American innovation ecosystem continues to thrive.”
ICYMI: FBI Director Statement Before the House Committee on Homeland Security
FBI Director Christopher Wray delivered this statement to the House Committee on Homeland Security last month, highlighting the work of his agency across several mission areas, including emerging technologies and counter WMD. Wray explained in part of this statement that, “In addition to fighting terrorism, countering the proliferation of weapons-of-mass-destruction materials, technologies, and expertise, preventing their use by any actor, and securing nuclear and radioactive materials of concern are also top national security priority missions for the FBI. The FBI considers preventing, mitigating, investigating, and responding to weapons of mass destruction (“WMD”) terrorism a “no-fail” mission because a WMD attack could result in substantial injuries, illness, or loss of lives, while yielding significant social, economic, political, and other national security consequences. In collaboration with federal, state, local, tribal, territorial, and other partners, the FBI integrates complementary efforts to counter WMD terrorism. An example of this collaboration is the FBI-led Weapons of Mass Destruction Strategic Group. This interagency crisis action team spans more than 15 departments and agencies to coordinate the federal government’s response to WMD threats and incidents. Alongside the FBI, the Department of Homeland Security maintains the largest footprint on the strategic group.”
NEW: Looking Ahead in Ukraine: What Could Increase the Risk of Escalation?
“As U.S. lawmakers debate the question of continued defense and humanitarian aid to Ukraine, the Ukrainian fight to expel Russian invaders continues with no end in sight. The stalemate on the front lines in Ukraine masks continued intense fighting and demands for resources on both sides that may drive longer-term changes—on the battlefield, inside Russia, and beyond. This could lead to further escalation, including the potential to turn the conflict into a wider war. Understanding which circumstances and policies may risk escalation in Ukraine is paramount: not only are decisions about supporting Ukraine critical to the long-term trajectory of the conflict but also the United States confronts a broad set of challenges across the globe.”
“Please join RAND’s National Security Research Division on Tuesday, December 5, 2023, 9:30 – 11:00 am ET, for a moderated panel discussion about which circumstances or policies may risk escalation in Ukraine—either deliberate or inadvertent—and the potential triggers and restraining factors likely to shape Russian escalation decisions in particular.”
“Missy Ryan, a national security reporter at the Washington Post, will moderate the discussion.”
NEW: Threat Agnostic Biodefense Webinar: Assessing the Zoonotic Risk of Pre-Emergent Viruses
From PNNL: “Exploration of the “virosphere” is in its golden age. The sheer number of new viruses discovered daily, and the fact that most cannot be cultured, creates enormous uncertainty about where to allocate attention and resources. It is not an intractable problem, however, to distinguish those few viruses that are likely to emerge as zoonoses from the many others that are not. This talk describes two diametric approaches to addressing this problem. The first approach involves a field-to-lab investigative methodology that, when combine with biologically informed predictive computational models, can assess the zoonotic risk of viruses that have not yet been identified in humans. The second approach relies on the power of modern methods in anthropology and ethnography to identify zoonotic transmission pathways, even before the identification of any pathogens that might traverse those pathways. A unifying example is simian hemorrhagic fever virus and its relatives in the family Arteriviridae, which cause important animal diseases but have never been documented to infect humans. Both approaches identify these viruses as high-risk pre-emergent zoonoses.”
Learn more and register for this December 6 event here.
NEW: Bio & Beer
“As a rising global leader in the bioeconomy, investments in the future STEM workforce are critical in order to secure the U.S.’s position as a world resource for biohealth technology and innovations. Join us and our three guest speakers as we discuss the importance of a diverse, skilled STEM workforce to address rapidly increasing industry demand. We will also talk about training and other opportunities designed to prepare individuals for STEM careers. Enjoy an evening of networking, drinks, and fun!”
Meeting the Moment: Biodefense Policy, Procurement, and Public Health
From the Bipartisan Commission on Biodefense: “As the Nation continues to endure the consequences of recent pandemics, and with continued interest in biological weapons by nation states and other enemies, the federal government has an opportunity to address vulnerabilities in the biodefense enterprise. At this meeting, titled Meeting the Moment: Biodefense Policy, Procurement, and Public Health, the Commission intends to further explore : (1) biodefense policies and activities at the Department of Defense; (2) federal stockpile evaluation and decision-making for smallpox medical countermeasures; (3) needed authorities of the Department of Health and Human Services, including the Centers for Disease Control and Prevention; and (4) biodefense leadership.”
This meeting will take place on December 5, from 10:30 am until 4 pm ET. Register here.
2023 EPA International Decontamination Research and Development Conference-“Advancing Preparedness through Science and Collaboration”
“The clean-up of chemical, biological, or radiological (CBR) contamination incidents and natural disasters is a critical challenge for the United States. Understanding how to characterize and remediate affected areas of environmental contamination and waste is necessary for daily life to return.”
“The Decon Conference is designed to facilitate presentation, discussion, and further collaboration of research and development topics focused on an all-hazards approach to remediate contaminated indoor and outdoor areas, critical infrastructure, water distribution systems, and other environmental areas/materials.”
“This conference is free and open to the public. Content and presentations are geared towards the emergency response community, including local and state emergency managers, homeland security officials, first responder coordinators, private sector industry, risk managers, educators in the field of emergency management, and others.”
This event will take place December 5-7 in Charleston, SC. Learn more and register here.
Mitigating Arboviral Threats and Strengthening Public Health Preparedness
“Arboviruses are a broad group of viruses that are spread by arthropods, such as ticks and mosquitoes. Diseases caused by arboviruses, like dengue, chikungunya, Zika, and yellow fever, present a significant public health burden and threaten billions of people worldwide. Despite the global recognition of the devastating health and economic impacts of these diseases, the need persists for improved integration of mitigation efforts into public health systems and environmental and urban planning.”
“The National Academies Forum on Microbial Threats will conduct a two-day workshop that will identify lessons learned from previous outbreaks, outline current arbovirus surveillance capacities, and describe novel approaches to arbovirus mitigation. The workshop will include perspectives from researchers, public health practitioners, and environmental management experts from across the globe.”
This event will take place on December 12 and 13. Learn more here.
Presidential Advisory Council on Combating Antibiotic-Resistant Bacteria (PACCARB) Virtual Meeting
“The Presidential Advisory Council on Combating Antibiotic-Resistant Bacteria (PACCARB) provides advice, information, and recommendations to the U.S. Secretary of Health and Human Services (HHS Secretary). The council supports and evaluates U.S. government activities focused on fighting antimicrobial resistance (AMR) in human health, animal health, and environmental health. Using this One Health approach, members of the PACCARB have expertise from a range of backgrounds, including academia, industry, public health, advocacy, veterinary, and agricultural production.”
“As a federal advisory committee, the PACCARB looks to engage with the public and all AMR stakeholders. The council holds several public meetings every year both in-person and live streamed on the HHS.gov website. These meetings are open to anyone with an interest in combating AMR. See how to get involved!”
This virtual meeting will take place on December 20 from 9-4 EST. Learn more here.
61st ISODARCO Course: Nuclear Order and International Security after Ukraine
“The war in Ukraine has had an enormous impact on global security, reviving nuclear fears, undermining the prospects for arms control, and shattering many of the norms and constraints that were the foundation of European security. ISODARCO 2024 will examine the global nuclear order in light of the Ukraine war, focusing on the states, the policies and the technologies that will shape the future in a much more difficult environment. How will we cope with this more dangerous world?”
This course will take place January 7-14, 2024, at the University of Trento. Learn more and register here.
International Conference, CBRNE Research & Innovation
“The last 40 years have demonstrated that both military and civilian populations could be exposed to highly hazardous CBRNE agents following conflicts, natural outbreaks and disasters, industrial incidents or terrorist attacks.”
“Worldwide, researchers, responders and industrial capacities have been commited to provide adapted response to these challenges.”
“Building on the success of the first 5 International Conferences « CBRNE Research and Innovation » which took place in Antibes (2015), Lyon (2017), Nantes (2019), on line (2021) and Lille (2022), we want to give you a new opportunity to build up or strengthen collaborative networks in Strabourg (March 19th – 21rst 2024).”
“The CBRNE R&I Conference is specifically devoted to scientific updates, responders’ feedbacks and expression of needs. It also includes workshops and demonstrations of innovative materials, technologies and procedures, according to the following themes: DETECTION – IDENTIFICATION, PROTECTION – DECONTAMINATION, MEDICAL COUNTERMEASURES, RISKS & CRISIS MANAGEMENT.”
“Looking forward to your proposals for communication and to welcoming you at Strasbourg in March 2024!”
Registration is now open for the Global Health Security 2024 conference in Sydney, Australia. This iteration will take place 18-21 June, 2024. The call for abstracts is also still open. “The mission of the Global Health Security conference is to provide a forum where leaders, researchers, policy-makers, and representatives from government, international organisations, civil society, and private industry from around the world can engage with each other, review the latest research and policy innovations, and agree solutions for making the world safer and healthier. To that end, our mission is to help foster a genuinely multidisciplinary community of practice that is committed to working collaboratively to enhance global health security and eliminate disease, irrespective of its origin or source.”
Council on Strategic Risks Launches the Nuclear Weapon Systems Project
“How states view the roles and relevance of nuclear weapons is changing. While these perspectives have been dynamic since the dawn of the atomic age, the changes occurring today and drivers of these changes are particularly worrisome—in particular given that they seem to be on the cusp of reversing a period heavily characterized by arms control agreements, reductions in global arsenals, and advances in international cooperation to reduce nuclear weapons risks.”
“CSR’s core nuclear policy work to address this challenging time has focused largely on qualitative approaches to reducing the risks of nuclear miscalculations, uses of these weapons, arms racing behavior, and other dangerous trends. Going beyond numbers of weapons—which has been a major policy focus given numerical limitations in past nuclear treaties—a qualitative view of the nuclear weapons landscape is done through the lens of the nuclear capabilities nations seek, and associated policies and postures. This can help to show where multiple nations might find areas for potential cooperation that would be mutually beneficial. It can also help to show where nations currently possess the capabilities they claim to need, and thereby in what ways cooperative or unilateral measures of restraint are the most appropriate.”
“In order to facilitate this work by CSR and by others, we are launching The Nuclear Weapon Systems Project to help visualize how the types of nuclear capabilities fielded in the world have evolved since the advent of these weapons.”
“This project seeks to document and characterize every deployed nuclear weapons system that NPT-recognized nuclear states have developed in history. More than just a list of bombs, missiles, and artillery shells, the resulting dataset illustrates a complex story of risks, strategies, and lessons learned—and lost. We consider this data to be a living resource, and encourage outside contributions and feedback.”
“Georgetown Global Health Center Launches First Open-Access Wildlife Disease Database”
Georgetown University Medical Center’s Center for Global Health Science and Security recently announced “the launch of a first-of-its-kind wildlife disease database — a system for collecting records of viruses, bacteria, fungi, parasites, etc. — designed to support an early warning system for potential viral emergence. The Pathogen Harmonized Observatory, or PHAROS, is open to the global community and free to access.”
“Scientists in GHSS’ Verena program, a collaborative institute comprising a global team of scientists, designed PHAROS to advance research and education around viral emergence — the process of viruses jumping from animals to humans. Verena co-founder and director Colin Carlson, PhD, says most platforms designed to track diseases in wild animals are very limited and are developed only in response to a major outbreak, such as birds dying off suddenly due to avian flu.”
‘“Our goal is to build a data sharing system that lets us eventually predict pandemics like the weather,” Carlson says. “When we collect data on wildlife viruses, it gets published in journals and then lost forever, because it isn’t ever standardized or compiled. After COVID, there’s no excuse to keep working that way.”’
Texas A&M Research Assistant Professor (Pandemic Preparedness/Biosecurity) Openings
Texas A&M University’s Scowcroft Institute of International Affairs is seeking up to two Research Assistant Professors with expertise in pandemic preparedness and/or biosecurity. The Research Assistant Professor will be in the Scowcroft Institute of International Affairs, Bush School of Government & Public Service, and will work with the Pandemic Preparedness & Biosecurity Policy Program. Responsibilities include teaching graduate courses, conducting research, and writing policy-relevant publications on biosecurity, global health security, bio and agro-defense, federal life sciences policy, one health, biotechnology, or related policy topics.