Happy New Year! This week covers reports of over 450 chemical attacks by Russia since the invasion of Ukraine in 2022, the fifth anniversary of DHS’ CWMD Office, and several recent publications.
Ukraine Reports Hundreds of Chemical Attacks by Russia Since Start of Invasion
In late December, the Kyiv Post published an article explaining a post from Ukraine’s Armed Forces Support Forces Command, which “claims that Russian troops have conducted 465 chemical attacks in Ukraine since the initiation of the full-scale invasion, with over 80 such attacks in December 2023, including one grenade containing a new, unknown chemical agent…The command notes an escalating trend in the use of such weapons by Russian forces, highlighting eight chemical attacks on Dec. 19 alone.”
The article continues, explaining “The commonly used weapons include grenades like K-51, RGR, and Drofa-PM gas hand grenades dropped from unmanned aerial vehicles (UAVs). Additionally, improvised explosive devices equipped with irritant substances and artillery shelling containing chemically dangerous substances are being employed.”
“The report mentions that 28 cases involving dangerous chemicals were documented and forwarded for investigative actions as part of criminal proceedings by groups of radiation, chemical, and biological intelligence from the military units of the Support Forces Command, working in collaboration with the Security Service of Ukraine (SBU).”
In case you missed it: Last summer, the Royal United Services Institute published an article on this topic, exploring the reported limited use of riot control agents and broader deployment of CW by Russia could mean in this war. The piece offers insight into Russia’s potential ogic in using these kinds of weapons in Ukraine, making it helpful in understanding this latest reporting.
DHS Celebrates Five Years of the Countering Weapons of Mass Destruction Office
In late December, the Department of Homeland Security celebrated the fifth anniversary of the founding of the Countering WMD Office. In an email update from the Department, Assistant Secretary for the Countering Weapons of Mass Destruction Office, Mary Ellen Callahan, was quoted saying “The threat of weapons of mass destruction terrorism is real. Five years ago, in the face of a dynamic, evolving threat environment, legislators recognized that the U.S. needed a more holistic approach to countering chemical, biological, radiological, and nuclear threats to the Homeland…By authorizing CWMD, the legislators enabled us to enhance and coordinate the chemical, biological, radiological, and nuclear detection efforts of federal, state, local, tribal, and territorial governments to improve preparedness and response capabilities throughout the United States. We look forward to continuing this essential mission to protect the American people.”
The update further explained “Congress established the CWMD Office in 2018 to elevate, consolidate, and streamline DHS efforts to protect the Homeland from weapons of mass destruction (WMD) and chemical, biological, radiological, and nuclear (CBRN) threats. CWMD serves as the DHS nexus for WMD and CBRN coordination, which includes providing direct financial and operational support nationwide to government and industry partners for full-time biological detection, illicit nuclear material detection, training, and exercises. Additionally, as part of the President’s Executive Order on AI signed in October 2023, President Biden tasked CWMD with helping to evaluate and mitigate the potential for AI to be used to develop WMDs, such as through AI-enabled misuse of synthetic nucleic acids to create biological weapons. The President directed the CWMD Office to evaluate the potential for AI to lower the barriers to entry for developing WMD and to develop a framework to evaluate and stress test synthetic-nucleic acid screening, creating a standardized set of expectations for third parties that audit AI systems to prevent the risk of abuse and proliferation by malicious actors.”
Defense Dossier Issue 38: “Pandemic Preparedness and Biodefense”
The American Foreign Policy Council’s December Defense Dossier is focused on biodefense and pandemic preparedness, featuring an article-“Parsing the Great Gain of Function Debate”-co-authored by Biodefense PhD Program alumni Yong-bee Lim and Saskia Popescu. It also includes other articles like “China’s Evolving Thinking About Biotechnology,” and “Understanding the Cyberbiosecurity Threat.” Read here.
“Virology-the Path Forward”
Rasmusen et al. recently published this commentary article in the Journal of Virology. They write in their abstract, “In the United States (US), biosafety and biosecurity oversight of research on viruses is being reappraised. Safety in virology research is paramount and oversight frameworks should be reviewed periodically. Changes should be made with care, however, to avoid impeding science that is essential for rapidly reducing and responding to pandemic threats as well as addressing more common challenges caused by infectious diseases. Decades of research uniquely positioned the US to be able to respond to the COVID-19 crisis with astounding speed, delivering life-saving vaccines within a year of identifying the virus. We should embolden and empower this strength, which is a vital part of protecting the health, economy, and security of US citizens. Herein, we offer our perspectives on priorities for revised rules governing virology research in the US.”
“Interpreting the Biological Weapons Convention – What Are “Necessary Measures” Under Article IV of the Convention?”
Sally Longworth recently published this report with the Swedish Defence Research Agency. She explains in her summary, “Article IV of the Biological Weapons Convention 1972 (BWC) requires States Parties to implement national implementation measures to prohibit and prevent the development, production, stockpiling, retention, acquisition, transfer, and use of biological agents, toxins and weapons in violation of the Convention. No definition of “national implementation measures” is included in the treaty, but there has been over 50 years of State practice in implementing this obligation, which can provide guidance on how States Parties interpret the obligations under Article IV. The Final Declarations agreed by consensus by States Parties at the Convention Review Conferences held every five years are particularly useful tools in understanding what measures are required and what, if any, development there has been in interpreting Article IV. Using legal methods to interpret international treaties, this memo first analyses the obligations set out in Article IV and then considers the interpretative value of the Final Declarations in relation to the BWC. It goes on to highlight a number of measures identified by the States Parties considered necessary in the implementation of the obligations contained in Article IV and important developments in what must be covered.”
“Vision, Needs, and Proposed Actions for Data for the Bioeconomy Initiative”
The National Science and Technology Council recently released this report from the Interagency Working Group on Data for the Bioeconomy. Its executive summary explains in part, “To realize a thriving bioeconomy, the Data Initiative identifies strategic investments and opportunities to leverage and build upon existing resources. The goal is to create an interwoven data fabric that connects data with the infrastructure and computational resources necessary to analyze, synthesize, and use those data for the widest audience. This vision depends on creation and adoption of community-driven standards, both for data and for repositories to enable interoperability and integration; training and education to build the bioeconomy data workforce of tomorrow; efforts to limit and mitigate security risks; and ongoing coordination to ensure efforts keep pace with transformations in data science, computing, biotechnology and biomanufacturing. While additional data are needed, government coordination and investment in infrastructure are also needed to make best use of the existing and anticipated data.”
Furthermore, in identifies seven Core Action areas the Data Initiative indicates requires “consistent whole-of-government coordination and investments”:
Dedicated long-term funding mechanisms for data and computational resources and infrastructure;
Standards to establish common best practices that foster and strengthen a shared U.S. bioeconomy data ecosystem;
Biodata Catalog to identify extant data and metadata;
Security practices and policies that secure the data landscape while supporting innovation;
Workforce to drive U.S. leadership in the bioeconomy of the future;
Strategically Targeted Areas for Rapid Transformation (START) to determine viability and impact and chart a course for larger investments; and
Coordination of intergovernmental investments, efforts, and resources.
“FACT SHEET: Biden-Harris Administration Releases Global Health Security Partnerships Annual Progress Report Demonstrating Results from United States Investments”
The White House recently released this fact sheet along with the release of its Global Health Security Partnerships Annual Progress Report. The fact sheet explains in its introduction, “The Biden-Harris Administration continues to prioritize global health security as a critical component of national biodefense. The COVID-19 pandemic, as well as HIV/AIDS, Ebola, mpox and other outbreaks in recent years, has demonstrated the catastrophic impacts infectious diseases can have on health, economies, and societies, regardless of where they start. The United States partners with countries around the world to build stronger global health security capacity – the ability to prevent, detect, rapidly respond to, and recover from new and emerging public health threats and prevent their spread across borders. Partnering with countries to stop infectious disease threats at their source, including by strengthening equitable health systems in their own countries and across regions, effectively protects the health of Americans and people across the world.”
“Exploring Actions for Epidemic and Pandemic Preparedness”
The National Academies recently released this Proceedings of a Symposium-in Brief: “Investing in pandemic preparedness ahead of disease outbreaks can greatly reduce the toll of epidemics and pandemics when they occur. Although several tools exist for assessing pandemic preparedness at an epidemiological and operational level, less information and fewer approaches are available to guide the prioritization of preparedness investments at the country level. The National Academies of Sciences, Engineering, and Medicine held an international, virtual symposium series in May and June 2023 to explore possible strategies for evidence-based prioritization of global health capabilities to prepare for future epidemics and pandemics. Speakers and participants discussed assessment tools for national action planning; country and organizational decision-making about funding priorities; effective approaches for disease surveillance and risk communication; governance structures that support robust and reliable systems for global health investments; and specific actions for tools and resource prioritization for preventing and preparing for future epidemics and pandemics. This publication summarizes the presentation and discussions of the symposium.”
“America Should Be More Like Operation Warp Speed”
Gary Hamel and Michele Zanini recently published this Ideas piece in The Atlantic focused on how OWS offers lessons for the rest of the government in achieving goals. They write in their introduction, “The U.S. government can achieve great things quickly when it has to. In November 2020, the Food and Drug Administration granted emergency-use authorization to the Pfizer-BioNTech vaccine for COVID-19. Seven days later, a competing vaccine from Moderna was approved. The rollout to the public began a few weeks later. The desperate search for a vaccine had been orchestrated by Operation Warp Speed, an initiative announced by the Trump administration that May. Developing, testing, manufacturing, and deploying a new vaccine typically takes a decade or more. OWS, which accomplished the feat in months, belongs in the pantheon of U.S. innovation triumphs, along with the Manhattan Project and the Apollo moon-landing program. It’s a case study in how the U.S. government can solve complex, urgent problems, and it challenges the narrative that public institutions have lost their ability to dream big and move fast.”
“Why the World Needs Its Own Immune System”
Atul Gawande, USAID’s Assistant Administrator for Global Health, recently published this opinion piece in The New York Times. He writes in part, “This is now the pattern: one emergency after another, often overlapping, diverting focus away from longer-term public health goals. And there’s no sign of this letting up. Displacement and activities like deforestation have increased contact between humans and wildlife — and thus the incidence of animal diseases leaping to humans. (The Ebola virus, for example, has been linked to bats as a possible source of spread.) The risk of outbreak-causing laboratory accidents is a significant concern as labs proliferate and safety measures lag. On average, between 1979 and 2015, more than 80 laboratory-acquired infections were reported per year, several involving transmission beyond those initially infected, and underreporting is rife. The growing field of synthetic virology has simultaneously generated lifesaving new treatments (mRNA vaccines, for example) and made it easier for bad actors to turn infectious diseases into weapons of mass destruction.”
“But we can break the pattern. Longer-range investment in local preparedness for such events — in building what I think of as a global immune system — could reduce the threat these crises pose and even reduce dependence on foreign aid to weather them. As dangers rise, so can our capacity to get ahead of them. With the right strategy, we could use the mishaps, malefactors and shocks we face to strengthen our capacity to adapt. This is not about developing resilience (the ability to recover from crisis) or robustness (the ability to resist crisis). It is about developing what the writer Nassim Nicholas Taleb has called antifragility — the ability to become stronger from crisis.”
“The OPCW and Civil Society: Considerations on Relevant Themes and Issues”
Alexander Ghionis recently published this working paper for CBWNet. He explains in its executive summary, “This paper explores some key elements of the relationship between the Organisation for the Prohibition of Chemical Weapons (OPCW) and civil society, with the specific and limited aim of supporting ongoing discussions being held within the OPCW regarding options and mechanisms to enhance that relationship. The paper is designed to be practical, providing readers from State Parties, the Technical Secretariat, civil society, and other stakeholders, with some initial perspectives, ideas, and considerations that could inform discussions.”
The paper addresses “The composition and focus of accredited civil society organisations (CSOs); How CSOs have engaged with the OPCW so far and what alternative modes of engagement may be beneficial; and, What foundational aspects can strengthen the relationship between the OPCW and civil society moving forward.”
“The Altered Nuclear Order in the Wake of the Russia-Ukraine War”
Rebecca Davis Gibbons, Stephen Herzog, Wilfred Wan, and Doreen Horschig recently published this research paper with the American Academy of Arts & Sciences. They explain in their executive summary: “On February 24, 2022, Russia invaded nonnuclear-armed Ukraine and leveraged threats with its nuclear arsenal as a “shield” to deter third-party intervention. The well-publicized horrors on the ground in Ukraine are, unfortunately, not the only consequences of Russia’s full-scale invasion of its neighbor. The war is having unmistakable effects on how governments, scholars, and the public think about nuclear arms. Not only has Moscow reintroduced the world to the often-unsavory realities of nuclear deterrence, but its suspension of the New Strategic Arms Reduction Treaty (START) and deratification of the Comprehensive Nuclear-Test-Ban Treaty (CTBT) have been setbacks for arms control and disarmament. Meanwhile, vulnerable states around the globe may be further incentivized to develop nuclear weapons or seek protection from nuclear-armed patrons to avoid being invaded like Ukraine.”
“Given these changing geopolitical circumstances, how might the Russian war on Ukraine affect the global nuclear order? The authors in this publication conclude that the United States and the broader international community must now more seriously engage with alternatives to traditional arms control, nonproliferation, and disarmament endeavors. Specifically, the authors discuss the increasing prominence of approaches such as the Treaty on the Prohibition of Nuclear Weapons (TPNW)—popularly known as the Nuclear Ban—and risk reduction measures. They assess whether these initiatives can have an impact in reducing nuclear dangers. Additionally, they examine temptations for states to pursue more forceful counterproliferation measures and describe the risks of doing so.”
NEW: “When Medicine Stops Saving Us: The Antimicrobial Resistance Crisis”
“Interim Dean Abel Valenzuela and the UCLA Division of Social Sciences present an exclusive screening of a new documentary from the team behind the award winning NETFLIX documentary, RESISTANCE. This genre-bending short film, HOLOBIOME, features the harrowing story of UCLA graduate Bradley Burnam’s personal encounter with a deadly superbug. Through a variety of creative elements, HOLOBIOME examines the need for innovation in AMR and questions the overall human relationship with infectious disease and the microbial world. The screening will be followed by an interdisciplinary panel discussing the looming AMR crisis through the lenses of sociology, public policy, industry, and public health.”
This event will be moderated by Biodefense PhD Program alumna Jomana Musmar. It will take place on January 22, at 5 pm PST. Learn more and register here.
NEW: AI Executive Order Report Card Reviewing the First 90 Days
“On October 30, 2023, the Biden Administration issued a call to action outlining a host of requirements and deliverables for U.S. government agencies on artificial intelligence. The executive order touched on a range of AI-relevant issues, including testing and evaluation of new AI systems, developing a healthy and capable U.S. AI workforce, and ensuring U.S. competitiveness in the years to come.”
“Join CSET researchers on January 31, 2024, for a discussion of what the U.S. Government has accomplished so far, what have we learned, and what’s left to do to complete the EO’s ambitious goals.”
This online event will begin at 12 pmEST. Learn more and register here.
International Conference, CBRNE Research & Innovation
“The last 40 years have demonstrated that both military and civilian populations could be exposed to highly hazardous CBRNE agents following conflicts, natural outbreaks and disasters, industrial incidents or terrorist attacks.”
“Worldwide, researchers, responders and industrial capacities have been commited to provide adapted response to these challenges.”
“Building on the success of the first 5 International Conferences « CBRNE Research and Innovation » which took place in Antibes (2015), Lyon (2017), Nantes (2019), on line (2021) and Lille (2022), we want to give you a new opportunity to build up or strengthen collaborative networks in Strabourg (March 19th – 21rst 2024).”
“The CBRNE R&I Conference is specifically devoted to scientific updates, responders’ feedbacks and expression of needs. It also includes workshops and demonstrations of innovative materials, technologies and procedures, according to the following themes: DETECTION – IDENTIFICATION, PROTECTION – DECONTAMINATION, MEDICAL COUNTERMEASURES, RISKS & CRISIS MANAGEMENT.”
“Looking forward to your proposals for communication and to welcoming you at Strasbourg in March 2024!”
Registration is now open for the Global Health Security 2024 conference in Sydney, Australia. This iteration will take place 18-21 June, 2024. The call for abstracts is also still open. “The mission of the Global Health Security conference is to provide a forum where leaders, researchers, policy-makers, and representatives from government, international organisations, civil society, and private industry from around the world can engage with each other, review the latest research and policy innovations, and agree solutions for making the world safer and healthier. To that end, our mission is to help foster a genuinely multidisciplinary community of practice that is committed to working collaboratively to enhance global health security and eliminate disease, irrespective of its origin or source.”
Vote: 2023 Arms Control Person(s) of the Year Nominees
“Since 2007, the independent, nongovernmental Arms Control Association has nominated individuals and institutions that have, in the previous 12 months, advanced effective arms control, nonproliferation, and disarmament solutions and raised awareness of the threats posed by mass casualty weapons.”
“In a field that is often focused on grave threats and negative developments, the Arms Control Person(s) of the Year contest aims to highlight several positive initiatives—some at the grassroots level, some on the international scale—designed to advance disarmament, nuclear security, and international peace, security, and justice.”
“Voting will take place between Dec. 8, 2023, and Jan. 11, 2024. The results will be announced on Jan. 12, 2024. Follow the discussion on social media using the hashtag #ACPOY2023.”
Happy first day of winter! This week we are covering updates on Russia’s actions in Ukraine, anthrax outbreaks in parts of Africa, efforts to get the Pandemic and All-Hazards Preparedness Act reauthorized, and OpenAI’s plan to manage threats posed by its AI platforms. This is the last issue of the Pandora Report for 2023. We will see you next year but, until then, have a happy rest of the holiday season!
Russia Tear Gases UkrainianForces
Recent reporting from CNN explained that, in addition to using wave after wave of convicts-turned-recruits, Russia has increasingly begun to use CS gas on Ukrainian forces: “Those fighting in besieged Ukrainian trenches say they now face another threat: the use of gas as a weapon. Nine incidents have been recorded in recent weeks in this area, one Ukrainian combat medic told CNN, in which a caustic and flammable gas had been dropped by drones onto Ukrainian lines, causing one fatality. The gas is used to cause panic and followed by conventional shelling or drone attacks, soldiers impacted said…A Ukrainian intelligence official told CNN the substance deployed by the Russians was a form of CS gas.”
CS (chlorobenzylidenemalononitrile) gas, commonly referred to colloquially as tear gas, is used as a riot control agent. According to the CDC, these agents “…are chemical compounds that temporarily make people unable to function by causing irritation to the eyes, mouth, throat, lungs, and skin.” Use of these agents in war is prohibited under the Chemical Weapons Convention.
The same CNN report later explained that “Two soldiers who survived a gas attack showed CNN medical reports indicating they had been poisoned. “At first I saw smoke,” one told CNN. “We ran out from the trench and the gas suddenly caught fire. The trench was in flames. This gas burns, blinds you, you can’t breathe, shoots down your throat immediately. We didn’t even have a second.”‘
“The alleged use of chemical agents on the battlefield marks another sign of the brutality and mendacity of Russia’s renewed fight for the terrain it lost. Ukraine had hoped for greater advances during the summer toward the Azov Sea, yet now must defend its minor gains.”
Russian Troops Reportedly Dying from “Mouse Fever”
Russian troops in Ukraine’s Kharkiv region are reportedly suffering an outbreak of “mouse fever,” a hemorrhagic fever. Ukraine’s Main Directorate of Intelligence of the Ministry of Defence of Ukraine (HUR) recently reported that “dissatisfaction is growing in the units of the Russian occupation army due to inadequate provision of winter clothing and a complete lack of medical care,” likely contributing to the rapid spread of this disease.
The Kyiv Post also explained that HUR reports that complaints about the outbreak on the front lines fell on deaf ears, with Russian leadership viewing them as “…another manifestation of attempts to avoid combat operations.” HUR has also reported that the disease initially presents with flu-like symptoms, and that it is a viral disease transmitted to humans from rodents via contact with bodily fluids. As the same Kyiv Post article explains, “Symptoms of mouse fever include severe headache, fever up to 40 degrees, rashes and redness, low blood pressure, hemorrhages in the eyes, nausea, and vomiting several times a day. The disease also affects the kidneys, a person infected with mouse fever experiences intense low back pain and will have serious difficulty urinating.”
HUR’s reporting on the outbreak did not identify a specific pathogen, though it did suggest this could be hemorrhagic fever with renal syndrome (HFRS), driving online speculation that this outbreak was caused by a hantavirus despite some outlets reporting it was caused by the bacterial rat-bite fever. The WHO explains that HFRS is “…an acute interstitial nephropathy characterized by high fever and varying degrees of renal insufficiency and hemorrhage. HFRS is caused by viruses belonging to the old world lineage of the Hantavirus genus of the family Bunyaviridae.”
The WHO further explains that “Various haemorrhagic fevers with a very similar syndrome have been reported throughout Europe and Asia, notably HFRS in the former Soviet Union, Songo fever in China, epidemic nephritis or epidemic haemorrhagic fever in Eastern Europe and Japan, and Hantaan virus in Korea. Several rodents and other small mammals harbor hantaviruses, and in urban areas, where rodent control is feasible, efforts can be made to reduce contact between humans and rodent excreta.”
Regardless of what is causing this outbreak, this is a tale as old as time. War and disease go hand-in-hand, highlighting the importance of maintaining sanitary practices, particularly when turning to trench warfare. Russia’s military has historically struggled with maintaining sanitary conditions, as noted by Amnesty International in the late 1990s and Russia’s own inspectors in the early 2010s, all of which has conicided with persistent challenges in professionalizing the military and maintaining supply lines during the current conflict.
Five African Countries Report Anthrax Outbreaks
The WHO has confirmed that five countries in eastern and southern Africa are experiencing outbreaks of anthrax, with at least 20 related deaths reported since the start of 2023. There are currently over 1,160 presumed anthrax cases in Kenya, Malawi, Uganda, Zambia, and Zimbabwe, though only 35 have been confirmed by laboratory testing. Zambia is currently fighting its largest anthrax outbreak since 2011, with nine of its ten provinces impacted. Though experts say this all is not unusual nor unreasonable, it is notable that, in Uganda, many of the presumed cases have tested negative for anthrax, potentially indicating a different disease is circulating.
The WHO explained in its December 11 press release on the matter that, “The outbreaks are presenting varied patterns in the affected countries. In Kenya, three deaths have been reported this year compared with zero fatalities from over 200 suspected cases in 2022. While the disease is endemic in animals in Malawi, the country reported its first ever human case this year. Human anthrax cases have been reported in three districts in Uganda, with 13 deaths compared with two deaths in 2022. The high case fatality ratio is due to patients reporting late to health facilities. In Zimbabwe, human cases have been reported every year since 2019, underscoring the need for stronger preventive actions.”
“Joint multidisciplinary teams have deployed at country level to support assessments, identify gaps and take measures to strengthen the outbreak response. WHO is also working closely with the Food and Agriculture Organization of the United Nations (FAO), United Nations Environment Programme and World Organisation for Animal Health to coordinate response in the affected countries leveraging the One Health Platforms…The outbreaks are likely being driven by multiple factors, including climatic shocks, food insecurity, low risk perception and exposure to the disease through handling the meat of infected animals.”
115 Organizations Urge Congress to Reauthorize PAHPA
A list of 115 organizations is formally calling on Congress to reauthorize the bipartisan Pandemic and All-Hazards Preparedness Act (PAHPA), according to a press release from the Senate Health, Education, Labor and Pensions (HELP) Committee. PAHPA expired on September 30 and has yet to be reauthorized by Congress, though the HELP Committee did pass legislation to reauthorize it in a 17-3 vote this summer.
The HELP Committee explained in its statement “Congress first enacted PAHPA in 2006, largely to address the failures of the federal response following Hurricane Katrina. The legislation sought to support states, local governments, and hospitals so they would be better prepared for future emergencies. It established the Office of the Assistant Secretary for Preparedness and Response (ASPR) and the Biomedical Advanced Research and Development Authority (BARDA). It also made improvements to the National Disaster Medical System and other resources to improve medical surge capacity during an emergency. PAHPA was previously reauthorized on a bipartisan basis in 2013 and 2019.”
A list of the 115 organizations involved is available at the link above.
OpenAI Unveils Plan for Managing AI Dangers
OpenAI, the company perhaps most famous for its ChatGPT chatbot, recently announced how it plans to prepare for what it believes to be potential threats posed by the technology it develops. A recent article from The Washington Post explains the plan, reading “OpenAI’s “Preparedness” team, led by MIT AI professor Aleksander Madry, will hire AI researchers, computer scientists, national security experts and policy professionals to monitor the tech, continually test it and warn the company if it believes any of its AI capabilities are becoming dangerous. The team sits between OpenAI’s “Safety Systems” team, which works on such existing problems as infusing racist biases intoAI, and the company’s “Superalignment” team, which researches how to ensure AI doesn’t harm humans in an imagined future where the tech has outstripped human intelligence completely.”
“The preparedness team is hiring national security experts from outside the AI world who can help OpenAI understand how to deal with big risks. It is beginning discussions with organizations, including the National Nuclear Security Administration, which oversees nuclear technology in the United States, to ensure the company can appropriately study the risks of AI, Madry said.”
“The team will monitor how and when OpenAI’s tech can instruct people to hack computers or build dangerous chemical, biological and nuclear weapons, beyond what people can find online through regular research. Madry is looking for people who “really think, ‘How can I mess with this set of rules? How can I be most ingenious in my evilness?’”
“Dr. Jomana Musmar, MS, PhD – Designated Federal Officer and Executive Director – PACCARB”
Check out this conversation with Biodefense PhD Program alumna Jomana Musmar on the Progress, Potential, and Possibilities YouTube channel: “Dr. Jomana Musmar, MS, PhD, is the Designated Federal Officer and Executive Director of the Presidential Advisory Council on Combating Antibiotic Resistant Bacteria ( https://www.hhs.gov/ash/advisory-comm… ), and Senior Public Health Advisor within the Office of Infectious Diseases and HIV/AIDS Policy ( https://www.hhs.gov/oidp/index.html ), at the U.S. Department of Health and Human Services (HHS).”
“The Presidential Advisory Council on Combating Antibiotic-Resistant Bacteria ( PACCARB – https://www.hhs.gov/ash/advisory-comm… ) is a US federal advisory committee that provides advice, information, and recommendations to the U.S. Secretary of Health and Human Services (HHS Secretary). The council supports and evaluates U.S. government activities focused on fighting antimicrobial resistance (AMR) in human health, animal health, and environmental health. Using this One Health approach, members of the PACCARB have expertise from a range of backgrounds, including academia, industry, public health, advocacy, veterinary, and agricultural production.”
“Dr. Musmar has been managing the PACCARB since its establishment in 2015, during which time she has hosted 24 public meetings and overseen the development of seven reports providing recommendations on a range of issues related to antimicrobial-resistance (AMR) for both human and animal health.”
“Dr. Musmar has over 10 years of Federal Advisory Committee experience, with a focus on the areas of public health, biodefense, and AMR. Her graduate degrees include a Master’s in Biomedical Science Policy from Georgetown University School of Medicine and a Doctorate in Biodefense and Homeland Security from George Mason University.”
“The Health Security Outcomes of APEC and the Biden-Xi Dialogue”
Recent Biodefense MS grad Sophie Hirshfield just published this piece for CSIS, addressing key global health questions following the APEC summit and Biden-Xi meeting. She explains in her introduction, “From November 14 to 16, leaders from the 21-member Asia-Pacific Economic Cooperation (APEC) group met in San Francisco to discuss promoting trade and economic growth across the Pacific region. On the sidelines of the forum, Presidents Joe Biden and Xi Jinping convened for their first in-person meeting in a year. While the meetings provided an opportunity to keep public health priorities on the diplomatic agenda, they led to few meaningful new commitments on U.S.-China health security cooperation.”
“Public Health Agencies Are Using AI Chatbots to Ease Workloads. Is It a Good Idea?”
Biodefense PhD Student Kimberly Ma recently published this piece with The Bulletin of the Atomic Scientists. In it, she explains in part, “There’s a real risk that large-language models like ChatGPT contribute to online disinformation and misinformation. In a call earlier this year for the safe and ethical use of AI, the World Health Organization (WHO) worried that AI responses “can appear authoritative and plausible to an end user” but be “completely incorrect or contain serious errors, especially for health-related” matters. Similarly, the organization warned AI may be “misused to generate and disseminate highly convincing disinformation in the form of text, audio or video content that is difficult for the public to differentiate from reliable health content.” Just as media organizations have been caught publishing AI-generated content riddled with inaccuracies, public health workers need to ensure they are not accidentally producing well-intentioned deliverables with critical errors. And in an environment when adversarial countries, antivaxxers, and politicians operate individually or in networks to spread disinformation online, public health agencies will be up against bad actors with the same technology they have.”
“Preparing for the Next Pandemic Response Through Strengthened Collaboration”
Donnel Harvin, a member of the Schar School faculty, recently co-authored this white paper for NEMA: “This report synthesizes the insights from the National Emergency Management Association (NEMA) Pandemic Workshop hosted in June of 2023. The Centers for Disease Control and Prevention (CDC) funded the project. The workshop brought together emergency management directors and state public health officers from eight states to discuss their collaborative response to the COVID-19 pandemic in the very early phases of the response, January 2020 – January 2022. The particular focus was on the identification of friction points, successes, and opportunities for increased collaboration. Federal partners were invited to discuss issues with federal integration into state COVID-19 response efforts. The discussions highlighted a range of complex issues encompassing roles and authorities, data collection and sharing, equity concerns, and communication, with an emphasis on state and local levels as well as rural and urban experiences.”
“Advancing Governance Models for Frontier for AIxBIO: Key Takeaways and Action Items from the Johns Hopkins Center for Health Security Metting with Industry, Government, and NGOs, 29 November 2023”
Johns Hopkins Center for Health Security recently published a “…summary of high-level findings that identify concrete next steps needed following its recent convening of leading AI labs, executive branch officials, and biosecurity experts…” that “was informed by discussions during a not-for-attribution meeting hosted by the Center. The meeting was attended by around 50 participants, including those from 6 different leading AI companies as well as government officials from the White House and several government agencies with responsibility for managing potential AIxBio risks.”
The report calls for “…the creation of an ongoing public-private forum to facilitate the sharing of important information related to biosecurity risks; a regulatory framework that defines mandatory practices, reporting, and oversight of highly capable AI models; and a legal accountability framework to incentivize developers and deployers of models to adequately address emergent risks.”
“Generative AI and Weapons of Mass Destruction: Will AI Lead to Proliferation?”
Ian Stewart unpacks potential proliferation threats posed by LLMs in this Medium post, writing in part “Large Language Models (LLMs) caught popular attention in 2023 through their ability to generate text based on prompts entered by the user. LLMs have also proven capable of generating code, summarizing text, and adding structure to unstructured text, among others. There remain questions around the real-world usefulness of LLMs in many domains, particularly given some of the difficulties in solving limitations of LLMs such as hallucination. Nonetheless, some have raised concerns about the ability of LLMs to contribute to nuclear, chemical and biological weapons proliferation (CBRN). Put simply, could a person learn enough through an interaction with an LLM to produce a weapon? And if so, would this differ from what the individual could learn by scouring the internet?”
“Poll: Voters Support Bringing EU-Style AI Regulations to the US, Prioritizing Safety Over Speed in Research”
New from the Artificial Intelligence Policy Institute: “A new poll conducted by the Artificial Intelligence Policy Institute (AIPI) shows that the American public supports the passage of the European Union’s AI Act by nearly a 4:1 margin, and 64% support similar regulation in the United States.”
“The survey showed strong public support for a slowdown of AI research and skepticism of tech companies; respondents decisively back federal regulation that curbs rapid AI research and development by private companies. By a 2:1 margin, respondents agree that it is the role of the government to make sure companies don’t go too fast when developing AI models. 75% say the government should restrict what private companies can do when training AI models.”
“AIPI also surveyed public opinion on risky research initiatives across AI development and dangerous virus research—particularly relevant as scientists and the federal government look to revise guidelines on potential pandemic pathogens. 83% of the public is in agreement that the federal government should implement renewed oversight protocols on research experiments using dangerous viruses. When prompted about AI being in such research, 68% say that we should be concerned that bad actors could use AI to create biological weapons.”
“Shaping the Future US Bioeconomy Through Safety, Security, Sustainability, and Social Responsibility”
Attal-Juncqua et al. recently published this article in Trends in Biotechnology: “Biomanufacturing practitioners and researchers describe the norms that should govern the growing, global field, to include safety, security, sustainability, and social responsibility. These ‘4S Principles’ should be broadly adopted so that the future of the field may provide the greatest benefits to society.”
“Stability of Pathogens on Banknotes and Coins: A Narrative Review”
Meister et al. recently published this article in the Journal of Medical Virology: “For the prevention of infectious diseases, knowledge about potential transmission routes is essential. Pathogens can be transmitted directly (i.e. respiratory droplets, hand-to-hand contact) or indirectly via contaminated surfaces (fomites). In particular, frequently touched objects/surfaces may serve as transmission vehicles for different clinically relevant bacterial, fungal, and viral pathogens. Banknotes and coins offer ample surface area and are frequently exchanged between individuals. Consequently, many concerns have been raised in the recent past, that banknotes and coins could serve as vectors for the transmission of disease-causing microorganisms. This review summarizes the latest research on the potential of paper currency and coins to serve as sources of pathogenic viral, bacterial, and fungal agents. In contrast to the current perception of banknotes and coins as important transmission vehicles, current evidence suggests, that banknotes and coins do not pose a particular risk of pathogen infection for the public.”
What We’re Watching 🍿
The Biological Weapons Convention and the Need for a Compliance and Verification Mechanism
New from the Geneva Center for Security Policy: “The GCSP’s Head of Arms Control and Disarmament speaks to three experts on biological security from King’s College London about the start of discussions by the States Parties to the Biological Weapons Convention (BWC) on compliance and verification. They discuss why a compliance and verification mechanism is needed, what can be learned from the previous verification efforts in other contexts, and what has changed in how verification is done since this was last discussed in the BWC framework over 20 years ago. The experts also discuss what the key elements of any mechanism will need to be, what are the most important bio security incidents, and how countries are working on their preparedness to respond to such incidents. The GCSP will be following the discussions in the BWC closely and stands ready to be a platform to bring together all stakeholders to generate new thinking to strengthen the BWC to respond to today’s bio security challenges.”
What We’re Listening To 🎧
PODCAST | Rethinking Our Defense Against Unknown Biothreats
“Dr. Harshini Mukundan, Program Manager and Scientist for Chemical and Biological Technologies at the Office of National and Homeland Security, Lawrence Berkeley National Laboratory, and visiting Scientist at Los Alamos National Laboratory sat down with host and AAAS STPF fellow Adejare (Jay) Atanda to discuss her research on pathogen agnostic disease detection and diagnostics, why this is important for biodefense against unknown biothreats, the role of technological innovations in pathogen agnostic detection and diagnostics, limitations of existing technological tools, and the vital importance of public-private partnerships in transforming this field. This conversation also covered the challenges women, people of color and immigrants face as scientists, the importance of mentorship in mitigating these challenges and her own mentorship and advocacy work to educate young girls about STEM careers as a AAAS IF/THEN STEM Ambassador and guest on CBS’s “Mission Unstoppable” among other efforts.”
Poisons and Pestilence: 20 Bonus Episode: No Fire No Thunder with Alastair Hay
Check out this episode with Alastair Hay, discussing his work as a toxicologist as it relates to the prohibition of chemical weapons.
61st ISODARCO Course: Nuclear Order and International Security after Ukraine
“The war in Ukraine has had an enormous impact on global security, reviving nuclear fears, undermining the prospects for arms control, and shattering many of the norms and constraints that were the foundation of European security. ISODARCO 2024 will examine the global nuclear order in light of the Ukraine war, focusing on the states, the policies and the technologies that will shape the future in a much more difficult environment. How will we cope with this more dangerous world?”
This course will take place January 7-14, 2024, at the University of Trento. Learn more and register here.
International Conference, CBRNE Research & Innovation
“The last 40 years have demonstrated that both military and civilian populations could be exposed to highly hazardous CBRNE agents following conflicts, natural outbreaks and disasters, industrial incidents or terrorist attacks.”
“Worldwide, researchers, responders and industrial capacities have been commited to provide adapted response to these challenges.”
“Building on the success of the first 5 International Conferences « CBRNE Research and Innovation » which took place in Antibes (2015), Lyon (2017), Nantes (2019), on line (2021) and Lille (2022), we want to give you a new opportunity to build up or strengthen collaborative networks in Strabourg (March 19th – 21rst 2024).”
“The CBRNE R&I Conference is specifically devoted to scientific updates, responders’ feedbacks and expression of needs. It also includes workshops and demonstrations of innovative materials, technologies and procedures, according to the following themes: DETECTION – IDENTIFICATION, PROTECTION – DECONTAMINATION, MEDICAL COUNTERMEASURES, RISKS & CRISIS MANAGEMENT.”
“Looking forward to your proposals for communication and to welcoming you at Strasbourg in March 2024!”
Registration is now open for the Global Health Security 2024 conference in Sydney, Australia. This iteration will take place 18-21 June, 2024. The call for abstracts is also still open. “The mission of the Global Health Security conference is to provide a forum where leaders, researchers, policy-makers, and representatives from government, international organisations, civil society, and private industry from around the world can engage with each other, review the latest research and policy innovations, and agree solutions for making the world safer and healthier. To that end, our mission is to help foster a genuinely multidisciplinary community of practice that is committed to working collaboratively to enhance global health security and eliminate disease, irrespective of its origin or source.”
Vote: 2023 Arms Control Person(s) of the Year Nominees
“Since 2007, the independent, nongovernmental Arms Control Association has nominated individuals and institutions that have, in the previous 12 months, advanced effective arms control, nonproliferation, and disarmament solutions and raised awareness of the threats posed by mass casualty weapons.”
“In a field that is often focused on grave threats and negative developments, the Arms Control Person(s) of the Year contest aims to highlight several positive initiatives—some at the grassroots level, some on the international scale—designed to advance disarmament, nuclear security, and international peace, security, and justice.”
“Voting will take place between Dec. 8, 2023, and Jan. 11, 2024. The results will be announced on Jan. 12, 2024. Follow the discussion on social media using the hashtag #ACPOY2023.”
This week covers the FDA’s ongoing investigation into contaminated applesauce, the passing of Gao Yaojie-an activist responsible for bringing to light the extent of China’s AIDS epidemic-, and more.
Biodefense MS Graduates Riley Flynn and Sophie Hirshfield at GMU’s 2023 Winter Commencement Ceremony
FDA Leadership Says Tainted Applesauce Pouches May Have Been Intentionally Contaminated
Cinnamon applesauce pouches available Weis, WanaBanana, and Schnucks have been pulled from shelves after they were found to be contaminated with lead. Dozens of children in the United States have been sickened by the tainted products. Now, the FDA’s Deputy Commissioner for Human Foods, Jim Jones, says they may have been intentionally contaminated.
In an interview with Politico, Jones said “We’re still in the midst of our investigation. But so far all of the signals we’re getting lead to an intentional act on the part of someone in the supply chain and we’re trying to sort of figure that out.” All of the pouches in question were linked to a manufacturing facility in Ecuador that the FDA is currently inspecting.
‘“My instinct is they didn’t think this product was going to end up in a country with a robust regulatory process,” Jones said. “They thought it was going to end up in places that did not have the ability to detect something like this.”’
Politico further explained that “The FDA continues to investigate a number of theories for how the pouches became contaminated, and has not drawn any conclusions about the way the lead was added, why or by whom. The FDA says it currently believes the adulteration is “economically motivated.” That generally refers to ingredients being altered in order to make products appear higher in value, often so companies can produce a cheaper item and sell it at an elevated price.”
“The agency and the Centers for Disease Control and Prevention have collaborated with state and local health authorities as well as Ecuadorian authorities to trace the origin of the cinnamon in the applesauce pouches, which is believed to be the source of the lead contamination. More than 60 U.S. children under the age of 6 have tested positive for lead poisoning after consuming the pouches — some at levels more than 500 times the acceptable threshold for lead, according to The Washington Post.”
Gao Yaojie, Chinese Physician and Self-Exiled AIDS Activist, Dead at 95
Gao Yaojie, a gynecologist and well-known AIDS activist, died on December 10 in New York City. Gao, formerly based in China’s Henan province, was famous for her work to expose the outbreak of HIV/AIDS in the country in the 1990s and 2000s. The outbreak was large in scale and primarily driven by the country’s Plasma Economy, which arose because of restrictions on foreign imports of blood products in the 1990s. This resulted in blood plasma donation becoming a way for rural populations to make money in government-supported plasma donation centers. However, unsafe practices like repeated use of unsterilized needles and pooling multiple donors’ blood during the plasmapheresis allowed HIV to spread widely.
Because of the Chinese government’s efforts to suppress reporting on this epidemic, poor rural populations were left largely unaware of the dangers of plasma donation and the public in general was unaware of the severity of the crisis. Gao was one of the first to speak publicly about the outbreak, helping draw the attention of media outlets. She later told documentary filmmakers about her motivations for doing this, saying, “My driving thought is: how can I save more people from dying of this disease? We each only live one life.”
It is estimated that at least one million Chinese were infected with HIV during this epidemic, highlighting the importance of Gao’s and others’ bravery. For this, she garnered praise from the United Nations, several Western organizations, and even Hillary Clinton. This rising fame led to her being placed under house arrest in 2007, with about 50 police preventing her from traveling to the United States to accept an award recognizing her work. In response to this, she told NPR “I think they feel I got in the way of their political achievements and their official careers…Otherwise, why would they put me under house arrest? What law did I break to warrant mobilizing all these police?”
NPR further explained her activities later in life in their article on her passing, writing: “Despite pressure from Henan provincial authorities to stop publicizing the AIDS crisis, she continued her work, using all the proceeds from her books and pamphlets to support AIDS families, especially children orphaned by the disease or the many suicides that it caused.”
“Restrictions on her movement began hindering in work in China, however, and in 2009, she abruptly fled to the US, after fearing she would be put under house arrest again. Many admirers continued to visit her apartment in West Harlem, including a group of young Chinese students who kept her company in the loneliness of exile.”
‘”Many Chinese regarded her as a hero, and when they came to New York, if they didn’t know how to contact her , [sic] they would ask me. I would ask them for an email written in Chinese and would forward it to her. So far as I know, she always wrote back to those people and welcomed them to come visit,” remembers Andrew Nathan, a political science professor at Columbia University who handled much of Gao’s affairs in New York.”
“The Biological and Toxin Weapons Convention in 2023: Glimmers of Progress Set Against a Troubled Geopolitical Landscape”
Experts at CSR’s Nolan Center, including Biodefense PhD Program alumna and current faculty member Saskia Popescu, recently authored this blog post focused on the BWC’s potential for success in verification, universalization and effective implementation in Africa, and the creation of an International Agency for Biological Safety. They explain in their introduction: “For nearly two decades, efforts to strengthen the Biological and Toxin Weapons Convention (BWC) were in stasis, with opportunities missed and States Parties unable to agree to definite action. States Parties arrived at the Review Conference last year facing a growing biological weapons threat—augmented by rapidly converging complimentary technologies—coupled with a status quo in the BWC that was insufficient for the task. Yet nations drove a breakthrough: the consensus achieved at last year’s Review Conference proved that action is still possible despite the challenging international security environment.”
“In a world in which biological threats and vulnerabilities are exceedingly complex, there is a critical need to reinforce relationships among global experts, national governments, and civil society. Over the past two weeks, these stakeholders have met to identify, examine, and develop specific and effective measures to strengthen the Convention. An unwavering theme throughout the Meeting of States Parties underscored that preparedness and resilience are investments, rather than costs, reinforcing the deterrence by denial efforts CSR continues to promote. Although the challenging international security environment continues to hinder progress there are glimmers of genuine progress across several fronts…”
“Biosecurity in the Americas: Regional Threat Assessment”
A new from UMD’s START, co-authored by Biodefense MS Program alumna Alexandra Williams: “This publication, currently available in Spanish, provides a breadth and depth of focuses as a high-level assessment of the Central and South America regions and introduction to key topics as:
The needed expansion of understanding of the differences and areas of collaboration between the concepts of biosafety and biosecurity,
Existing international obligations to biosecurity through the BWC and UNSC Resolution 1540,
How biosecurity applies to and may differ in application across a variety of facility types that engage in biological research or production, whether private or public laboratories, agricultural or university-based facilities,
Biosecurity risks that include proliferation, bioterrorism, agroterrorism, and biocrime,
The five pillars and mechanisms of biosecurity,
Lastly, the application of biosecurity in the Central and South American regions.”
“NTI|Bio Convenes Workshop on Disincentivizing State Bioweapons Development and Use”
From NTI: “A week ahead of the Biological Weapons Convention (BWC) Working Group meetings in Geneva, Switzerland, NTI | bio convened a workshop on “Disincentivizing State Bioweapons Development and Use.” This two-day workshop on November 29 and 30 brought together academics, diplomats, biosecurity experts, and government policy makers to begin developing a cross-disciplinary thought and practice community to explore and develop potential disincentivizing solutions. Current thinking and policy on disincentivizing bioweapons acquisition and use is underdeveloped—especially by comparison with the nuclear security field.”
‘“We launched this effort because we see the need for more rigorous thinking on effective approaches to making bioweapons unattractive to nation-states,” said NTI | bio Vice President Jaime Yassif. “NTI’s goal is to bridge theory and practical policy-relevant approaches to develop new ideas that can invigorate international efforts to reduce biological threats.”’
Biodefense Graduate Program Director Gregory Koblentz and Associate Professor Sonia Ben Ouagrham-Gormley both participated in this workshop. Read more about it here.
“Great Powers and the Norms of the BW Prohibition Regime”
A new working paper from CBWNet: “The United States of America and the Soviet Union were instrumental in creating the biological weapons prohibition regime more than 50 years ago. This has left the regime with a big gap in its normative structure related to the verification of treaty compliance. The working paper by Alexander Kelle and Eva Siegmann analyses great power involvement in several areas of regime implementation and concludes that none of the great powers, including China, has supported the addition of declaration and inspection norms. While recent US and Chinese initiatives could still lead to a strengthening of the regime in different areas, Russian policies, most notably false accusations against the US and others, threaten to undermine the regime.”
“AI and Biorisk: An Explainer”
A new explainer from Georgetown’s CSET: “Recent government directives, international conferences, and media headlines reflect growing concern that artificial intelligence could exacerbate biological threats. When it comes to biorisk, AI tools are cited as enablers that lower information barriers, enhance novel biothreat design, or otherwise increase a malicious actor’s capabilities. In this explainer, CSET Biorisk Research Fellow Steph Batalis summarizes the state of the biorisk landscape with and without AI.”
“Bio X AI: Policy Recommendations For A New Frontier”
Jeffrey et al. discuss the work of the Federation of American Scientists’ Bio x AI Policy Development Sprint in this piece, explaining in their introduction: “Artificial intelligence (AI) is likely to yield tremendous advances in our basic understanding of biological systems, as well as significant benefits for health, agriculture, and the broader bioeconomy. However, AI tools, if misused or developed irresponsibly, can also pose risks to biosecurity. The landscape of biosecurity risks related to AI is complex and rapidly changing, and understanding the range of issues requires diverse perspectives and expertise. To better understand and address these challenges, FAS initiated the Bio x AI Policy Development Sprint to solicit creative recommendations from subject matter experts in the life sciences, biosecurity, and governance of emerging technologies. Through a competitive selection process, FAS identified six promising ideas and, over the course of seven weeks, worked closely with the authors to develop them into the recommendations included here. These recommendations cover a diverse range of topics to match the diversity of challenges that AI poses in the life sciences. We believe that these will help inform policy development on these topics, including the work of the National Security Commission on Emerging Biotechnologies.”
“Push to Improve Biosecurity in the Age of Genetic Engineering”
Wilmot James recently authored this opinion piece for Business Day, explaining in part “The possibility of using AI to develop bioweapons raises additional concerns, and remains uncharted territory. While the intersection of AI and biotechnology holds immense potential for positive applications in healthcare, research and diagnostics, it also poses risks if misused. AI algorithms could be employed to analyse vast genetic data sets and identify specific sequences for manipulation. This could accelerate the process of genetic engineering, allowing for the creation of more efficient and potentially harmful pathogens…To safeguard against such threats, multilateral and public-private sector agreements and regulations to govern the ethical use of AI in science, emphasising the prohibition of bioweapon development, should be established, with strong oversight committees responsible for assessing the ethical implications at the intersection of AI and biotechnology. These committees should include experts in AI, virology, bioethics and global health security.”
“Sounding the Alarm on Anti-Science”
Margaret Winchester provides background and overview of Peter Hotez’s latest book-The Deadly Rise of Anti-Science-in this piece for Health Affairs: “In his book, The Deadly Rise of Anti-Science, Hotez, professor and dean of the National School of Tropical Medicine at Baylor College of Medicine, and co-director of the Center for Vaccine Development at Texas Children’s Hospital, paints a bleak picture of public science denial during the pandemic, embedded in historic context. He tells the story of systematic anti-science efforts from his view in the trenches—and as a personal target for anti-science activists. This book, and his commentary in our December issue of Health Affairs on global lessons from COVID-19, highlight the very real effects of this movement, including lives lost, undermined public health efforts, foregone vaccinations, social schisms, and more, that will be felt for generations to come. As he writes, “anti-science now kills more Americans than global terrorism, or other deadly societal forces and social determinants.” Drawing from multiple sources, he estimates that approximately 200,000 people needlessly died in the US after COVID-19 vaccines became widely available.”
EU vs Disinfo Disinformation Review
The most recent edition of EU vs Disinfo’s Disinformation Review is now available and features multiple sections focused on Russia’s continued use of alleged US biological weapons laboratories as a bogeyman. Be sure to check it out for fantastic lines such as “If the only tool that you have is a hammer, everything looks like a biolab,” and “At a staged event, Putin mumbled out an announcement to veterans and the wider public that his regime would continue to rule over Russia after an orchestrated ritual not to be confused with an event known as an ‘election’ in the free world.”
2023 State of the Bioeconomy
From BIOISAC: “We have a lot to celebrate as we close 2023 and just over 12 months since the Executive Order calling for a safe, secure bioeconomy. Join us as we recap the activity, publications, outcomes, and – we will of course share a glimpse of the “behind the scenes” conversations from our 3 regional events and our one-day “Closing the Knowledge Gaps” event, our two-day table top training and the resulting “Going Viral: Bioeconomy Defense TTX” report, and, of course, the industry-demanded outputs from our hardware/software device security workgroup report and supplements, “Fortifying the Bioeconomy” as well as the Bioeconomy Security Questionnaire and Instrument Disposal Guide. We also have a lot left to do! We plan to share a few of our goals for 2024 and our upcoming regional events schedule.”
“Join us December 19th at 2pm Eastern-US for a live discussion.” Register here.
Presidential Advisory Council on Combating Antibiotic-Resistant Bacteria (PACCARB) Virtual Meeting
“The Presidential Advisory Council on Combating Antibiotic-Resistant Bacteria (PACCARB) provides advice, information, and recommendations to the U.S. Secretary of Health and Human Services (HHS Secretary). The council supports and evaluates U.S. government activities focused on fighting antimicrobial resistance (AMR) in human health, animal health, and environmental health. Using this One Health approach, members of the PACCARB have expertise from a range of backgrounds, including academia, industry, public health, advocacy, veterinary, and agricultural production.”
“As a federal advisory committee, the PACCARB looks to engage with the public and all AMR stakeholders. The council holds several public meetings every year both in-person and live streamed on the HHS.gov website. These meetings are open to anyone with an interest in combating AMR. See how to get involved!”
This virtual meeting will take place on December 20 from 9-4 EST. Learn more here.
61st ISODARCO Course: Nuclear Order and International Security after Ukraine
“The war in Ukraine has had an enormous impact on global security, reviving nuclear fears, undermining the prospects for arms control, and shattering many of the norms and constraints that were the foundation of European security. ISODARCO 2024 will examine the global nuclear order in light of the Ukraine war, focusing on the states, the policies and the technologies that will shape the future in a much more difficult environment. How will we cope with this more dangerous world?”
This course will take place January 7-14, 2024, at the University of Trento. Learn more and register here.
International Conference, CBRNE Research & Innovation
“The last 40 years have demonstrated that both military and civilian populations could be exposed to highly hazardous CBRNE agents following conflicts, natural outbreaks and disasters, industrial incidents or terrorist attacks.”
“Worldwide, researchers, responders and industrial capacities have been commited to provide adapted response to these challenges.”
“Building on the success of the first 5 International Conferences « CBRNE Research and Innovation » which took place in Antibes (2015), Lyon (2017), Nantes (2019), on line (2021) and Lille (2022), we want to give you a new opportunity to build up or strengthen collaborative networks in Strabourg (March 19th – 21rst 2024).”
“The CBRNE R&I Conference is specifically devoted to scientific updates, responders’ feedbacks and expression of needs. It also includes workshops and demonstrations of innovative materials, technologies and procedures, according to the following themes: DETECTION – IDENTIFICATION, PROTECTION – DECONTAMINATION, MEDICAL COUNTERMEASURES, RISKS & CRISIS MANAGEMENT.”
“Looking forward to your proposals for communication and to welcoming you at Strasbourg in March 2024!”
Registration is now open for the Global Health Security 2024 conference in Sydney, Australia. This iteration will take place 18-21 June, 2024. The call for abstracts is also still open. “The mission of the Global Health Security conference is to provide a forum where leaders, researchers, policy-makers, and representatives from government, international organisations, civil society, and private industry from around the world can engage with each other, review the latest research and policy innovations, and agree solutions for making the world safer and healthier. To that end, our mission is to help foster a genuinely multidisciplinary community of practice that is committed to working collaboratively to enhance global health security and eliminate disease, irrespective of its origin or source.”
WHO Announces Proposed Members of Technical Advisory Group on Response Use of the Life Sciences and Dual-Use Research
The WHO recently announced its proposed membership of its Technical Advisory Group on Responsible use of the life sciences and dual-use research (TAG-RULS DUR). According to WHO, “As per WHO processes, there will be now a two-week public consultation period for WHO to receive feedback on the proposed TAG-RULS DUR members and set in place the modalities for the TAG-RULS DUR’s first meeting, which is planned to take place following this consultation period…The final membership to the TAG-RULS DUR is subject to the above-mentioned public consultation period and relevant WHO practices and procedures.”
The proposed membership and instructions for providing commentary on the individuals included are both available here.
Vote: 2023 Arms Control Person(s) of the Year Nominees
“Since 2007, the independent, nongovernmental Arms Control Association has nominated individuals and institutions that have, in the previous 12 months, advanced effective arms control, nonproliferation, and disarmament solutions and raised awareness of the threats posed by mass casualty weapons.”
“In a field that is often focused on grave threats and negative developments, the Arms Control Person(s) of the Year contest aims to highlight several positive initiatives—some at the grassroots level, some on the international scale—designed to advance disarmament, nuclear security, and international peace, security, and justice.”
“Voting will take place between Dec. 8, 2023, and Jan. 11, 2024. The results will be announced on Jan. 12, 2024. Follow the discussion on social media using the hashtag #ACPOY2023.”
This week includes coverage of updates to Japan’s End User List, the Taliban’s newly declared war on polio, Biomemory’s $1k DNA storage cards, new publications, upcoming events, and more.
Japan Revises End User List, Includes 101 Chinese Organizations and Institutions
Japan’s Ministry of Economy, Trade, and Industry has revised the country’s End User List, which provides “…exporters with information on foreign entities for which concern cannot be eliminated regarding involvement in activities such as the development of weapons of mass destruction (WMDs) and other items, for the purpose of enhancing the effectiveness of the catch-all control on cargos and other loads relating to WMDs and other items.”
The updated list, which takes effect on Monday, now includes 706 organizations in 15 countries and regions, according to Nikkei. This is an increase of 36 over last year’s list and, notably, it includes the China Academy of Engineering Physics (CAEP)-the main center for Chinese research on and manufacturing of nuclear weapons. Seven total Chinese entities were added to the list, about 90% of which are thought to be involved in missile development. Nikkei notes that “Many universities, academies and research institutes are also listed, which reveals the extent of Xi Jinping’s Military-Civilian Fusion policy. Machine tools produced by Japanese companies and others are suspected of being used by the CAEP, according to a Nikkei investigation.”
223 Iranian organizations and institutions are on the list, in addition to 153 North Korean ones, and 101 each from China and Pakistan. Nikkei further explains that “Japan aims to prevent the outflow of civilian technology that could be diverted to military use. Exporters are required to get approval from the Minister of Economy, Trade and Industry to export products to the listed organizations unless it is clear that the materials will not be used to develop WMDs such as nuclear weapons or missiles.”
“The economy ministry makes the list to enhance the effectiveness of its “catch-all” control system, which obliges exporters to apply for an export license for goods that may be used for the development of WMDs even if the goods are not subject to export restrictions under international agreements. The list has been issued since catch-all controls were introduced in April 2002 and is revised about once a year. It is not an embargo list.”
Taliban Announces Polio Eradication Campaign
Naturally acquired polio remains endemic in just two countries today- Afghanistan and Pakistan- in part because, as Radio Azadi explains, “Islamic militants often target polio-vaccination teams, falsely claiming the vaccination campaigns are a Western conspiracy to sterilize children.” During its 20-year struggle to regain power, the Taliban often banned door-to-door vaccination efforts. In 2021, nationwide door-to-door polio vaccinations were allowed to resume after the Taliban and the United Nations/World Health Organization reached an agreement.
Now, as explained by a recent article in The Washington Post, the Taliban is “declaring war” on polio in an apparent complete reversal of its previous stance. The article explains “Vaccinators in the country’s northeast, the center of the poliovirus outbreak, search cars for unvaccinated children at roadside checkpoints manned by Taliban soldiers. With no deadly attacks on public health campaigners reported in Afghanistan this year, they also feel increasingly comfortable venturing into remote virus hot spots that were previously far beyond their reach.”
The country’s health ministry announced the continuation of its annual polio vaccination campaign in March of this year, marking the second year the program has continued to operate under the Taliban’s rule. The ministry indicated it aimed to reach approximately 9 million children with the campaign, as Afghanistan and neighboring Pakistan continue to struggle with endemic polio due in large part to accessibility difficulties, displacement, regional instability, and concerns about external interference. Pakistan suspended its anti-polio drive in multiple districts this year after police escorting vaccination teams were repeatedly attacked.
French Start-Up Announces Sales of DNA Storage Cards,BIO-ISAC Joins DNA Data Storage Alliance Amid Growing Interest, Concerns
Multiple news outlets have covered the French start-up Biomemory‘s release of $1,000 pairs of DNA cards that promise a “minimum” 150-year lifespan of data storage. The Verge’s Emma Roth explains “DNA has emerged as a theoretical alternative to hard drives, SSDs, and other forms of digital data storage, namely because of its impressive lifespan. Science estimates the technology could potentially last hundreds of thousands of years if stored in a cool, dry environment. That’s a heck of a lot longer than the lifespan of your average hard drive, which typically tops out at around five years.”
However, Biomemory’s cards currently offer just one kilobyte of storage, or about one email according to Wired. The data stored on the card is retrieved by mailing the cards to Eurofins Genomics, who then return the stored information using strings of DNA’s nucleotide bases-adenine (A), cytosine (C), guanine (G) and thymine (T). Users can then use Biomemory’s DNA translation feature to decode the stored information. The card is not returned afterward. The company expects to begin shipping orders from its waitlist in January.
‘”The launch of our DNA Cards represents a significant milestone in the evolution of data storage technology,” Erfane Arwani, CEO of Biomemory, said about the pioneering development. “After years of talk about the potential of molecular computing, we are incredibly proud to bring the first DNA data storage product to market, that not only pushes the boundaries of innovation but also aligns with our commitment to environmental sustainability and efficiency.”‘
This news has coincided with the announcement that the Bioeconomy Information Sharing and Analysis Center, an international organization that aims to address threats unique to the bioeconomy, has joined the DNA Data Storage Alliance. The organization explained in a statement: “This year BIO-ISAC created the Genomic Data Workgroup, informing the National Cybersecurity Center of Excellence at National Institute of Standards and Technology efforts to launch the Cybersecurity Framework Profile for Genomic Data and the forthcoming text on the Privacy Framework Profile for Genomic Data. Prioritizing workgroup efforts to apply and implement this work, BIO-ISAC pursued membership and presentation opportunities with aligned organizations and audiences.”
“Founded in 2020, the DNA Data Storage Alliance was built to create and promote an interoperable storage ecosystem based on DNA as a data storage medium. The organization seeks to educate the public and raise awareness about this emerging technology and its vast power to preserve our digital legacy. As the methods of commercially viable DNA storage become better understood, the Alliance will consider recommending the creation of specifications and standards (e.g., encoding, reliability, retention, file systems) which enable end-users to add interoperable DNA-based storage solutions to their existing storage hierarchies.”
On a more fun note, Biomemory’s homepage does include a DNA Translate feature at the bottom which shows users how lines of text may be converted to strings of As, Cs, Gs, and Ts, so we tested it out: AGAGAGACAGTCTCACAGTCAGAGACTCACACAGAGACACAGTCACAGAGTCTGTCAGTCAGACAGTCTGTGAGTGACTCAGTCACAGACTCACACAGAGACTCAGTCAGAGAGTGACACAGTCTGTGAGTGACTCAGTGAGACACTCACACAGTCTCAGAGTGACTGACTCACACAGTGAGACAGTCTCACAGTCAGAGACTCACACAGTCACTCAGTCAGAGAGTGACTGAGTGAGACACTCACACAGTCTGTCAGTCAGAGAGTGCCGAAGTGACTGAGTCTGACAGTCAGAGAGTGAGACAGTGAGACAGTCAGAGAGTGACTCCCGAACAG
The page lacks a feature allowing users to translate their string of nucleotide bases back to regular text, so take our word for it: The Pandora Report is the best newsletter!
WHO Weekly Epidemiological Record One Health-Focused Issue
“The Weekly Epidemiological Record (WER) serves as an essential instrument for the rapid and accurate dissemination of epidemiological information on cases and outbreaks of diseases under the International Health Regulations and on other communicable diseases of public health importance, including emerging or re-emerging infections.”
“Henry Kissinger Supported Wars and Coups. He Also Played a Little-Known Role in Eliminating Bioweapons”
Matt Field recently authored this piece about the late Henry Kissinger in The Bulletin of the Atomic Scientists, writing in part: “By the late 1960s, incidents with chemical weapons—including an accident with VX nerve agent in Utah that killed some 6,000 sheep—had focused Congress’s attention on the US chemical and biological warfare operation. Internationally, there were efforts to begin arms control negotiations around these weapons of mass destruction. And Kissinger led internal government deliberations over what to do with the US program. At one point, according to Tucker and Mahan, Kissinger, unhappy with a policy paper that contained both arguments in favor and against retaining biological weapons, produced his own paper that cut the points in favor of the offensive program. He included his personal recommendation to restrict the US program to biological defense, which involves the development of countermeasures such as vaccines.”
“Insights from BARDA Industry Day 2023”
Tanima Sinha, Director of Life Science Product Development and Government Contracts at the Biomedical Advanced Research and Development Authority (BARDA), recently authored this post covering BARDA Industry Day 2023 and upcoming insights from the conference that will be made available. She explains in part, “Here we will take a quick glimpse at ASPR (Administration for Strategic Preparedness and Response) and BARDA’s programs to enhance the nation’s biomedical industrial base and supply chain capacity. The COVID-19 pandemic brought to light the inadequate availability of essential medical needs. In response to these deficiencies, the USG/ HHS (Health and Human Services) (Health and Human Services) is expanding the public health industrial base through innovative solutions.”
Fortifying the Bioeconomy
From BIO-ISAC: “Standardizing tools for assessing, remediating, and disposing of hardware and software instruments has been a recurring problem in our sector, reducing our ability to operate in a safe, secure way. Earlier this year, BIO-ISAC took action to address this need.” “Fortifying the Bioeconomy, an in-depth resource about shared responsibility in hardware and software lifecycle management, is now available. This resource includes additional materials including a standardized vendor questionnaire and an instrument disposal guide.”
“We hope these materials guide industry and offer us a safe, secure path forward for our nation’s labs, biomanufacturers, growers, and innovators.”
“Country Reports on Terrorism 2022 is submitted in compliance with Title 22 of the United States Code, Section 2656f (the “Act”), which requires the Department of State to provide to Congress a full and complete annual report on terrorism for those countries and groups meeting the criteria of the Act.”
This report includes “Chapter 3 — The Global Challenge of Chemical, Biological, Radiological, or Nuclear Terrorism,” explaining the status of CBRN materials and expertise as terrorist threats and the United States’ efforts to counter them in 2022.
“New Information Tool on Nuclear Weapons Seeks to Identify the Next Arms Control Strategies”
Andrew Facini recently authored this piece for The Bulletin of the Atomic Scientists discussing the Council on Strategic Risks’ recently-launched Nuclear Weapons System Project. He explains, “For those of us seeking to cultivate nuclear policies geared toward enhancing strategic stability, the current trend reflects a worrying loss of perspective—a forgetting of the hard-earned lessons of the Cold War. To help put today’s trends in their historical context, a team of the Council on Strategic Risks (CSR) developed a new visualization tool and information system that maps every type of nuclear weapon fielded by the five nuclear weapons states (P5) under the Nuclear Non-Proliferation Treaty (NPT)—China, France, Russia, the United Kingdom, and the United States—from their inception to present day.”
What We’re Listening To 🎧
Technologically Speaking Podcast Ep. 6, Science is Messy
New from the Department of Homeland Security: “Host John Verrico sits down with Dr. Nick Bergman, director of S&T’s National Biodefense Analysis and Countermeasures Center (NBACC). Dr. Bergman is a bit of a germaphobe, but it’s hard not to be when you run a Biosecurity Level 4 lab that studies pathogens for which no vaccine or treatment exists. Hear an insider’s perspective of the COVID pandemic, find out how NBACC regularly helps the FBI, and meet a guy living a “pretty typical life” of helping save us all from superbugs.”
New from the Dutch Ministry of Health, Welfare and Sport: “This film provides an introduction into eight pillars of good practice for biosecurity, that are important when implementing biosecurity control measures.”
“These control measures are necessary to protect high-risk biological materials against theft or misuse by malicious parties.”
“The biosecurity aspects in these eight pillars of good practice are explained, which can help you to implement biosecurity within your organisation. This film is focussed on organisations that work with high risk biological materials.”
Mitigating Arboviral Threats and Strengthening Public Health Preparedness
“Arboviruses are a broad group of viruses that are spread by arthropods, such as ticks and mosquitoes. Diseases caused by arboviruses, like dengue, chikungunya, Zika, and yellow fever, present a significant public health burden and threaten billions of people worldwide. Despite the global recognition of the devastating health and economic impacts of these diseases, the need persists for improved integration of mitigation efforts into public health systems and environmental and urban planning.”
“The National Academies Forum on Microbial Threats will conduct a two-day workshop that will identify lessons learned from previous outbreaks, outline current arbovirus surveillance capacities, and describe novel approaches to arbovirus mitigation. The workshop will include perspectives from researchers, public health practitioners, and environmental management experts from across the globe.”
This event will take place on December 12 and 13. Learn more here.
Presidential Advisory Council on Combating Antibiotic-Resistant Bacteria (PACCARB) Virtual Meeting
“The Presidential Advisory Council on Combating Antibiotic-Resistant Bacteria (PACCARB) provides advice, information, and recommendations to the U.S. Secretary of Health and Human Services (HHS Secretary). The council supports and evaluates U.S. government activities focused on fighting antimicrobial resistance (AMR) in human health, animal health, and environmental health. Using this One Health approach, members of the PACCARB have expertise from a range of backgrounds, including academia, industry, public health, advocacy, veterinary, and agricultural production.”
“As a federal advisory committee, the PACCARB looks to engage with the public and all AMR stakeholders. The council holds several public meetings every year both in-person and live streamed on the HHS.gov website. These meetings are open to anyone with an interest in combating AMR. See how to get involved!”
This virtual meeting will take place on December 20 from 9-4 EST. Learn more here.
61st ISODARCO Course: Nuclear Order and International Security after Ukraine
“The war in Ukraine has had an enormous impact on global security, reviving nuclear fears, undermining the prospects for arms control, and shattering many of the norms and constraints that were the foundation of European security. ISODARCO 2024 will examine the global nuclear order in light of the Ukraine war, focusing on the states, the policies and the technologies that will shape the future in a much more difficult environment. How will we cope with this more dangerous world?”
This course will take place January 7-14, 2024, at the University of Trento. Learn more and register here.
International Conference, CBRNE Research & Innovation
“The last 40 years have demonstrated that both military and civilian populations could be exposed to highly hazardous CBRNE agents following conflicts, natural outbreaks and disasters, industrial incidents or terrorist attacks.”
“Worldwide, researchers, responders and industrial capacities have been commited to provide adapted response to these challenges.”
“Building on the success of the first 5 International Conferences « CBRNE Research and Innovation » which took place in Antibes (2015), Lyon (2017), Nantes (2019), on line (2021) and Lille (2022), we want to give you a new opportunity to build up or strengthen collaborative networks in Strabourg (March 19th – 21rst 2024).”
“The CBRNE R&I Conference is specifically devoted to scientific updates, responders’ feedbacks and expression of needs. It also includes workshops and demonstrations of innovative materials, technologies and procedures, according to the following themes: DETECTION – IDENTIFICATION, PROTECTION – DECONTAMINATION, MEDICAL COUNTERMEASURES, RISKS & CRISIS MANAGEMENT.”
“Looking forward to your proposals for communication and to welcoming you at Strasbourg in March 2024!”
Registration is now open for the Global Health Security 2024 conference in Sydney, Australia. This iteration will take place 18-21 June, 2024. The call for abstracts is also still open. “The mission of the Global Health Security conference is to provide a forum where leaders, researchers, policy-makers, and representatives from government, international organisations, civil society, and private industry from around the world can engage with each other, review the latest research and policy innovations, and agree solutions for making the world safer and healthier. To that end, our mission is to help foster a genuinely multidisciplinary community of practice that is committed to working collaboratively to enhance global health security and eliminate disease, irrespective of its origin or source.”
“Biodefense Budget Breakdown: Data Visualization of U.S. Biodefense Investments”
New from Council on Strategic Risks: “In recent years, U.S. strategies and policies have advanced greatly in addressing biological risks from all sources. We at CSR have marked several areas of progress through writings and analysis: the beginning of a pivot toward pathogen-agnostic approaches, requiring annual exercises on biological risks, and the creation of the Biodefense Council within the Department of Defense, and more…In September, CSR launched a scorecardprocess to track signs of implementation of stronger U.S. biodefense and biosecurity policies. CSR’s Biodefense Budget Breakdown will accompany the scorecard, tracking trends in resources and investments.”
“Before the launch of this tool, no publicly-accessible resource provided a detailed analysis of the total budget across the federal biodefense enterprise. By creating the Biodefense Budget Breakdown, we hope to provide a robust and user-friendly resource for the government, key stakeholders, and the general public.”
“This tool is intended to provide focused analyses of the biodefense budget, with multiple interfaces to understand and analyze the federal biodefense portfolio. This tool starts with the cumulative U.S. biodefense totals for each fiscal year dating back to 2019, progresses to agency-specific drill-downs, and culminates with a detailed line item index for biodefense budgets across key agencies. This tool reports biodefense investments across three steps in the budget cycle: requested (R), enacted (E), and actual (A) levels of funding.”
Call for Applications: Ecological Security Fellowship
“The Council on Strategic Risks is pleased to announce a call for applications for its Ecological Security Fellowship, a key part of its broader Ecological Security Program.”
“Tackling complex, converging risks arising from ecological degradation requires the development of resilient leaders spanning international, national, state, and local levels. This program will familiarize participants with novel ways of conceptualizing the security risks posed by ecological disruption driven by human activities, climate change, and other stressors. Participants will acquire expertise and build professional development through networking with experts and practitioners in different areas of ecological security.”
This week covers a wide range of topics, including chemical weapons, indictments for those involved in running the illegal laboratory in Reedley, CA, and more. Several new publications follow, as well new upcoming events and newly-available resources in the announcement section.
George Mason University’s Biomedical Laboratory Receives $12 Million in Funding from NIH
From GMU: “Farhang Alem, Interim Director of the Biomedical Research Laboratory, Institute for Biohealth Innovation, and Aarthi Narayanan, Professor, Biology, will receive more than $12 million from the National Institute for Health to support development of Mason’s Biomedical Research Laboratory, advancing the university’s research capabilities for infectious diseases.”
“George Mason University’s Biomedical Laboratory (BRL) is one of 12 Regional Biocontainment Laboratories (RBLs) established through the National Institute of Allergy and Infectious Diseases. The BRL offers Biosafety Level 3 (BSL-3) facilities that conduct cutting edge pathogen research and serve as resources to rapidly address emerging infectious disease outbreaks.”
“Funding will support a number of facility improvements including the implementation of a comprehensive BSL-3 facilities preventative maintenance and upgrade plan to ensure continuity of operations, compliance with federal regulations, and a safe and secure facility. Funding will also enhance safety and quality of BSL-3 laboratory practices and create two new research cores in high containment.”
DOD Chemical and Biological Defense Program Celebrates 30th Anniversary
The Department of Defense recently reached the 30-year anniversary of the formation of its Chemical and Biological Defense Program. “Congress created the DOD wide chemical and biological defense program in November 1993, after a government report noted U.S. forces were not sufficiently prepared to address Iraq’s chemical and biological warfare capabilities…Prior to the creation of the program under the Office of the Secretary of Defense, the military services were each responsible for developing their own chemical and biological defense capabilities.”
“The Conference decided that the continued possession and use of chemical weapons by the Syrian Arab Republic, and its failures to submit an accurate and complete declaration and to destroy all its undeclared chemical weapons and production facilities, have caused serious damage to the object and purpose of the Chemical Weapons Convention.”
“In adopting the decision, States Parties condemned “in the strongest possible terms the use of chemical weapons by anyone, under any circumstances, emphasising that any use of chemical weapons anywhere, at any time, by anyone, and under any circumstances is unacceptable and contravenes international norms and standards”. States Parties reaffirmed their determination to continue to take action to address threats related to chemical weapons in Syria and elsewhere.”
“Today’s decision seeks to implement for the first time Paragraph 3 of Article XII of the Convention, which refers to measures States Parties can take in order to ensure compliance.”
Syrian Network for Human Rights Statement On the Day of Remembrance For All Victims of Chemical Warfare
The Syrian Network for Human Rights released its statement yesterday on the Day of Remembrance for all Victims of Chemical Warfare, highlighting CW attacks perpetrated by the Assad regime and the ongoing struggle for victims to hold the regime accountable. The statement is available below.
OPCW Director-General Amb. Fernando Arias and the Mayor of the Municipality of The Hague, Mr. Jan van Zanen, announced last week the three recipients of the 2023 OPCW-The Hague Award. These recipients are the Spiez Laboratory in Switzerland, Dr. Syeda Sultana Razia at the Bangladesh University of Engineering and Technology, and Mr. Hubert K. Foy at the African Centre for Science and International Security in Ghana.
‘“All three of these recipients have demonstrated that everyone has a role to play in ridding the world of chemical weapons and preventing their re-emergence,” said OPCW Director-General, Ambassador Fernando Arias. “We must together strive to continue to ensure that toxic chemicals are never used as instruments of harm and that our populations are protected.”’
Read more about the recipients and their work here.
NTI, NextGen, iGEM, SynBio Africa, GHSN, and 80,000 Hours Announce Winners of 7th Annual Next Generation for Biosecurity Competition
The winners of the Seventh Annual Next Generation for Biosecurity Competition were recently announced. They are Gupreet Dhaliwal, Ph.D. candidate in Synthetic Biology and Immunology at the University of Cambridge, Askar Kleefeldt, Ph.D. candidate in Synthetic Biology at the MRC Laboratory of Molecular Biology and the University of Cambridge, and Alexandra Klein, Ph.D. candidate in Science, Technology, Engineering and Public Policy at the University College London and research assistant at the Centre for the Study of Existential Risk, University of Cambridge.
“In their winning paper, Biosecurity-By-Design to Safeguard Emerging Bioeconomies: Integrating Biosecurity Considerations into the Full Biotechnology Innovation and Development Pipeline, the team proposes a ‘biosecurity-by-design’ approach to ensure that biosecurity is integrated into every stage of the life science research and development pipeline, especially project conceptualization. The three authors outline a set of recommendations to achieve this goal, including fostering a culture of responsibility among scientific communities through the adoption of the Tianjin Biosecurity Guidelines for Codes of Conduct for Scientists as a global standard in emerging bioeconomies. The authors emphasize the importance of engaging with the private sector and encourage governments to incentivize biosecurity in product design by using levers such as market access regulations or reputational rewards through seals of approval. The authors also propose that States Parties at the Biological Weapons Convention adopt a systematic review mechanism for science and technology to raise awareness of emerging biotechnology risks. Overall, these recommendations aim to make biosecurity an integral part of biotechnology innovation while allowing the bioeconomy to flourish.”
No Cost COVID-19 Tests Available in United States Again
The US Government is once more offering four at-home viral tests delivered via the US Postal Service. Those who did not order any in September can order up to eight of them during this round. Order tests at COVIDtests.gov.
ICYMI: Select Committee on the CCP Releases Report on Reedley Lab, DOJ Announces Indictment of Operator
Last month “Chairman Mike Gallagher (R-WI) of the House Select Committee on the Chinese Communist Party unveiled a report on its investigation into the illegal People’s Republic of China-tied biolab discovered in Reedley, CA. The members were joined by Rep. Jim Costa (D-CA), whose district includes Reedley, CA, Former Speaker Kevin McCarthy (R-CA), Rep. Dan Newhouse (R-WA), and Rep. Neal Dunn (R-FL).”
According to the report, the Committee’s main findings were:
“The illegal biolab was run by a PRC citizen who is a wanted fugitive from Canada with a $330 million Canadian dollar judgment against him for stealing American intellectual property.
This PRC citizen was a top official at a PRC-state-controlled company and had links to military-civil fusion entities.
The illegal biolab received millions of dollars in unexplained payments from PRC banks while running the illegal biolab.
The illegal biolab contained thousands of samples of labeled, unlabeled, and encoded potential pathogens, including HIV, malaria, tuberculosis, and Covid.
The illegal biolab also contained a freezer labeled “Ebola,” which contained unlabeled, sealed silver bags consistent with how the lab stored high risk biological materials. Ebola is a Select Agent with a lethality rate between 25-90%.
The biolab contained nearly a thousand transgenic mice, genetically engineered to mimic the human immune system. Lab workers said that the mice were designed “to catch and carry the COVID-19 virus.”
After local officials who discovered the lab sought help from the CDC and others, the CDC refused to test any of the samples.”
Meanwhile, the Department of Justice announced a three-count indictment against operators of the lab, saying in a press statement “A federal grand jury returned a three-count indictment today against Jia Bei Zhu, aka Jesse Zhu, Qiang He, and David He, 62, a citizen of China who formerly resided in Clovis, charging him with distributing adulterated and misbranded medical devices in violation of the federal Food, Drug, and Cosmetic Act and for making false statements to the Food and Drug Administration (FDA), U.S. Attorney Phillip A. Talbert announced.”
“According to court documents, between January 2020 and March 2023, through the companies Universal Meditech Incorporated (UMI) and Prestige Biotech Incorporated (PBI), Zhu sold hundreds of thousands of COVID-19 test kits to companies throughout the United States. UMI and PBI were based in Fresno and Reedley and did not obtain pre-market approval, pre-market clearance, emergency use authorization, or other applicable exemption from the FDA as was required. UMI and PBI received millions of dollars for the sales of the test kits.”
“When questioned by FDA officials, Zhu made several false statements to them, including that (1) his name was Qiang “David” He, (2) he was hired by UMI as a COVID-19 consultant in 2021, (3) he was hired by PBI just a couple of weeks prior to meeting with the FDA to communicate with government agencies on PBI’s behalf, and (4) he did not know anything about the manufacturing or distribution histories for UMI or PBI.”
“This case is the product of an investigation by the FDA Office of Criminal Investigations with assistance from the Federal Bureau of Investigation and the California Department of Public Health – Food and Drug Branch. Assistant U.S. Attorneys Joseph D. Barton, Arelis M. Clemente, and Henry Z. Carbajal III are prosecuting this case.”
“Why AI-Assisted Bioterrorism Became a Top Concern for Open AI and Anthropic”
Louise Matsakis covers the now constant concern about the potential for AI to aid in bioterrorism, explaining in her introduction “In the spring of 1995, U.S. lawmakers were becoming concerned that material uploaded to the nascent internet might pose a threat to national security. The Oklahoma City bombing had happened several weeks earlier, drawing attention to publications circulating online like The Big Book of Mischief, which included instructions on how to build homemade explosives.”
“Worried the information could be used to orchestrate another attack, then-Senator Dianne Feinstein pushed to make publishing bomb recipes on the internet illegal. The effort sparked a national debate about “Open Access vs. Censorship,” as one newspaper headline put it at the time.”
“Nearly 30 years later, a similar debate is now unfolding about artificial intelligence. Rather than DIY explosives, some U.S. officials and leading AI companies say they are increasingly worried that large language models could be used to develop biological weapons. The possibility has been repeatedly cited as one reason to be cautious about making AI systems open source.”
Matsakis interviewed George Mason’s Sonia Ben Ouagrham-Gormley as well in writing this piece, writing ‘“With new technologies, we tend to project in the future as though their development was linear and straightforward, and we never take into consideration the challenges and the contingencies of the people using them,” said Sonia Ben Ouagrham-Gormley, an associate professor at George Mason University who has interviewed former scientists in both the U.S. and Soviet Union’s now-defunct biological weapons programs.”
And later: “Ben Ouagrham-Gormley said her research has shown that achieving each of these steps requires employing different, highly-trained experts, including people who specialize in the exact type of pathogen being used. An AI model might be able to replace some of their work in the future, but she argued it can’t replicate the hands-on wisdom that comes from working in a laboratory.”
‘“This kind of tacit knowledge exists everywhere, but in the bio field, it’s really important because of the fragility of the raw material,” Ben Ouagrham-Gormley said.”
“Artificial Intelligence and Synthetic Biology Are Not Harbingers of Doom”
David Bray provides an optimistic outlook on the potential of AI and synthetic biology in this policy memo for the Stimson Center. Bray writes, “Contrary to many people’s fears, artificial intelligence (AI) can be a positive force in advancing biological research and biotechnology. The assumption that AI will super-empower the risks that already exist for the misuse of biotech to develop and spread pathogens and fuel bioterrorism misses three key points. First, the data must be out there for either an AI or a human to use it. Second, governments stop bad actors from using bio for nefarious purposes by focusing on the actors’ precursor behaviors. Third, given how wrong large language models (LLMs) often are and their risk of hallucinations, any would-be AI intended to provide advice on biotech will have to be checked by a human expert. In contrast, AI can be a positive force in advancing biological research and biotechnology — and insights from biology can power the next wave of AI for the benefit of humankind. Private and public-sector leaders need to make near-term decisions and actions to lay the foundation for maximizing the benefits of AI and biotech. National and international attention should focus on both new, collective approaches to data curation and ensuring the right training approaches for AI models of biological systems.”
“Going Viral: Bioeconomy Defense”
This report from Johns Hopkins’ Applied Physics Lab summarizes the findings of a May tabletop exercise:
“The May tabletop exercise at APL revealed four key areas of action to ensure a safe and secure bioeconomy.
Trust in lab equipment performance and data is foundational to the bioeconomy. Recommendations include developing digital security standards for lab equipment, hardening waypoints at each step in the data life cycle, and introducing a system of tiered levels of compliance.
Awareness of vulnerabilities, cyber and physical, and the steps for prevention and intervention are needed. Recommendations include additional exercises to strengthen intra-agency coordination and training and extending this activity to private sector companies.
Responsibility for responding to threats in the bioeconomy, and the roles for each team member, need to be defined with a process workflow, using a shared responsibility model, and teams need regular training opportunities to practice.
Preparedness is lacking, and threat-mitigation strategies specific to the bioeconomy need to be identified, tested and distributed. The exercise pushed the limits of participants’ traditional threat-mitigation strategies and identified the need for assessments of critical infrastructure and functions, cross-domain training, and the establishment of policies and procedures for an inter-agency group to rapidly respond to threats.”
“Security Considerations At the Intersection of Engineering Biology and Artificial Intelligence”
New from the Engineering Biology Research Consortium: “This white paper describes three areas at the intersection of engineering biology and artificial intelligence that may yield significant security concerns: de novo biological design, closed-loop autonomous laboratories, and natural language Large Language Models. It describes each area, identifies potential security concerns, and offers ideas for the potential mitigation of those concerns, ultimately calling for an international forum to continually address this evolving issue.”
“Pascale Ferrier and the Threat of Bioterror”
Markus K. Binder recently published this piece in NCT’s CBNW: “Drawing upon the START CBRN Data Suite and other research, Markus Binder considers the five ricin bio-attacks directed at the U.S. President and other officials that have taken place since 2013 to assess what, if anything, they can tell us about bioterrorism.”
“Americans’ Trust in Scientists, Positive Views of Science Continue to Decline”
New work from the Pew Research Center has found that “…the share of Americans who say science has had a mostly positive effect on society has fallen and there’s been a continued decline in public trust in scientists.”
“Overall, 57% of Americans say science has had a mostly positive effect on society. This share is down 8 percentage points since November 2021 and down 16 points since before the start of the coronavirus outbreak.”
“About a third (34%) now say the impact of science on society has been equally positive as negative. A small share (8%) think science has had a mostly negative impact on society.”
“A Systematic Review Of COVID-19 Misinformation Interventions: Lessons Learned”
Smith et al. recently published this article with Health Affairs: “Governments, public health authorities, and social media platforms have employed various measures to counter misinformation that emerged during the COVID-19 pandemic. The effectiveness of those misinformation interventions is poorly understood. We analyzed fifty papers published between January 1, 2020, and February 24, 2023, to understand which interventions, if any, were helpful in mitigating COVID-19 misinformation. We found evidence supporting accuracy prompts, debunks, media literacy tips, warning labels, and overlays in mitigating either the spread of or belief in COVID-19 misinformation. However, by mapping the different characteristics of each study, we found levels of variation that weaken the current evidence base. For example, only 18 percent of studies included public health–related measures, such as intent to vaccinate, and the misinformation that interventions were tested against ranged considerably from conspiracy theories (vaccines include microchips) to unproven claims (gargling with saltwater prevents COVID-19). To more clearly discern the impact of various interventions and make evidence actionable for public health, the field urgently needs to include more public health experts in intervention design and to develop a health misinformation typology; agreed-upon outcome measures; and more global, more longitudinal, more video-based, and more platform-diverse studies.”
“Coffee As a Dietary Strategy to Prevent SARS-CoV-2 Infection”
Wu et al.‘s recent article in Cell & Bioscience offers further validation for coffee drinkers (as if we needed it): “Background: To date, most countries lifted the restriction requirement and coexisted with SARS-CoV-2. Thus, dietary behavior for preventing SARS-CoV-2 infection becomes an interesting issue on a daily basis. Coffee consumption is connected with reduced COVID-19 risk and correlated to COVID-19 severity. However, the mechanisms of coffee for the reduction of COVID-19 risk are still unclear.”
“Results: Here, we identified that coffee can inhibit multiple variants of the SARS-CoV-2 infection by restraining the binding of the SARS-CoV-2 spike protein to human angiotensin-converting enzyme 2 (ACE2), and reducing transmembrane serine protease 2 (TMPRSS2) and cathepsin L (CTSL) activity. Then, we used the method of “Here” (HRMS-exploring-recombination-examining) and found that isochlorogenic acid A, B, and C of coffee ingredients showed their potential to inhibit SARS-CoV-2 infection (inhibitory efficiency 43–54%). In addition, decaffeinated coffee still preserves inhibitory activity against SARS-CoV-2. Finally, in a human trial of 64 subjects, we identified that coffee consumption (approximately 1–2 cups/day) is sufficient to inhibit infection of multiple variants of SARS-CoV-2 entry, suggesting coffee could be a dietary strategy to prevent SARS-CoV2 infection.”
“Conclusions: This study verified moderate coffee consumption, including decaffeination, can provide a new guideline for the prevention of SARS-CoV-2. Based on the results, we also suggest a coffee-drinking plan for people to prevent infection in the post-COVID-19 era.”
“WHO: ‘Collective Action’ Needed to Effectively Reduce Antimicrobial Resistance”
CIDRAP’s Chris Dall covers WHO officials’ answers to questions about AMR in this piece written in recognition of World AMR Awareness Week. Dall explains “Encouraging the medical community, world leaders, and other stakeholders to do their part in staving off that grim future is one of the goals of World AMR Awareness Week, a global campaign of the World Health Organization (WHO) this week aimed at raising public awareness and promoting practices that help mitigate the threat posed by drug-resistant infections…CIDRAP News recently submitted a series of questions to WHO officials about the themes of this year’s World AMR Awareness Week, their assessment of the progress that countries have made in addressing AMR, and the challenges that lay ahead. Responses were provided by Sarah Sheppard, the WHO’s communications lead for Medicines, Health Products & AMR.”
“The World’s Chemical-Weapons Stockpiles Are Gone – But a New Challenge Looms”
Peter J. Hotchkiss, science policy adviser to the OPCW’s Scientific Advisory Board, recently published this World View piece with Nature. He explains in part, “In 2019, the OPCW’s 193 member states decided unanimously, for the first time in history, to add compounds to the schedules, the lists of chemicals that are regulated under the convention. The four entries comprise toxic nerve agents with no known civilian use: three cover phosphorus-based agents (in the ‘novichok family’), and the fourth is a family of carbamates, another kind of nerve agent. The convention already prohibited using these (or any chemical) to intentionally kill or harm people through toxicity. Now, their production, transfer and storage are subject to stringent verification by the OPCW, through declarations and on-site inspections.”
“Yet some states have been reticent to share data on these chemicals with the OPCW. The lack of information on the newly scheduled chemicals is in jarring contrast to what we have on other weapons listed in the convention and on their precursors. To ensure the health and safety of staff members during inspections, the OPCW needs the best understanding of these chemicals’ properties, the types of personal protective equipment and medical countermeasures that are effective against them and the analytical methods for detecting them. These data would also help us to provide the best information and training to all member states, ensuring that they are prepared in the event that any of these chemicals are used as a weapon.”
“29 Morally Bankrupt Governments, Headed by Russia, Voted Against the OPCW’s Resolutions”
The Syrian Network for Human Rights recently released this report “…emphasizing that many states worldwide must bring cases against the Syrian regime before the International Criminal Court (ICC) over the regime’s repeated violations of the Chemical Weapons Convention (CWC).”
“In the 15-page report, SNHR notes that the Syrian regime has carried out 184 chemical attacks since ratifying the Convention in September 2013. The report outlines the decisions adopted by the Organization for the Prohibition of Chemical Weapons (OPCW), identifying the states that voted against those decisions, or in other words the states that support the continuation of the Syrian regime’s chemical weapons program. Through this action, it notes, these states are, in effect, encouraging the regime to use weapons of mass destruction – chemical weapons – and emboldening it to carry out more chemical weapons attacks against the Syrian people.”
“Scientific Experts Provide Key Recommendations on Biotoxin Analysis to the OPCW”
“The Scientific Advisory Board (SAB) of the Organisation for the Prohibition of Chemical Weapons (OPCW) endorsed a report outlining key recommendations on biotoxin analysis and investigations of their alleged use as weapons submitted by a SAB Temporary Working Group (TWG) earlier this year.”
“Biotoxins are toxic chemicals produced by living organisms, which vary widely in properties such as structure, size, and mechanisms of toxicity. Some biotoxins can be more toxic than traditional nerve agents. There are two biotoxins subject to stringent verification measures under the Chemical Weapons Convention – ricin and saxitoxin – with many others also posing safety and security concerns.”
“The risk of misuse of biotoxins as weapons requires the OPCW to be prepared to conduct various investigations and missions related to their alleged use. To ensure the Organisation’s readiness to do so, the TWG’s report makes critical recommendations to the OPCW…”
“2023 Catalogue of Civil Society Activities Supporting the Chemical Weapons Convention”
The Stimson Center recently released its 2023 Catalogue of Civil Society Activities Supporting the Chemical Weapons Convention, “a catalogue of civil society capacity-building, assistance, and/or research programs supporting the Chemical Weapons Convention (CWC). The catalogue highlights all interested parties, including the CWC States Parties, the Organisation for the Prohibition of Chemical Weapons (OPCW), the Global Partnership Against the Spread of Weapons and Materials of Mass Destruction, international organizations, and industry stakeholders, civil society’s contributions to strengthen reducing the threat of chemical weapons and promoting the peaceful use of chemistry. By providing a uniform product, interested parties will be able to easily identify programs, experts, and organizations that support the CWC and related chemical weapons nonproliferation instruments.”
“Emerging and Re-Emerging Chemical Threats (Part 2)”
MRIGlobal continues their discussion of CW threats with “Chemical Threats on the Battlefield and Home Front” in this blog post, explaining in part “Today’s conflicts around the world highlight the current and pressing need for continued research to help ensure the safety of anyone in danger. And though we touched on “Emerging and Re-emerging Chemical Threats” earlier in the year, because emerging and re-emerging chemical threats pose an ever-present challenge to both warfighters and civilians, we are revisiting the topic to share additional expertise. To learn more, we visited with Cristina Youngren and Evan Durnal, subject matter experts in MRIGlobal’s Integrated Defense Solutions division.”
“What Does a French Arrest Warrant Mean for Normalization With Assad?”
Julia Neumann discusses what France’s arrest warrants for Bashar al-Assad and several associates mean in practice and for regional normalization in this piece for Syria Direct.
“Why Cheap Drones Pose a Significant Chemical Terrorism Threat”
Zachary Kallenborn recently published this piece with The Bulletin of the Atomic Scientists, writing in part “Relatively cheap drones are becoming a mainstay of conflicts, from the war in Ukraine to the Israel-Hamas conflict in Gaza. Though drones were once the purview of rich and powerful militaries, it’s now possible to use cheap consumer drones in battle. With a few tweaks, they can whistle past even sophisticated air defenses. As Al-Bared’s case highlights, they may also present a significant chemical terrorism threat. Drones can be equipped with sprayers to deliver chemical weapons, or they could be used in an attack on a chemical plant. They could also provide critical attack support, helping with reconnaissance to plan out and conduct an attack, monitor law enforcement response, and create propaganda to highlight terrorist activities.”
“Stanford Emerging Technology Review: Reporting on Key Technology Areas and Their Policy Implications”
“Emerging technologies are transforming societies, economies, and geopolitics. This moment brings unparalleled promise and novel risks. In every era, technological advances buoy nations that develop and scale them—helping to save lives, win wars, foster greater prosperity, and advance the human condition. At the same time, history is filled with examples where slow-moving governments stifled innovation in ways policymakers never intended, and nefarious actors used technological advances in ways that inventors never imagined. Technology is a tool. It is not inherently good or bad. But its use can amplify human talent or degrade it, uplift societies or repress them, solve vexing challenges or exacerbate them. These effects are sometimes deliberate but often accidental.”
“The stakes of technological developments today are especially high. Artificial intelligence (AI) is already revolutionizing industries, from music to medicine to the military, and its impact has been likened to the invention of electricity. Yet AI is just one among many technologies that are ushering in profound change. Fields like synthetic biology, materials science, and neuroscience hold potential to vastly improve health care, environmental sustainability, economic growth, and more. We have experienced moments of major technological change before. But we have never experienced the convergence of so many technologies with the potential to change so much, so fast.”
“The Stanford Emerging Technology Review(SETR) is the first product of a major new Stanford technology education initiative for policymakers. Our goal is to help both the public and private sectors better understand the technologies poised to transform our world so that the United States can seize opportunities, mitigate risks, and ensure that the American innovation ecosystem continues to thrive.”
ICYMI: FBI Director Statement Before the House Committee on Homeland Security
FBI Director Christopher Wray delivered this statement to the House Committee on Homeland Security last month, highlighting the work of his agency across several mission areas, including emerging technologies and counter WMD. Wray explained in part of this statement that, “In addition to fighting terrorism, countering the proliferation of weapons-of-mass-destruction materials, technologies, and expertise, preventing their use by any actor, and securing nuclear and radioactive materials of concern are also top national security priority missions for the FBI. The FBI considers preventing, mitigating, investigating, and responding to weapons of mass destruction (“WMD”) terrorism a “no-fail” mission because a WMD attack could result in substantial injuries, illness, or loss of lives, while yielding significant social, economic, political, and other national security consequences. In collaboration with federal, state, local, tribal, territorial, and other partners, the FBI integrates complementary efforts to counter WMD terrorism. An example of this collaboration is the FBI-led Weapons of Mass Destruction Strategic Group. This interagency crisis action team spans more than 15 departments and agencies to coordinate the federal government’s response to WMD threats and incidents. Alongside the FBI, the Department of Homeland Security maintains the largest footprint on the strategic group.”
NEW: Looking Ahead in Ukraine: What Could Increase the Risk of Escalation?
“As U.S. lawmakers debate the question of continued defense and humanitarian aid to Ukraine, the Ukrainian fight to expel Russian invaders continues with no end in sight. The stalemate on the front lines in Ukraine masks continued intense fighting and demands for resources on both sides that may drive longer-term changes—on the battlefield, inside Russia, and beyond. This could lead to further escalation, including the potential to turn the conflict into a wider war. Understanding which circumstances and policies may risk escalation in Ukraine is paramount: not only are decisions about supporting Ukraine critical to the long-term trajectory of the conflict but also the United States confronts a broad set of challenges across the globe.”
“Please join RAND’s National Security Research Division on Tuesday, December 5, 2023, 9:30 – 11:00 am ET, for a moderated panel discussion about which circumstances or policies may risk escalation in Ukraine—either deliberate or inadvertent—and the potential triggers and restraining factors likely to shape Russian escalation decisions in particular.”
“Missy Ryan, a national security reporter at the Washington Post, will moderate the discussion.”
NEW: Threat Agnostic Biodefense Webinar: Assessing the Zoonotic Risk of Pre-Emergent Viruses
From PNNL: “Exploration of the “virosphere” is in its golden age. The sheer number of new viruses discovered daily, and the fact that most cannot be cultured, creates enormous uncertainty about where to allocate attention and resources. It is not an intractable problem, however, to distinguish those few viruses that are likely to emerge as zoonoses from the many others that are not. This talk describes two diametric approaches to addressing this problem. The first approach involves a field-to-lab investigative methodology that, when combine with biologically informed predictive computational models, can assess the zoonotic risk of viruses that have not yet been identified in humans. The second approach relies on the power of modern methods in anthropology and ethnography to identify zoonotic transmission pathways, even before the identification of any pathogens that might traverse those pathways. A unifying example is simian hemorrhagic fever virus and its relatives in the family Arteriviridae, which cause important animal diseases but have never been documented to infect humans. Both approaches identify these viruses as high-risk pre-emergent zoonoses.”
Learn more and register for this December 6 event here.
NEW: Bio & Beer
“As a rising global leader in the bioeconomy, investments in the future STEM workforce are critical in order to secure the U.S.’s position as a world resource for biohealth technology and innovations. Join us and our three guest speakers as we discuss the importance of a diverse, skilled STEM workforce to address rapidly increasing industry demand. We will also talk about training and other opportunities designed to prepare individuals for STEM careers. Enjoy an evening of networking, drinks, and fun!”
Meeting the Moment: Biodefense Policy, Procurement, and Public Health
From the Bipartisan Commission on Biodefense: “As the Nation continues to endure the consequences of recent pandemics, and with continued interest in biological weapons by nation states and other enemies, the federal government has an opportunity to address vulnerabilities in the biodefense enterprise. At this meeting, titled Meeting the Moment: Biodefense Policy, Procurement, and Public Health, the Commission intends to further explore : (1) biodefense policies and activities at the Department of Defense; (2) federal stockpile evaluation and decision-making for smallpox medical countermeasures; (3) needed authorities of the Department of Health and Human Services, including the Centers for Disease Control and Prevention; and (4) biodefense leadership.”
This meeting will take place on December 5, from 10:30 am until 4 pm ET. Register here.
2023 EPA International Decontamination Research and Development Conference-“Advancing Preparedness through Science and Collaboration”
“The clean-up of chemical, biological, or radiological (CBR) contamination incidents and natural disasters is a critical challenge for the United States. Understanding how to characterize and remediate affected areas of environmental contamination and waste is necessary for daily life to return.”
“The Decon Conference is designed to facilitate presentation, discussion, and further collaboration of research and development topics focused on an all-hazards approach to remediate contaminated indoor and outdoor areas, critical infrastructure, water distribution systems, and other environmental areas/materials.”
“This conference is free and open to the public. Content and presentations are geared towards the emergency response community, including local and state emergency managers, homeland security officials, first responder coordinators, private sector industry, risk managers, educators in the field of emergency management, and others.”
This event will take place December 5-7 in Charleston, SC. Learn more and register here.
Mitigating Arboviral Threats and Strengthening Public Health Preparedness
“Arboviruses are a broad group of viruses that are spread by arthropods, such as ticks and mosquitoes. Diseases caused by arboviruses, like dengue, chikungunya, Zika, and yellow fever, present a significant public health burden and threaten billions of people worldwide. Despite the global recognition of the devastating health and economic impacts of these diseases, the need persists for improved integration of mitigation efforts into public health systems and environmental and urban planning.”
“The National Academies Forum on Microbial Threats will conduct a two-day workshop that will identify lessons learned from previous outbreaks, outline current arbovirus surveillance capacities, and describe novel approaches to arbovirus mitigation. The workshop will include perspectives from researchers, public health practitioners, and environmental management experts from across the globe.”
This event will take place on December 12 and 13. Learn more here.
Presidential Advisory Council on Combating Antibiotic-Resistant Bacteria (PACCARB) Virtual Meeting
“The Presidential Advisory Council on Combating Antibiotic-Resistant Bacteria (PACCARB) provides advice, information, and recommendations to the U.S. Secretary of Health and Human Services (HHS Secretary). The council supports and evaluates U.S. government activities focused on fighting antimicrobial resistance (AMR) in human health, animal health, and environmental health. Using this One Health approach, members of the PACCARB have expertise from a range of backgrounds, including academia, industry, public health, advocacy, veterinary, and agricultural production.”
“As a federal advisory committee, the PACCARB looks to engage with the public and all AMR stakeholders. The council holds several public meetings every year both in-person and live streamed on the HHS.gov website. These meetings are open to anyone with an interest in combating AMR. See how to get involved!”
This virtual meeting will take place on December 20 from 9-4 EST. Learn more here.
61st ISODARCO Course: Nuclear Order and International Security after Ukraine
“The war in Ukraine has had an enormous impact on global security, reviving nuclear fears, undermining the prospects for arms control, and shattering many of the norms and constraints that were the foundation of European security. ISODARCO 2024 will examine the global nuclear order in light of the Ukraine war, focusing on the states, the policies and the technologies that will shape the future in a much more difficult environment. How will we cope with this more dangerous world?”
This course will take place January 7-14, 2024, at the University of Trento. Learn more and register here.
International Conference, CBRNE Research & Innovation
“The last 40 years have demonstrated that both military and civilian populations could be exposed to highly hazardous CBRNE agents following conflicts, natural outbreaks and disasters, industrial incidents or terrorist attacks.”
“Worldwide, researchers, responders and industrial capacities have been commited to provide adapted response to these challenges.”
“Building on the success of the first 5 International Conferences « CBRNE Research and Innovation » which took place in Antibes (2015), Lyon (2017), Nantes (2019), on line (2021) and Lille (2022), we want to give you a new opportunity to build up or strengthen collaborative networks in Strabourg (March 19th – 21rst 2024).”
“The CBRNE R&I Conference is specifically devoted to scientific updates, responders’ feedbacks and expression of needs. It also includes workshops and demonstrations of innovative materials, technologies and procedures, according to the following themes: DETECTION – IDENTIFICATION, PROTECTION – DECONTAMINATION, MEDICAL COUNTERMEASURES, RISKS & CRISIS MANAGEMENT.”
“Looking forward to your proposals for communication and to welcoming you at Strasbourg in March 2024!”
Registration is now open for the Global Health Security 2024 conference in Sydney, Australia. This iteration will take place 18-21 June, 2024. The call for abstracts is also still open. “The mission of the Global Health Security conference is to provide a forum where leaders, researchers, policy-makers, and representatives from government, international organisations, civil society, and private industry from around the world can engage with each other, review the latest research and policy innovations, and agree solutions for making the world safer and healthier. To that end, our mission is to help foster a genuinely multidisciplinary community of practice that is committed to working collaboratively to enhance global health security and eliminate disease, irrespective of its origin or source.”
Council on Strategic Risks Launches the Nuclear Weapon Systems Project
“How states view the roles and relevance of nuclear weapons is changing. While these perspectives have been dynamic since the dawn of the atomic age, the changes occurring today and drivers of these changes are particularly worrisome—in particular given that they seem to be on the cusp of reversing a period heavily characterized by arms control agreements, reductions in global arsenals, and advances in international cooperation to reduce nuclear weapons risks.”
“CSR’s core nuclear policy work to address this challenging time has focused largely on qualitative approaches to reducing the risks of nuclear miscalculations, uses of these weapons, arms racing behavior, and other dangerous trends. Going beyond numbers of weapons—which has been a major policy focus given numerical limitations in past nuclear treaties—a qualitative view of the nuclear weapons landscape is done through the lens of the nuclear capabilities nations seek, and associated policies and postures. This can help to show where multiple nations might find areas for potential cooperation that would be mutually beneficial. It can also help to show where nations currently possess the capabilities they claim to need, and thereby in what ways cooperative or unilateral measures of restraint are the most appropriate.”
“In order to facilitate this work by CSR and by others, we are launching The Nuclear Weapon Systems Project to help visualize how the types of nuclear capabilities fielded in the world have evolved since the advent of these weapons.”
“This project seeks to document and characterize every deployed nuclear weapons system that NPT-recognized nuclear states have developed in history. More than just a list of bombs, missiles, and artillery shells, the resulting dataset illustrates a complex story of risks, strategies, and lessons learned—and lost. We consider this data to be a living resource, and encourage outside contributions and feedback.”
“Georgetown Global Health Center Launches First Open-Access Wildlife Disease Database”
Georgetown University Medical Center’s Center for Global Health Science and Security recently announced “the launch of a first-of-its-kind wildlife disease database — a system for collecting records of viruses, bacteria, fungi, parasites, etc. — designed to support an early warning system for potential viral emergence. The Pathogen Harmonized Observatory, or PHAROS, is open to the global community and free to access.”
“Scientists in GHSS’ Verena program, a collaborative institute comprising a global team of scientists, designed PHAROS to advance research and education around viral emergence — the process of viruses jumping from animals to humans. Verena co-founder and director Colin Carlson, PhD, says most platforms designed to track diseases in wild animals are very limited and are developed only in response to a major outbreak, such as birds dying off suddenly due to avian flu.”
‘“Our goal is to build a data sharing system that lets us eventually predict pandemics like the weather,” Carlson says. “When we collect data on wildlife viruses, it gets published in journals and then lost forever, because it isn’t ever standardized or compiled. After COVID, there’s no excuse to keep working that way.”’
Texas A&M Research Assistant Professor (Pandemic Preparedness/Biosecurity) Openings
Texas A&M University’s Scowcroft Institute of International Affairs is seeking up to two Research Assistant Professors with expertise in pandemic preparedness and/or biosecurity. The Research Assistant Professor will be in the Scowcroft Institute of International Affairs, Bush School of Government & Public Service, and will work with the Pandemic Preparedness & Biosecurity Policy Program. Responsibilities include teaching graduate courses, conducting research, and writing policy-relevant publications on biosecurity, global health security, bio and agro-defense, federal life sciences policy, one health, biotechnology, or related policy topics.
This week covers France’s arrest warrants for Bashar al-Assad and several associates in relation to CW use in Syria, the US House’s passage of a measure that would prohibit federal funding for GoF research, the discovery of a new satellite phage in Maryland, the Bureau of Arms Control, Verification and Compliance’s recent rebranding, and more. As always, new publications and upcoming events are included, as well as multiple new professional opportunities, including exciting job openings with Texas A&M’s Scowcroft Institute and opportunities for publication.
French Authorities Issue Arrest Warrants for Bashar Al-Assad and Associates
Criminal investigative judges in France have formally issued arrest warrants for Syrian President Bashar al-Assad and three of his associates-Maher al-Assad, the de-facto leader of an elite Syrian unit, and two generals in the Syrian military-for the use of chemical weapons against civilians. This follows an investigation focused on CW attacks in Douma and Eastern Ghouta in August 2013, which killed over 1,000 people.
Civil Rights Defenders explains that “The decision to issue arrest warrants against several high-ranking representatives of the Syrian regime follows a multi-year criminal investigation. In addition to Bashar al-Assad, President of the Syrian Arab Republic and head of the armed forces, and Maher al-Assad, de facto leader of the 4th Armored Division, warrants have been issued against General Ghassan Abbas, Director of Branch 450 of the Syrian Scientific Studies and Research Center (SSRC), and General Bassam al-Hassan, Presidential Advisor for Strategic Affairs and liaison officer between the Presidential Palace and the SSRC. The arrest warrants refer to the legal qualifications of complicity in crimes against humanity and war crimes.”
‘“The French judiciary’s issuance of arrest warrants against the head of state, Bashar al-Assad, and his associates constitutes a historic judicial precedent. It is a new victory for the victims, their families, and the survivors and a step on the path to justice and sustainable peace in Syria.” said lawyer Mazen Darwish, founder and director general of the Syrian Center for Media and Freedom of Expression (SCM).”’
Similar complaints have also been filed in Germany and Sweden, as CRD notes in their statement on this development. The organization explains “The principle of extraterritorial jurisdiction can be used by courts to investigate and prosecute international atrocity crimes committed on foreign territory under certain circumstances. In October 2020, SCM, Syrian Archive, and the Open Justice Initiative filed a similar complaint before the Office of the German Federal Public Prosecutor, on the Syrian government’s sarin attacks on al Ghouta in 2013 and on Khan Shaykhun in 2017.”
“A further criminal complaint was filed by the three NGOs in April 2021 in Sweden, together with Civil Rights Defenders, against high-ranking members of the Assad regime for war crimes and crimes against humanity. Together, the French, German and Swedish complaints include evidence from the most detailed investigations carried out into these attacks to date.”
The OPCW has conducted numerous fact-finding missions focused on CW use in the Syrian conflict, and there are now several fact-finding mission and Investigation and Identification Team reports on the topic available on the organization’s website. This includes a report from early 2023 finding “reasonable grounds to identify Syrian Arab Air Forces as perpetrators of 2018 Douma chemical attack.”
US House Approves Federal Funding Ban on GoF Research
The House of Representatives approved HR 5894, which includes a measure banning federal funding for studies that include gain-of-function research. Though the bill in question still requires Senate approval to have a chance to take effect, this move will likely be worrying to many in the scientific community.
Science Insider offers brief background on the bill, explaining “Sponsored by Representatives Thomas Massie (R–KY) and Mariannette Miller-Meeks (R–IA), the ban was part of a slate of amendments to the 2024 House spending bill for the Department of Health and Human Services (HHS), the parent agency of the National Institutes of Health (NIH), that came before the full chamber yesterday. It passed on a voice vote, meaning individual members did not have to register their support or opposition…”
“The GOF amendment would revise language passed into law last year that banned HHS from funding such work in China and other “adversary” countries such as Cuba. That qualifier is now gone, meaning work by HHS-funded researchers in the United States could also be banned. The amendment now reads: “None of the funds made available by this Act may be used, either directly or indirectly, to conduct or support any gain-of-function research involving a potential pandemic pathogen.”’
“Vampire Virus” Discovered in Poolesville, Maryland
Some transplants insist Maryland sucks, and it appears they may have a point. A lab at the University of Maryland, Baltimore County recently discovered a virus that latches onto the neck of another virus…Dracula style. What’s more, the discovery may potentially aid in future antiviral therapy development work.
In 2019, undergraduates in the lab found a viral satellite attached to a Streptomyces scabiei bacterium isolated from soil samples taken in Poolesville. The satellite was named bacteriophage MindFlayer. However, the same lab recently discovered that there was not just the original satellite present, but a second satellite phage as well attached to the neck of MindFlayer-satellite phage MiniFlayer. The details of this finding are included in the lab’s recent article in The ISME Journal.
The lab’s PI, Ivan Erill, recently authored a piece in The Conversation explaining his team’s findings, in which he writes in part, “MiniFlayer is the first satellite phage known to have lost its ability to lie dormant. Not being able to lie in wait for your helper to enter the cell poses an important challenge to a satellite phage. If you need another virus to replicate, how do you guarantee that it makes it into the cell around the same time you do?”
“MiniFlayer addressed this challenge with evolutionary aplomb and horror-movie creativity. Instead of lying in wait, MiniFlayer has gone on the offensive. Borrowing from both “Dracula” and “Alien,” this satellite phage evolved a short appendage that allows it to latch onto its helper’s neck like a vampire. Together, the unwary helper and its passenger travel in search of a new host, where the viral drama will unfold again. We don’t yet know how MiniFlayer subdues its helper, or whether MindFlayer has evolved countermeasures.”
“If the recent pandemic has taught us anything, it is that our supply of antivirals is rather limited. Research on the complex, intertwined and at times predatory nature of viruses and their satellites, like the ability of MiniFlayer to attach to its helper’s neck, has the potential to open new avenues for antiviral therapy.”
Stakeholder Groups Urge Congress to Reauthorize Pandemic and All-Hazards Preparedness Act
A group of more than 100 stakeholders recently sent a letter to congressional leadership, calling on Congress to reauthorize the Pandemic and All-Hazards Preparedness Act (PAHPA) before the end of the calendar year. The effort, led by the Johns Hopkins Center for Health Security, “called on Senate Majority Leader Charles Schumer, Senate Minority Leader Mitch McConnell, House Speaker Mike Johnson, and House Minority Leader Hakeem Jeffries to include a comprehensive 5-year PAHPA reauthorization in moving legislation this year.”
‘“Our nation’s changing health security threat landscape and the federal government’s responsibility to protect the American people demand that we work together now to find a strong bipartisan path forward to reauthorize this critical legislation,” write the signatories. “Failing to reauthorize PAHPA would have serious effects on our country’s economic well-being, national security, and health security given the rapidly changing threat landscape.”’
Read the full letter here and see the complete list of signatories here.
State Department Renames Bureau of Arms Control, Verification and Compliance to the Bureau of Arms Control, Deterrence, and Stability
Oxford comma fans, rejoice! The Department of State announced this week that it has renamed the Bureau of Arms Control, Verification and Compliance as the Bureau of Arms Control, Deterrence, and Stability (ADS). In its statement, the Department said, “This name change reflects the full scope of this Bureau’s long-standing work and its role in addressing new challenges posed by emerging security technologies and domains. ADS leads Department of State efforts on developing, negotiating, implementing, and verifying compliance with a range of arms control and disarmament agreements and arrangements; extended deterrence; missile defense; confidence- and security-building measures (CSBMs); risk reduction; and crisis communications. Working with others in the Department, ADS has grown its capacity to respond to issues relating to artificial intelligence, biotechnology, and quantum computing. Today, the Bureau is playing a key role in establishing and promoting norms of responsible behavior in outer space, cyberspace, and with artificial intelligence and other emerging technologies. Diplomatic efforts advancing these issues contribute to integrated deterrence, global stability, and international security.”
“This change reflects a broader effort within the Department to address emerging 21st century national security challenges. While the core functions of ADS remain the same – to use diplomacy to reduce risks and avoid miscalculations – we recognize how we must modernize our approaches and expand our thinking to help build a more stable, peaceful world.”
“Technical Experts and International Diplomats Convened to Advance the “Joint Assessment Mechanism”‘
New from the Nuclear Threat Initiative: “NTI | bio convened two working groups of international biosecurity experts to discuss policy and institutional considerations, and technical operations for the Joint Assessment Mechanism (JAM) to identify the source of high-consequence biological outbreaks of unknown origin. These discussions were motivated by the recognition that there is a gap within the UN system in capabilities to perform this critical function. The October 19th and November 3rd discussions focused on how the JAM, best established within the United Nations Secretary-General’s office, could cooperate with partner organizations like the World Health Organization (WHO) and the UN Secretary Generals’ Mechanism for Investigation of Alleged Use of Chemical and Biological Weapons (UNSGM)–serving as an interface between these two mechanisms.”
“The group of experts also discussed potential functions of the JAM during periods between “activation,” when there is no outbreak of unknown origin to investigate. There was broad consensus that the JAM will need to adopt a “steady state” function during these times and that it would need sufficient technical operating capacities for both modes of operation. In response, the experts proposed that researchers within the JAM synthesize and report on biosurveillance and biosecurity data generated by partner organizations. They discussed the need for data sharing agreements and mechanisms to build trust among partners, noting that it would be important to strike a balance between drafting robust agreements and maintaining flexibility to engage necessary resources during a rapidly emerging situation.”
“To further the policy and technical conversations around establishing the JAM, H.E. Ambassador Alexander Marschik of Austria hosted NTI | bio and permanent representatives, deputy permanent representatives, and expert staff from 16 nations for a working lunch on November 7th. Discussions focused on the possibility of placing the JAM within the UN Secretary General’s Office and navigating partnerships with other UN organizations, as well as ideas for building widespread political support across UN member states to establish the JAM.”
“The Antimicrobial Resistance Research Landscape and Emerging Solutions”
This CSET Data Brief was written by Vikram Venkatram and Katherine Quinn: “Antimicrobial resistance (AMR) is one of the world’s most pressing global health threats. Basic research is the first step towards identifying solutions. This brief examines the AMR research landscape since 2000, finding that the amount of research is increasing and that the U.S. is a leading publisher, but also that novel solutions like phages and synthetic antimicrobial production are a small portion of that research.”
“Perspective: The Rise of “Wet” Artificial Intelligence”
Aneil Mallavarapu recently published this piece in proto.life, explaining in the article’s introduction that “While the public’s attention has been captured by AI chatbots, a quiet revolution has been brewing in the sciences. One of the most promising fields AI is impacting is biology—long dominated by the tradition of the “wet lab,” which favors pure experimental data over computer simulation. Deep learning is changing that. It enables computers to understand complex patterns in data and generate ideas based on those patterns, and that’s making AI more and more central to experimental biology. There is no field more complex in its patterns than biology, so AI is the perfect tool for understanding it. And—as a host of new companies are showing—engineering it.”
“Electronics in the Shahed-136 Kamikaze Drone”
David Albright and Sarah Burkhard recently published this report with the Institute for Science and International Security. They explain in their introduction, “Shahed-136 kamikaze drones, filled with Western electronics, continue to destroy Ukrainian lives and their civilian infrastructure. These drones, also known as Geran 2, are produced and assembled at JSC Alabuga facilities inside the Alabuga Special Economic Zone in Russia, with assistance from Iran. Yet, the company responsible, JSC Alabuga, and related companies are still not found on public U.S. or allied sanctions lists.”
“Report on Deterrence in a World of Nuclear Multipolarity”
This week, the State Department announced that, “the Secretary’s International Security Advisory Board (ISAB) released its study, “Report on Deterrence in a World of Nuclear Multipolarity.” The report fulfills the request from Ambassador Bonnie D. Jenkins, the Under Secretary of State for Arms Control and International Security, to undertake a study on how to use the mutually reinforcing tools of deterrence and arms control to address the challenges of two future nuclear-armed strategic peers – Russia and the PRC. The recommendations, developed by a study group consisting of a subset of board members, was approved during the Board’s October 31, 2023, plenary meeting.”
“Handbook of Best Practices for Strategic Trade Control Enforcement at Ports”
King’s College London recently released this handbook that “…is designed primarily for use by government agencies responsible for enforcing STCs at ports, for example customs, border protection and policing. It will also support the work of agencies responsible for port management and governance, export licensing, trade regulation, maritime domain awareness, and industry outreach.”
“A particularly strong feature of this handbook is the large number of international experts who contributed content and expertise. Significant contributions came from consultants on STCs and sanctions in UK and Dutch Customs, and a senior advisor in the UK’s Export Control Joint Unit. Excellent contributions also came from the Manager of the Port of London, the UN Panel of Experts, and a research group at Ghent University. Based on leading voices from industry, law enforcement, international security and academia, this handbook will help governments meet the complex challenges of strategic trade control.”
What We’re Listening To 🎧
Poisons and Pestilence 18 Bonus Episode: The Clouds of Auguste Trillat with Étienne Aucouturier
NEW: National Biodefense Science Board Public Meeting
“The NBSB will discuss and vote on two set of recommendations related to COVID-19 pandemic lessons; Project NextGen vaccine and therapeutic products; and disaster preparedness training. The Board is also inviting key stakeholder groups to address the Board and share their ideas on issues related to current and future chemical, biological, radiological, and nuclear threats, and other disaster preparedness and response matters.”
This virtual meeting will take place on November 30 at 1 pm EST. Learn more and register here.
NEW: HIDA-ASPR Educational Webinar Series
“HIDA has collaborated with the Administration for Strategic Preparedness and Response (ASPR) on a series of webinars designed to educate stakeholders on the role of ASPR programs as well as share insights on successful public/private partnerships. Specifically, this series focuses on a few areas of ASPR to offer you a greater understanding of what the agency does that make it so effective, and what your organization can do to improve preparedness and response AND engage with ASPR:
NEW: Presidential Advisory Council on Combating Antibiotic-Resistant Bacteria (PACCARB) Virtual Meeting
“The Presidential Advisory Council on Combating Antibiotic-Resistant Bacteria (PACCARB) provides advice, information, and recommendations to the U.S. Secretary of Health and Human Services (HHS Secretary). The council supports and evaluates U.S. government activities focused on fighting antimicrobial resistance (AMR) in human health, animal health, and environmental health. Using this One Health approach, members of the PACCARB have expertise from a range of backgrounds, including academia, industry, public health, advocacy, veterinary, and agricultural production.”
“As a federal advisory committee, the PACCARB looks to engage with the public and all AMR stakeholders. The council holds several public meetings every year both in-person and live streamed on the HHS.gov website. These meetings are open to anyone with an interest in combating AMR. See how to get involved!”
This virtual meeting will take place on December 20 from 9-4 EST. Learn more here.
Meeting the Moment: Biodefense Policy, Procurement, and Public Health
From the Bipartisan Commission on Biodefense: “As the Nation continues to endure the consequences of recent pandemics, and with continued interest in biological weapons by nation states and other enemies, the federal government has an opportunity to address vulnerabilities in the biodefense enterprise. At this meeting, titled Meeting the Moment: Biodefense Policy, Procurement, and Public Health, the Commission intends to further explore : (1) biodefense policies and activities at the Department of Defense; (2) federal stockpile evaluation and decision-making for smallpox medical countermeasures; (3) needed authorities of the Department of Health and Human Services, including the Centers for Disease Control and Prevention; and (4) biodefense leadership.”
This meeting will take place on December 5, from 10:30 am until 4 pm ET. Register here.
2023 EPA International Decontamination Research and Development Conference-“Advancing Preparedness through Science and Collaboration”
“The clean-up of chemical, biological, or radiological (CBR) contamination incidents and natural disasters is a critical challenge for the United States. Understanding how to characterize and remediate affected areas of environmental contamination and waste is necessary for daily life to return.”
“The Decon Conference is designed to facilitate presentation, discussion, and further collaboration of research and development topics focused on an all-hazards approach to remediate contaminated indoor and outdoor areas, critical infrastructure, water distribution systems, and other environmental areas/materials.”
“This conference is free and open to the public. Content and presentations are geared towards the emergency response community, including local and state emergency managers, homeland security officials, first responder coordinators, private sector industry, risk managers, educators in the field of emergency management, and others.”
This event will take place December 5-7 in Charleston, SC. Learn more and register here.
Mitigating Arboviral Threats and Strengthening Public Health Preparedness
“Arboviruses are a broad group of viruses that are spread by arthropods, such as ticks and mosquitoes. Diseases caused by arboviruses, like dengue, chikungunya, Zika, and yellow fever, present a significant public health burden and threaten billions of people worldwide. Despite the global recognition of the devastating health and economic impacts of these diseases, the need persists for improved integration of mitigation efforts into public health systems and environmental and urban planning.”
“The National Academies Forum on Microbial Threats will conduct a two-day workshop that will identify lessons learned from previous outbreaks, outline current arbovirus surveillance capacities, and describe novel approaches to arbovirus mitigation. The workshop will include perspectives from researchers, public health practitioners, and environmental management experts from across the globe.”
This event will take place on December 12 and 13. Learn more here.
61st ISODARCO Course: Nuclear Order and International Security after Ukraine
“The war in Ukraine has had an enormous impact on global security, reviving nuclear fears, undermining the prospects for arms control, and shattering many of the norms and constraints that were the foundation of European security. ISODARCO 2024 will examine the global nuclear order in light of the Ukraine war, focusing on the states, the policies and the technologies that will shape the future in a much more difficult environment. How will we cope with this more dangerous world?”
This course will take place January 7-14, 2024, at the University of Trento. Learn more and register here.
International Conference, CBRNE Research & Innovation
“The last 40 years have demonstrated that both military and civilian populations could be exposed to highly hazardous CBRNE agents following conflicts, natural outbreaks and disasters, industrial incidents or terrorist attacks.”
“Worldwide, researchers, responders and industrial capacities have been commited to provide adapted response to these challenges.”
“Building on the success of the first 5 International Conferences « CBRNE Research and Innovation » which took place in Antibes (2015), Lyon (2017), Nantes (2019), on line (2021) and Lille (2022), we want to give you a new opportunity to build up or strengthen collaborative networks in Strabourg (March 19th – 21rst 2024).”
“The CBRNE R&I Conference is specifically devoted to scientific updates, responders’ feedbacks and expression of needs. It also includes workshops and demonstrations of innovative materials, technologies and procedures, according to the following themes: DETECTION – IDENTIFICATION, PROTECTION – DECONTAMINATION, MEDICAL COUNTERMEASURES, RISKS & CRISIS MANAGEMENT.”
“Looking forward to your proposals for communication and to welcoming you at Strasbourg in March 2024!”
Registration is now open for the Global Health Security 2024 conference in Sydney, Australia. This iteration will take place 18-21 June, 2024. The call for abstracts is also still open. “The mission of the Global Health Security conference is to provide a forum where leaders, researchers, policy-makers, and representatives from government, international organisations, civil society, and private industry from around the world can engage with each other, review the latest research and policy innovations, and agree solutions for making the world safer and healthier. To that end, our mission is to help foster a genuinely multidisciplinary community of practice that is committed to working collaboratively to enhance global health security and eliminate disease, irrespective of its origin or source.”
Texas A&M Research Assistant Professor (Pandemic Preparedness/Biosecurity) Openings
Texas A&M University’s Scowcroft Institute of International Affairs is seeking up to two Research Assistant Professors with expertise in pandemic preparedness and/or biosecurity. The Research Assistant Professor will be in the Scowcroft Institute of International Affairs, Bush School of Government & Public Service, and will work with the Pandemic Preparedness & Biosecurity Policy Program. Responsibilities include teaching graduate courses, conducting research, and writing policy-relevant publications on biosecurity, global health security, bio and agro-defense, federal life sciences policy, one health, biotechnology, or related policy topics.
Call for Ideas to Counter Disinformation on Social Media
“Social media is being deliberately flooded with information intended to deceive and mislead. Such information has adversely affected the decision-making process for key functions of our society by impacting our ability to respond to immediate and long-term crises, in particular those related to controversial subjects such as elections, pandemic response, and climate change.”
“The National Academies of Sciences, Engineering, and Medicine’s Committee on Evolving Technological, Legal and Social Solutions to Counter Disinformation on Social Media (the “Committee”) is seeking creative ideas to detect, measure, and mitigate such disinformation. We invite you, your small team, or large collaborative to send us groundbreaking ideas (or new perspectives on conventional ideas) for countering disinformation on social media and related platforms.”
“We welcome out-of-the-box, non-linear, and/or interdisciplinary ideas. You may wonder, “If I submit my idea, what will happen?” Submissions will be considered for discussion at a public, virtual National Academies’ workshop on April 10-11, 2024.”
“If the Committee finds your submission particularly compelling, it will be discussed at the workshop (and you could be asked to present and discuss your idea[s] there).*”
“The workshop will feature two days of interactive brainstorming to foster new research and collaborations and build implementable solutions for a whole-of-society approach to mitigating disinformation and its detrimental effects. Following the event, a workshop proceedings will be published by the National Academies Press.”
Request for Letters of Support for ProMED Rescue Initiative
The American Veterinary One Health Society is requesting letters of support for an initiative to save ProMED. “The Program for Monitoring Emerging Diseases (ProMED) was launched in 1994 as an Internet-based service to identify unusual health events related to emerging and re-emerging infectious diseases and toxins affecting humans, animals, plants and all-natural life in the world. It has been a program activity of the International Society for Infectious Diseases (ISID) since 1999. ProMED is the largest and most dependable publicly available system conducting global reporting of health-related disease outbreaks. Reports are produced and commentary provided by a multidisciplinary global team of subject matter expert (SME) Moderators in a variety of fields including microbiology, parasitology, pathology, epidemiology, entomology, veterinary, environmental health, toxicology, insect/plant diseases and beyond. Historically, ProMED is in operation 24 hours a day, 7days a week to ensure timely reporting in every time zone. Tragically, the ProMED program now finds itself in grave financial troubles.”
Learn more and submit letters using the instructions here.
“Divergent Options is calling for national security papers assessing situations or discussing options related to Nuclear Threats.”
“For the purpose of this Call for Papers, a nuclear threat could range from traditional nuclear bombs and missiles to conventional explosives combined with radioactive material aka a Dirty Bomb. The context could also range from nation states to non-state actors.”
“Please limit your article to 1,000 words and write using our Options Paper or Assessment Paper templates which are designed for ease of use by both writers and readers alike.”
“Divergent Options is a non-politically aligned non-revenue generating national security website that, in 1,000 words or less, provides unbiased, dispassionate, candid articles that assess a national security situation, present multiple options to address the situation, and articulate the risk and gain of each option. Please note that while we assess a national security situation and may provide options, we never recommend a specific option.”
This week covers updates on the press to reauthorize DHS’ CWMD Office and other programs, CDC’s expansion of the Traveler-Based Genomic Surveillance Program, and more from Google, the WHO, the US Department of State, and others. New publications follow, including several focused on the intersection of AI and biodefense and multiple publications from alumni of the Biodefense Graduate Program.
Schar School Biodefense MS Virtual Open House
Prospective students are invited to attend an information session to hear more about the Biodefense MS program offered at the Schar School. The online session will provide an overview of the program, as well as the application process, student experience, and graduate outcomes. This admissions session will be led by the Graduate Admissions team. This event will take place on November 13 from 12 to 1 pm EST. Learn more and register here.
Secretary Mayorkas Urges Congress to Reauthorize Several DHS Programs
The Department of Homeland Security Secretary, Alejandro Mayorkas, urged Congress this week to reauthorize several programs in his department, including DHS’ counter-unmanned aircraft systems authority (set to expire November 18), the Countering Weapons of Mass Destruction Office (set to expire December 21), and CISA’s authority to implement the Chemical Facility Anti-Terrorism Standards Program, which expired this summer.
According to ExecutiveGov, Mayorkas said in a Senate hearing ‘“As of today, we have no longer been authorized to conduct over 450 inspections, when historically more than a third of inspections identify at least one gap in a facility’s security.”
The same article explained that “Mayorkas also urged Congress to protect DHS’ intelligence collection authorities by reauthorizing Section 702 of the Foreign Intelligence Surveillance Act and resisting a provision in a proposed bill that would limit the authority of the department’s Office of Intelligence and Analysis.”
CDC to Screen for COVID-19, Flu, RSV, and Other Diseases at Major Airports
The CDC Travelers’ Health Branch is set to roll out an expanded version of the Traveler-Based Genomic Surveillance Program at four major US airports-Boston Logan, San Francisco International, Washington’s Dulles International, and New York’s John F. Kennedy. CNN explained that “The program currently operates Covid-19 surveillance at seven major international airports in the United States. For a pilot program, it’s now expanding to test for more than 30 bacteria, antimicrobial resistance targets and viruses including influenza A and B, and respiratory syncytial virus, known as RSV…The traveler surveillance program was introduced in 2021 when the CDC began collecting nasal swab samples from anonymous international travelers arriving at participating airports who volunteer to get swabbed.”
Google Joins Bio-ISAC
Google announced this week that it has joined the not-for-profit organization, the Bioeconomy Information Sharing and Analysis Center (Bio-ISAC), as an industry member. The company said in a statement, “As the bioeconomy grows and evolves, its manufacturers are increasingly reliant on digital technologies and interconnected systems. Cybersecurity is paramount. Ensuring the security of supply chains, industrial control systems, intellectual property and data, protecting the connected critical infrastructure becomes essential to prevent disruptions and maintain trust. Robust cybersecurity measures safeguard the bioeconomy’s valuable assets and maintain public confidence in the sector’s ability to drive sustainable innovation and economic growth.”
“To support these efforts and Google Cloud’s commitment to securing the cloud, our customers, and the planet, we have joined the Bioeconomy Information Sharing and Analysis Center (Bio-ISAC) as an Industry Member. As an Industry Member, we will help connect organizations working to better secure the bioeconomy with Google Cloud’s own cybersecurity resources and expertise.”
Explaining the goal of Bio-ISAC, the statement further elaborated “Bio-ISAC is an international not for profit organization that addresses threats unique to the bioeconomy. Working to enhance the cybersecurity posture of the biotechnology industry, Bio-ISAC brings together companies, research institutions, government agencies, and cybersecurity experts to share timely and relevant information on emerging cyber threats, vulnerabilities, and mitigation strategies to keep the industry informed and better prepared to protect critical assets and infrastructure.”
WHO, Johns Hopkins Announce WHO Generic All-Hazards Risk Assessment Tool for Mass Gathering Events
The Johns Hopkins Center for Health Security announced this week that it has partnered with WHO to create the WHO Generic All-Hazards Risk Assessment Tool for Mass Gathering Events (All-Hazards MG RA Tool). According to the Center, “This user-friendly and innovative digital tool aims to support WHO Member States and mass gathering event organizers in identifying, assessing, and mitigating risks associated with large-scale gatherings, ultimately enhancing event safety.”
The All-Hazards MG RA Tool aims to build “…upon earlier risk assessment tools for mass gatherings developed by WHO and the Johns Hopkins Center for Health Security, which focused on the risk of amplifying COVID-19 spread. The WHO All-Hazards MG RA Tool represents a collaborative effort between 2 renowned organizations with a shared commitment to global health and safety.”
The tool provides:
“A systematic, evidence-based approach to identifying and classifying priority risks.
A description of the necessary level of national preparedness and readiness to mitigate specific hazards.
Guidance on the implementation of a comprehensive and strategic risk assessment to inform preparedness and response plans, ahead of the mass gathering.
An estimated assessment of the host country’s capacity to identify and respond to potential negative health impacts related to the event.”
State Department Launches North Korea Sanctions Website
The US Department of State Export Control and Related Border Security Program has collaborated with CRDF Global to launch the North Korea Sanctions website. According to their press statement, “This website has been meticulously designed to serve as a valuable resource for government officials and private sector practitioners alike, offering accessible and pertinent information in three languages: English, Spanish, and Bahasa. The website contains digestible, searchable syntheses of open-source information about UN sanctions on the Democratic People’s Republic of Korea (DPRK) with the aim of assisting practitioners in finding, understanding, and referencing authoritative information on sanctions.”
“Addressing the Threat of Disease Spillover”
A team from the Council on Strategic Risks recently authored this report. Two of the authors, Yong-bee Lim and Saskia Popescu, are alumni of the Biodefense PhD Program. The report’s summary promises “The report provides a deeper understanding of the current landscape of pandemic prevention activities that focus on high-risk disease spillover sites. It provides examples of the complex web of biological and ecological factors that contribute to spillover risks, and highlights a range of current activities and practices. It also identifies gaps and challenges currently stemming from the existing silos between the biological and ecological security fields—gaps and challenges which result in siloed approaches to the way these activities are conceptualized, considered, executed, and prioritized.”
“Biotechnology: The Deadly Weaponization of Life”
Diego Laje recently interviewed Sonia Ben Ouagrham-Gormley, an associate professor in the Schar School, for this piece in Signal. Laje writes in part, “Using biological agents as weapons is illegal, but an organism that scientists lawfully use for genuine research could be repurposed for an attack. Therefore, what is banned depends on what an actor plans to do rather than the actual pathogens.”
“Leveraging biotechnology could be a new, more terrorizing form of adopting technologies for greater destruction. Nevertheless, for one specialist, this is only another iteration of the age-old weaponization of life…“There are no biotechnological weapons. They don’t exist. It’s biological weapons,” explained Sonia Ben Ouagrham-Gormley, deputy director of the biodefense program at George Mason University.”
“Social Media Lies: User’s Private Information and the Spread of Misinformation and Disinformation”
Christina Roberts and Keith Ludwick (a Biodefense PhD Program alumnus) recently published this article in Global Security and Intelligence Studies: “Social media is becoming more and more integrated with everyday life. Individuals around the globe use social media to stay connected with family and friends, conduct business, market products, run political campaigns, and a myriad of other activities. Unfortunately, the integration of social media with daily life is becoming so ubiquitous as to numb users to the possibility that the companies controlling our access to social media might be using the private information gleaned from individual users to help spread misinformation/disinformation (MIDI). This paper asks: How does the use of private information by social media companies lead to the spread of misinformation or disinformation? Using a Grounded Theory approach and examining three instances of social media companies accessing users’ private information (Cambridge Analytica, Russian interference in the 2016 U.S. Presidential Election, and the January 6th insurrection at the U.S. Capitol), this paper interprets these incidents to determine the extent of culpability of the company’s use of private user information. The findings indicate a strong link between these companies’ private, personal information use and the spread of MIDI. The study finishes with policy recommendations and suggestions for future research.”
“Can’t Quite Develop That Dangerous Pathogen? AI May Soon Be Able to Help”
Allison Berke recently published this piece with The Bulletin of the Atomic Scientists, in which she explains “Imagine the near future of artificial intelligence (AI) models. One model might be able to replicate the email-writing styles of others. Mimicking a virologist, it could convince his colleagues to provide sensitive information on a newly identified viral mutation. Another might evaluate existing chemotherapies and suggest variations for making the drugs even more toxic, including to non-cancerous cells. Yet another model might be able analyze a failed genetic engineering experiment and could, through generated photos, guide a beginner toward an improved protocol for making antibiotic-resistant bacteria.”
“The capabilities these scenarios describe are close to what the current crop of advanced and publicly available AI tools can already do. The day when a bad actor could use such an AI model to develop, say, a biological weapon, could potentially be soon. But how can these risky uses of AI be deterred without curtailing the extraordinary potential of these tools to accelerate helpful biotechnology development?”
Steph Batalis published this article in Foreign Policy, writing “Human extinction, mass unemployment, cheating on exams—these are just some of the far-ranging fears when it comes to the latest advances in artificial intelligence chatbot capabilities. Recently, however, concern has turned toward the possibility that a chatbot could do some serious damage in another area: making it easier to construct a biological weapon.”
“These fears are based in large part on a report from a group at the Massachusetts Institute of Technology, as well as testimony in the U.S. Congress from Dario Amodei, the CEO of AI company Anthropic. They argue that chatbots could provide users with step-by-step instructions to genetically engineer and produce pathogens, such as viruses or bacteria. Armed with such information, the thinking goes, a determined chatbot user could go as far as to develop and deploy a dangerous bioweapon without the need for any scientific training.”
“The Mad Scientists of AI”
Carmen Paun recently authored this piece for POLITICO, explaining in her introduction “Artificial intelligence designs a new toxin that doesn’t exist in nature. Someone then uses a machine the size of a microwave — called a benchtop DNA synthetic device — to produce it and spread it, potentially triggering a new pandemic.”
“This might sound like science fiction but experts warn that it could happen if governments don’t set rules for how AI is used in synthetic biology.”
— A National Academies of Sciences, Engineering, and Medicine report with recommendations on how to mitigate risks from AI trained on biological data and also an assessment of how AI could be used to reduce biosecurity risks;
— Rules from the White House Office of Science and Technology Policy for providers of synthetic nucleic acid sequences, requiring them to identify biological sequences that could be used to engineer a bioweapon and to screen their customers;
— Requirements for the beneficiaries of federal life science research grants that they procure synthetic nucleic acid only from companies that follow the OSTP rules.”
“Prepare for Pandemics or CBRN Threats? We Must Do Both.”
Greg Burel and David Lasseter recently published this piece in Real Clear Defense. In it, they write in part: “In our fight against the growing threat of manmade weapons and natural born agents, we no longer have the luxury of focusing on one at the expense of the other. It’s time for the preparedness community to walk and chew gum at the same time.”
“That’s especially true given the relatively little attention that many in the U.S. Government and the media pay to the biological threat compared to the shiny objects of cybersecurity, artificial intelligence, and hypersonic missiles. While those evolving capabilities will certainly shape dynamic and changing future battlefields, the threats posed by manmade chemical, biological, radiological, and nuclear (CBRN) weapons and natural occurring germs are a clear and present threat today that is only growing given the sheer scale of violence the world is now experiencing. The U.S. Government must ensure the American people and warfighters, as well as its allies and partners, have the capabilities necessary to defend against and respond to the broad array of threats that can turn from regional to global in days.”
“All-Hazards Policy for Global Catastrophic Risk”
This Technical Report from the Global Catastrophic Risk Institute was authored by Rumtin Sepasspour and explains that “A variety of threats could cause catastrophic harm to humanity globally. The list of threats include, but are not limited to, nuclear weapons, climate change, pandemics, asteroids and comets, supervolcanic eruption and ecological collapse. Although each threat has distinctive characteristics, they are not unrelated or mutually exclusive.”
“An all-hazards approach to global catastrophic risk (GCR) addresses GCR as a whole. An allhazards policy approach provides a strategic policy framework to reducing GCR. It helps reduce multiple threats and hazards at the same time. It also helps tackle threats that are unknown or underestimated. Ultimately, all-hazards GCR policy will enable more efficient, effective and holistic reduction of GCR compared to treating the threats and hazards separately.”
“This report introduces the concept of all-hazards GCR and applies it to government policy for reducing GCR. It presents two approaches to all-hazards GCR policy.”
“We Are Not Prepared for Biological Attacks Resulting From the Escalating Israel-Hamas War”
Joe Lieberman and Tom Ridge make the case for paying attention to biological threats arising from the Israel-Hamas War in this Messenger Opinion piece, writing in part “It is urgent that the Biden administration and Congress take these biological threats seriously and act to prevent them and, if necessary, be ready to respond. We need our government to pull together at this time of danger to ensure that our nation’s defense, intelligence, and public health communities can continue to protect us and do their critical work at home and around the world.”
“Immediate priorities are to avoid the imminent government shutdown on November 17, send military and humanitarian aid to the regions at war, and reauthorize of Section 702 of the Foreign Intelligence Surveillance Act (FISA) which expires at the end of this year. Section 702 authorizes the U.S. Intelligence Community, under court supervision, to target communications of non-Americans located overseas and ensures that our government can quickly obtain critical intelligence while protecting the rights of Americans. Section 702 is absolutely essential for intelligence gathering to address the potential of biological terrorism and warfare.”
“TB Is the World’s Second Deadliest Infectious Disease”
Anna Fleck for Statista: “Tuberculosis, or TB, was the world’s second deadliest infectious disease in 2022, following only after Covid-19. According to data from the World Health Organization, an estimated 1.13 million HIV-negative people died from TB last year. To put this into perspective, the officially reported death toll for Covid was 1.24 million in 2022, while total deaths from AIDS/HIV totaled 0.63 million and malaria 0.62 million.”
“When people with HIV die from TB, their deaths are officially classified as deaths from AIDS/HIV. Tuberculosis is also known as the leading killer for people living with HIV/AIDS.”
“In terms of all known causes of deaths, the WHO estimated in 2019 that where heart disease, strokes and chronic obstructive pulmonary disease were the three biggest killers, TB came in rank 13.”‘
“More Medical Gloves Are Coming From China, as U.S. Makers of Protective Gear Struggle”
If you have forgotten the horror of the mad dash to acquire PPE in the US during the early days of the pandemic, revive that sense of panic with Nell Greenfieldboyce’s recent analysis piece for NPR. Greenfieldboyce dissects how many of the plants the federal government invested in heavily to address these PPE shortages have yet to actually produce anything as China and other Asian countries grow their output.
The piece explores the effects of the panic-and-neglect funding cycle, explaining in part “A spokesperson for the Department of Health and Human Services (HHS), which worked with the Department of Defense to give out grants during the pandemic, says that the efforts by the HHS have “strengthened our preparedness for future public health threats but sustaining the gains that our country has made over the last few years is difficult, important, and requires continued investment in domestic manufacturing.”‘
What We’re Listening To 🎧
Issues in Science and Technology Podcast, EP 38: Sustaining Science for the Future of Ukraine
“After Russia invaded Ukraine, hundreds of scientists fled the country and hundreds more remained behind. Those scientists who stayed are trying to continue their research and engage with the global scientific community under often difficult circumstances, with the ultimate goal of being able to help rebuild Ukraine when the war ends.”
“Since the early days of the war, Vaughan Turekian, the director of the Policy and Global Affairs Division of the National Academies of Sciences, Engineering, and Medicine, has been leading efforts to support Ukrainian scientists and their research, enlisting the help of international science academies and philanthropic partners. Turekian has spent much of his career in science diplomacy. Before joining the Academies, he served as the fifth science and technology advisor to US Secretary of State John Kerry and was also the founding director of the Center for Science Diplomacy at the American Association for the Advancement of Science.”
“In this episode, recorded on October 5, Turekian joins host Molly Galvin to discuss efforts to support Ukrainian scientists and why such efforts are important for the future of Ukraine.”
NEW: Global Health Security and Diplomacy in the 21st Century
Join the State Department’s Bureau of Global Health Security and Diplomacy and the Council on Foreign Relations for their inaugural symposium, “Global Health Security and Diplomacy in the 21st Century.” This event will take place on November 13, from 8:15 am through 2:30 pm EST. Access the livestream here.
NEW: Better Testing Now: A New Testing Playbook to Aid Planning & Mitigate Harms from Biological Emergencies
“On November 16th at 12PM EST the Pandemic Center will host Better Testing Now: A new Testing Playbook to aid planning & mitigate harms from biological emergencies.“
“In October of 2023, the “Testing Playbook for Biological Emergencies” was published. Its purpose is to provide executive leaders with easy-to-use information that will inform their planning on how equitable access to accurate testing can quickly be provided to all communities during an emerging biological event and how the data from testing can inform emergency decisions at each stage of a crisis.”
“On November 16th, the Pandemic Center will bring together authors of the Testing Playbook to discuss lessons learned and next steps.”
NEW: Meeting the Moment: Biodefense Policy, Procurement, and Public Health
From the Bipartisan Commission on Biodefense: “As the Nation continues to endure the consequences of recent pandemics, and with continued interest in biological weapons by nation states and other enemies, the federal government has an opportunity to address vulnerabilities in the biodefense enterprise. At this meeting, titled Meeting the Moment: Biodefense Policy, Procurement, and Public Health, the Commission intends to further explore : (1) biodefense policies and activities at the Department of Defense; (2) federal stockpile evaluation and decision-making for smallpox medical countermeasures; (3) needed authorities of the Department of Health and Human Services, including the Centers for Disease Control and Prevention; and (4) biodefense leadership.”
This meeting will take place on December 5, from 10:30 am until 4 pm ET. Register here.
NEW: Mitigating Arboviral Threats and Strengthening Public Health Preparedness
“Arboviruses are a broad group of viruses that are spread by arthropods, such as ticks and mosquitoes. Diseases caused by arboviruses, like dengue, chikungunya, Zika, and yellow fever, present a significant public health burden and threaten billions of people worldwide. Despite the global recognition of the devastating health and economic impacts of these diseases, the need persists for improved integration of mitigation efforts into public health systems and environmental and urban planning.”
“The National Academies Forum on Microbial Threats will conduct a two-day workshop that will identify lessons learned from previous outbreaks, outline current arbovirus surveillance capacities, and describe novel approaches to arbovirus mitigation. The workshop will include perspectives from researchers, public health practitioners, and environmental management experts from across the globe.”
This event will take place on December 12 and 13. Learn more here.
NEW: International Conference, CBRNE Research & Innovation
“The last 40 years have demonstrated that both military and civilian populations could be exposed to highly hazardous CBRNE agents following conflicts, natural outbreaks and disasters, industrial incidents or terrorist attacks.”
“Worldwide, researchers, responders and industrial capacities have been commited to provide adapted response to these challenges.”
“Building on the success of the first 5 International Conferences « CBRNE Research and Innovation » which took place in Antibes (2015), Lyon (2017), Nantes (2019), on line (2021) and Lille (2022), we want to give you a new opportunity to build up or strengthen collaborative networks in Strabourg (March 19th – 21rst 2024).”
“The CBRNE R&I Conference is specifically devoted to scientific updates, responders’ feedbacks and expression of needs. It also includes workshops and demonstrations of innovative materials, technologies and procedures, according to the following themes: DETECTION – IDENTIFICATION, PROTECTION – DECONTAMINATION, MEDICAL COUNTERMEASURES, RISKS & CRISIS MANAGEMENT.”
“Looking forward to your proposals for communication and to welcoming you at Strasbourg in March 2024!”
Fireside Chat: Chemical Weapons Threats and Responses
“The Council on Strategic Risks (CSR) will host a public event on Monday, November 13, 2023 in Washington, D.C. on chemical weapons threats and responses. This will be the first in a series of quarterly “fireside chat” discussions that CSR plans to host regarding weapons of mass destruction issues.”
Charting a Responsible Future in AI & Biosecurity: A Webinar Series
From NASEM: “This two-part webinar will bring together technology developers, researchers, and policymakers working at the intersection of generative artificial intelligence (AI) and biological research for nuanced discussions that explore the impact of these technologies on innovation, potential biosecurity risks, and promising solutions. The first session (Nov 6) will examine the technological capabilities and bridge the needs for risk management between developers and policymakers. The second session (Nov 15) will focus on governance of these emerging technologies, including challenges in defining regulatory policies as well as approaches in safeguarding against these risks.”
Key Issues at the 28th CWC Conference of States Parties
“The CWC Coalition will host a webinar on Tuesday, November 14 on the key issues facing the Chemical Weapons Convention ahead of its annual Conference of States Parties in The Hague from November 27 through December 1, 2023.
We will highlight key issues, followed by a general discussion with all participants. Our goal is to define the issues that civil society would like to raise at the Conference of States Parties. Issues include:
– Compliance
– Accountability
– Universality
– Expansion of schedules
– and more”
This event will take place at 10 am EST. Learn more and register here.
2023 EPA International Decontamination Research and Development Conference-“Advancing Preparedness through Science and Collaboration”
“The clean-up of chemical, biological, or radiological (CBR) contamination incidents and natural disasters is a critical challenge for the United States. Understanding how to characterize and remediate affected areas of environmental contamination and waste is necessary for daily life to return.”
“The Decon Conference is designed to facilitate presentation, discussion, and further collaboration of research and development topics focused on an all-hazards approach to remediate contaminated indoor and outdoor areas, critical infrastructure, water distribution systems, and other environmental areas/materials.”
“This conference is free and open to the public. Content and presentations are geared towards the emergency response community, including local and state emergency managers, homeland security officials, first responder coordinators, private sector industry, risk managers, educators in the field of emergency management, and others.”
This event will take place December 5-7 in Charleston, SC. Learn more and register here.
61st ISODARCO Course: Nuclear Order and International Security after Ukraine
“The war in Ukraine has had an enormous impact on global security, reviving nuclear fears, undermining the prospects for arms control, and shattering many of the norms and constraints that were the foundation of European security. ISODARCO 2024 will examine the global nuclear order in light of the Ukraine war, focusing on the states, the policies and the technologies that will shape the future in a much more difficult environment. How will we cope with this more dangerous world?”
This course will take place January 7-14, 2024, at the University of Trento. Learn more and register here.
Registration for GHS 2024 Now Open
Registration is now open for the Global Health Security 2024 conference in Sydney, Australia. This iteration will take place 18-21 June, 2024. The call for abstracts is also still open. “The mission of the Global Health Security conference is to provide a forum where leaders, researchers, policy-makers, and representatives from government, international organisations, civil society, and private industry from around the world can engage with each other, review the latest research and policy innovations, and agree solutions for making the world safer and healthier. To that end, our mission is to help foster a genuinely multidisciplinary community of practice that is committed to working collaboratively to enhance global health security and eliminate disease, irrespective of its origin or source.”
Job Opportunity: Senior Research Program Manager
“The Hoover Institution’s Biotechnology Policy Initiative, based at Stanford University, is seeking highly motivated Senior Research Program Manager to join our team”.
Job purpose and duties include: “Lead biopolicy research efforts on matters arising at the intersection of emerging biotechnologies and national security, economic strategy, political theory, democracy, and freedom. Work under the general direction of joint senior faculty at Stanford/Hoover to develop, implement, and administer the vision, strategy, and goals of the assigned academic entity/program(s). Participate in entity/program strategy development, long-range planning, and partnership development. Open to considering candidates from post baccalaureate through post-doctoral or others with significant industry or government experience.”
This job posting is from the WHO’s Health Emergencies Program. “The mission of WHO’s Health Emergencies Programme (The Programme) is to help countries, and coordinate international action, to prevent, prepare for, detect, rapidly respond to, and recover from outbreaks and emergencies. The team objective is to support the Incident Management team in Operation Support and logistics related to response operations. The scope of the work will be aligned with the WHO principles of work and strategic documents on the health system infrastructure and health care services provision, public health essential operations and public health emergency preparedness and response principles.” Learn more and apply here.
This week covers President Biden’s recent executive order on AI, China’s recent warning about “gene weapons,” a recent Senate committee hearing that featured several points about the nation’s efforts to prevent WMD use, and more. Several publications are listed as well, including ones focused on everything from drones, US biotech regulations, AI, and China’s false claims about alleged Taiwanese BW labs. Upcoming events and more professional opportunities finish out this issue.
Schar School Open Houses
Virtual PhD Open House
Prospective students are invited to attend a virtual open house to learn more about the Schar School of Policy and Government PhD Programs and interact with the admissions staff and faculty program directors. This event will take place on November 8 from 7 to 8:30 pm EST. Learn more and register here.
Virtual Biodefense MS Open House
Prospective students are invited to attend a information session to hear more about the Biodefense M.S. program offered at the Schar School. The online session will provide an overview of the program, as well as the application process, student experience and graduate outcomes. This session admissions will be led by the Graduate Admissions team. This event will take place on November 13 from 12 to 1 pm EST. Learn more and register here.
One Health Commission Celebrates Annual One Health Day
The One Health Commission once again celebrated its annual One Health Day yesterday, November 3, with associated events continuing through the end of the year. “Initiated in 2016 by the One Health Commission, the One Health Platform, and the One Health Initiative Team, International One Health Day is officially celebrated around the world every year on November 3. The One Health Platform closed its doors in 2021 so One Health Day was overseen in 2021 and 2022 by the One Health Commission and One Health Initiative Autonomous team.”
“The goal of One Health Day is to build the cultural will necessary for a sea change in how planetary health challenges are assessed and addressed and how professionals exchange information across disciplines. One Health Day brings global attention to the need for One Health collaborations and allows the world to ‘see them in action’. The One Health Day campaign is designed to engage as many individuals as possible from as many arenas as possible in One Health education and awareness events and to generate an inspiring array of projects worldwide.”
EO on AI Ee I Ee I O: President Biden Issues Executive Order On Artificial Intelligence
This week, the White House announced President Biden signed an executive order aimed at “seizing the promise and managing the risks of artificial intelligence.” In a press statement, the White House said “The Executive Order establishes new standards for AI safety and security, protects Americans’ privacy, advances equity and civil rights, stands up for consumers and workers, promotes innovation and competition, advances American leadership around the world, and more.”
The EO takes several actions under the main categories of New Standards for AI Safety and Security, Protecting Americans’ Privacy, Advancing Equity and Civil Rights, Standing Up for Consumers, Patients, and Students, Supporting Workers, Promoting Innovation and Competition, Advancing American Leadership Abroad, and Ensuring Responsible and Effective Government Use of AI.
The statement further explained “As we advance this agenda at home, the Administration will work with allies and partners abroad on a strong international framework to govern the development and use of AI. The Administration has already consulted widely on AI governance frameworks over the past several months—engaging with Australia, Brazil, Canada, Chile, the European Union, France, Germany, India, Israel, Italy, Japan, Kenya, Mexico, the Netherlands, New Zealand, Nigeria, the Philippines, Singapore, South Korea, the UAE, and the UK. The actions taken today support and complement Japan’s leadership of the G-7 Hiroshima Process, the UK Summit on AI Safety, India’s leadership as Chair of the Global Partnership on AI, and ongoing discussions at the United Nations.”
China’s MSS Warns of “Gene Weapons”
“Some countries have “armed” themselves with deadly weapons targeting human genes, China’s top spy agency alleged on Monday – the first time a Chinese state body has mentioned such a threat publicly,” an article from the South China Morning Post reported this week.
The same article explains, “In a post on its official WeChat account, the Ministry of State Security said some nations had targeted the Chinese population for “ulterior motives”…The ministry did not name those countries or offer evidence to support the claim…While up to 99.9 per cent of human DNA is shared between all individuals on earth, there are key genetic differences that distinguish those of a certain ethnicity or race, the Chinese ministry said.”
While this may be the first time a ministry, let alone the one focused on non-military intelligence, has made such public claims, this is not the first time authoritative statements on the matter have come from the Chinese government. For example, as highlighted by Elsa Kania and Wilson Vorndick in a 2019 piece for Defense One, “The 2017 edition of Science of Military Strategy (战略学), a textbook published by the PLA’s National Defense University that is considered to be relatively authoritative, debuted a section about biology as a domain of military struggle, similarly mentioning the potential for new kinds of biological warfare to include “specific ethnic genetic attacks,” indicating that prominent members of the PLA are also focused in part on this concept.
Furthermore, despite ethnic bioweapons being a long-disputed concept, this statement from the MSS likely was intended to incite public concerns by drawing on the size of the country’s largest ethnic group-Han Chinese-who make up about 92% of the PRC’s population. As the SCMP article notes, developing this kind of weapon would be, at best, plagued by several substantial technical challenges, and there is no evidence such weapons exist, contrary to claims made by the likes of RFK Jr. and Russian state media. However, the PRC has increasingly spread false information about biological weapons and peaceful biological research in recent years, building on a decades-long effort to undermine global norms on BW, making it likely this is more of the same rather than a genuine expression of concern from the MSS.
Senate Homeland Security and Governmental Affairs Committee Holds Hearing on Threats to the Homeland
This week, the Senate Homeland Security and Governmental Affairs Committee held a full committee hearing titled “Threats to the Homeland.” Panelists included DHS Secretary Alejandro Mayorkas, FBI Director Christopher Wray, and NCCO Director Christine Abizaid. Senator Gary Peters, Committee Chairman, said in part of his opening statement, “Our nation also faces emerging threats from biological, chemical, nuclear, and radiological weapons – especially if those weapons fall into the wrong hands. I have long been concerned about the danger this poses – which is why I led the effort to re-authorize the Office of Countering Weapons of Mass Destruction, and will continue to work towards its passage. We must also re-authorize the Chemical Facility Anti-Terrorism Standards Program, and ensure that facilities that store or produce chemicals are secure from terrorist threats.”
Much of Secretary Mayorkas’ testimony focused on this topic, with the DHS Secretary touching on the work of his department’s Countering Weapons of Mass Destruction Office and the recent expiration of the Chemical Facility Anti-Terrorism Standards, which was overseen by CISA. A portion of Secretary Mayorka’s testimony is included below:
“Countering Weapons of Mass Destruction”
“Although terrorist capabilities to conduct large-scale attacks have been degraded by U.S. counterterrorism operations and policies, terrorists remain interested in acquiring and using weapons of mass destruction (WMD) in attacks against U.S. interests and the Homeland. Congress established the DHS Countering Weapons of Mass Destruction Office (CWMD) in 2018 to elevate, consolidate, and streamline DHS efforts to protect the Homeland from WMD and chemical, biological, radiological, and nuclear (CBRN) threats. CWMD serves as the DHS nexus for WMD and CBRN coordination, which includes providing direct support to both our government and industry partners. Of significant concern is DHS’s ability to continue the mission to counter WMDs after the authorization for CWMD terminates on December 21, 2023. DHS’s tools to accomplish this mission are at risk.”
“The CWMD Office has primary authority and responsibility within DHS to protect the Homeland against CBRN threats by interpreting national strategies and developing departmental strategic guidance; monitoring and reporting on related threats; generating and distributing related risk assessments; and researching, developing, acquiring, and deploying operationally effective solutions, such as equipment, training, and exercises, in support of SLTT communities and Departmental Components. CWMD strengthens DHS-wide and federal interagency coordination and provides direct financial and operational support nationwide to SLTT partners who serve as first-responders. Additionally, as part of the President’s EO on AI, CWMD was tasked with helping to evaluate and mitigate the potential for AI to be used to develop WMDs, such as through AI-enabled misuse of synthetic nucleic acids to create biological weapons. If CWMD authorization is allowed to expire, not only will DHS not be able to support these AI efforts, but over $130 million in annual grants will cease to support state and local first responders for full time biological detection, illicit nuclear material detection, training, and exercises. CWMD will also cease important CBRN research to improve security standards and equipment for SLTTs and DHS, including threat detection and prevention at large events.”
“Chemical Facility Anti-Terrorism Standards”
“Chemical Facility Anti-Terrorism Standards (CFATS) is the nation’s first regulatory program focused specifically on security at high-risk chemical facilities. Managed by CISA, the CFATS program identifies and regulates high-risk facilities to ensure security measures are in place to reduce the risk that certain dangerous chemicals can be weaponized by terrorists. An attack on one of these U.S. sites could be as lethal as a nuclear blast. On July 28, 2023, DHS authorities to implement the CFATS expired, and the program ceased to operate. With the expiration of the program, DHS can no longer reassure the more than 3,200 communities surrounding chemical facilities at high risk of terrorist attack that everything is being done to ensure those chemicals are protected.”
“As of today, we have no longer been authorized to conduct over 450 inspections, when historically more than a third of inspections identify at least one gap in a facility’s security. We have lost crucial visibility, with likely more than 100 facilities having newly acquired chemicals without reporting them, resulting in the inability of CISA to conduct risk assessments of these facilities. Cybersecurity and physical security measures at these sites are being allowed to lapse, and government planners and first responders are forced to rely on out-of-date information about what civilian industry chemical stores exist in their areas of responsibility.”
“It is critical to the DHS mission and the safety of the Homeland that Congress reauthorize the Department’s C-UAS authority, the CFATS program, and the CWMD Office without delay. These programs are vital to protecting our communities against drones, WMDs, and other related CBRN threats.”
A recording of the hearing and the statements from the Chairman, Ranking Member, and those testifying are available here.
“Beijing Dusts Off an Old Playbook with Disinformation about Taiwan Biological Warfare Labs”
The Global Taiwan Institute’s John Dotson recently published this piece for the Global Taiwan Brief, writing in part “On July 9 of this year, the Taiwan newspaper United Daily News (UDN, 聯合報) published a pair of articles with startling headlines: “Does America Want Taiwan to Build a P4 Laboratory to Develop Biological Weapons? Documents Reveal the Discussions in a Democratic Progressive Party Government Meeting” (美要台灣設P4實驗室開發生物戰劑? 文件顯示民進黨政府曾開會討論); and “From Researching Biological Warfare to Secretly Advancing Research and Development / The Democratic Progressive Party’s Blind Pro-Americanism Abandons Conscience” (從反生物戰劑到秘密推動研發 民進黨盲目親美毀棄良知). The articles, both written by UDN reporter Kao Ling-yun (高凌雲), purported to reveal the minutes of a secret June 2022 meeting of a government body titled the “South Sea Working Committee” (南海工作會議), which indicated plans for the construction of a new level 4 bio-containment laboratory (P4 laboratory). This new lab would be housed within the Ministry of National Defense’s (MND, 中華民國國防部) existing National Defense Medical School Preventive Medicine Research Institute (國防醫學院預防醫學研究所) (located in the San Hsia district of New Taipei City), and used for purposes of biological warfare research.”
Dotson offers concise yet thorough discussion and insight into the history of the PRC’s BW disinformation efforts and how this narrative is being presented once more.
“Let the Experts Shape U.S. Biotech Regulations”
Gigi Kwik Gronvall recently authored this piece for Lawfare, writing in part “The Department of Health and Human Services (HHS) is currently considering proposed rules for scientific research that, if adopted in their current form, would severely handicap America’s economic competitiveness and its ability to prevent and treat infectious diseases. The proposed federal rules were suggested by civilian advisers to address certain types of research conducted on viruses and bacteria that cause human disease. Safety reviews of proposed research experiments are both essential and routine, and most scientists in U.S. laboratories would welcome a serious, thoughtful, comprehensive review of biological experiments involving potentially harmful microbes. The problem with the proposed rules, though, is that they are vague about which pathogens and what experiments should be targeted. This uncertainty is likely to cause scientists and their institutions to shun too wide an array of research out of an abundance of caution about running afoul of the new regulations. Some of the projects likely to be avoided could be crucial to making advances in biomanufacturing, engineered biology, environmental restoration, and even promising biotechnology applications like rare-earth mineral mining. In other words, the new rules threaten to throw the baby out with the bathwater.”
“Continued US and Allied Integration Is Essential to Deter Russian CBRN Use”
From the Atlantic Council: “This report presents the findings and recommendations of the Atlantic Council project, Conceptualizing Integrated Deterrence to Address Russian Chemical, Biological, Radiological, and Nuclear (CBRN) Escalation. The objective of this project was to develop an approach for incorporating European allies and partners into the US model of integrated deterrence against Russian CBRN use.
Key findings summary:
Allies and partners already significantly contribute to US approaches to counter Russian CBRN threats in Europe. Future cooperation—bilaterally, multilaterally, and through NATO— should focus on areas of greatest need as mutually identified by the United States and its European allies and partners.
As a concept, integrated deterrence is a useful frame for examining cooperation with European nations to counter Russia’s CBRN threats, but the US Government should use this framing to identify new opportunities, rather than detract from or encapsulate ongoing cooperation.
Civil-military cooperation across a variety of sectors is essential to respond to CBRN threats, especially among public health agencies and law enforcement. To fully realize integrated deterrence in the next five to ten years, greater coordination among civilian and military communities—within the United States and among its European allies and partners—is essential to enhancing resilience.
Challenges for US cooperation with allies and partners to counter CBRN threats, especially as these threats become more complex. The United States and its European allies should remain vigilant about emerging threats, while leveraging new technological developments in detection and attribution systems and emergency response mechanisms to build comprehensive defenses against CBRN threats.
As Russia deploys hybrid warfare tactics to support and conceal potential CBRN escalation, the United States and its European allies must prepare to combat malign influence efforts, such as information influence activities, targeted assassinations, energy sabotage, and economic coercion, related to CBRN use as part of the US strategy of integrated deterrence.”
“A Fragile State of Preparedness: 2023 Report on the State of the World’s Preparedness”
From the Global Preparedness Monitoring Board: “The GPMB 2023 Report, ‘A Fragile State of Preparedness’, which is based for the first time on an analysis using the GPMB Monitoring Framework, finds that global preparedness for pandemics and other disease outbreaks remains inadequate. There have been some areas of progress since COVID-19 but this progress remains fragile, and some areas have declined, highlighting an urgent need for political commitment and increased resources. The Board makes four key recommendations to urgently strengthen global preparedness.”
“PERSPECTIVE: Time’s Ticking: Tell Congress to Act Now to Protect Our Homeland, Reauthorize DHS’s CWMD Office”
Ron Fizer recently published this opinion piece in Homeland Security Today, writing in part “Failure to authorize the continuance of the Department of Homeland Security (DHS) Countering Weapons of Mass Destruction (CWMD) Office is an invitation to terrorism, a betrayal of our security, and a perilous gamble with our nation’s future. With our homeland on high alert for terrorism, the threat of a Chemical, Biological, Radiological, and Nuclear (CBRN) event is more existential than ever. Now is not the time to diminish our nation’s capability to safeguard against these threats. With the DHS CWMD Office facing imminent expiration on December 21, 2023, Congressional action is of utmost urgency. Vital to our nation’s security, any closure, even temporary, may make it impossible to bring DHS CWMD staffs’ gifted and rare skillsets back in an effective and timely manner to reconstitute our current vigilance.”
“Global Catastrophic Biological Risks: A Guide for Philanthropists”
From Founders Pledge, this report highlights several key points, including:
“Pandemics have long been a scourge on humanity, from the Black Death to the 1918 Flu to COVID-19.
But nature is not “the biggest bioterrorist.” Malevolent actors — of which there are many examples in history —could out-engineer evolution to create horrific pandemic pathogens.
Such deliberately-released engineered pandemics could result in the collapse of modern civilization and pose an existential risk to humanity.
Advances in the life sciences and enabling technologies like AI are shifting the risk landscape, creating a threat that is growing, complex, and adaptive to our risk-mitigation efforts, while at the same time proliferating powerful tools to thousands.
Despite billions spent on health security, most government spending does not target the most extreme pandemic scenarios.
Private philanthropists therefore need to fill this gap with funding for interventions that are threat agnostic and robust to the worst-case scenarios.”
“Indo-Pacific Missile Arsenals: Avoiding Spirals and Mitigating Escalation Risks”
Ankit Panda recently authored this report for the Carnegie Endowment for International Peace, writing in his summary “The Indo-Pacific region is on the cusp of a new missile age: inventories of short- to intermediate-range surface-to-surface missile systems are quickly growing in the region. Military planners and policymakers may view these capabilities as essential to preserving peace and maintaining deterrence, but this proliferation could intensify already complex security dilemmas, particularly related to North Korea and the Taiwan Strait, and heighten nuclear escalation risks. A new Carnegie report identifies the motivators of missile proliferation dynamics in Asia and offers recommendations for addressing the most salient risks.”
“Perspective- Drone Proliferation in the Conflict Zones: Who Are the Suppliers and Users?”
Mahmut Chengiz recently published this piece in the Small Wars Journal Blog, explaining in part “Unmanned Aerial Vehicles (UAVs), also known as drones, have evolved from reconnaissance tools to deadly weapons. Drones play critical roles in changing wars and become tools in the hands of fighting groups in the conflict zones. Increasing interest in acquiring drones makes its proliferation inevitable, and today, state actors and non-state actors, composed of militia groups, insurgents, and terrorist organizations, procure these drones. Its deployment in the conflict regions complicates the security environment further.”
“States have deployed drones to provide round-the-clock surveillance and carry out targeted strikes, even in foreign countries, which could result in legal and human rights issues. In some cases, these drones violate territorial sovereignty and cause collateral damage, raising questions about legality, secrecy, and absence of government accountability.”
“The Convergence of Artificial Intelligence and the Life Sciences: Safeguarding Technology, Rethinking Governance, and Preventing Catastrophe”
This new report from NTI reads in part, “Rapid scientific and technological advances are fueling a 21st-century biotechnology revolution. Accelerating developments in the life sciences and in technologies such as artificial intelligence (AI), automation, and robotics are enhancing scientists’ abilities to engineer living systems for a broad range of purposes. These groundbreaking advances are critical to building a more productive, sustainable, and healthy future for humans, animals, and the environment.”
“Significant advances in AI in recent years offer tremendous benefits for modern bioscience and bioengineering by supporting the rapid development of vaccines and therapeutics, enabling the development of new materials, fostering economic development, and helping fight climate change. However, AI-bio capabilities—AI tools and technologies that enable the engineering of living systems—also could be accidentally or deliberately misused to cause significant harm, with the potential to cause a global biological catastrophe.”
“These tools could expand access to knowledge and capabilities for producing well-known toxins, pathogens, or other biological agents. Soon, some AI-bio capabilities also could be exploited by malicious actors to develop agents that are new or more harmful than those that may evolve naturally. Given the rapid development and proliferation of these capabilities, leaders in government, bioscience research, industry, and the biosecurity community must work quickly to anticipate emerging risks on the horizon and proactively address them by developing strategies to protect against misuse.”
“The Promise and Peril of Artificial Intelligence — Violet Teaming Offers a Balanced Path Forward”
A recent preprint from Alexander Titus and Adam Russell: “Artificial intelligence (AI) promises immense benefits across sectors, yet also poses risks from dual-use potentials, biases, and unintended behaviors. This paper reviews emerging issues with opaque and uncontrollable AI systems and proposes an integrative framework called violet teaming to develop reliable and responsible AI. Violet teaming combines adversarial vulnerability probing (red teaming) with solutions for safety and security (blue teaming) while prioritizing ethics and social benefit. It emerged from AI safety research to manage risks proactively by design. The paper traces the evolution of red, blue, and purple teaming toward violet teaming, and then discusses applying violet techniques to address biosecurity risks of AI in biotechnology. Additional sections review key perspectives across law, ethics, cybersecurity, macrostrategy, and industry best practices essential for operationalizing responsible AI through holistic technical and social considerations. Violet teaming provides both philosophy and method for steering AI trajectories toward societal good. With conscience and wisdom, the extraordinary capabilities of AI can enrich humanity. But without adequate precaution, the risks could prove catastrophic. Violet teaming aims to empower moral technology for the common welfare.”
An episode of the MLSecOps Podcast also discusses this paper with one of its authors.
“Decoding Intentions: Artificial Intelligence and Costly Signals”
Georgetown’s Center for Security and Emerging Technology recently published this issue brief: “How can policymakers credibly reveal and assess intentions in the field of artificial intelligence? Policymakers can send credible signals of their intent by making pledges or committing to undertaking certain actions for which they will pay a price—political, reputational, or monetary—if they back down or fail to make good on their initial promise or threat. Talk is cheap, but inadvertent escalation is costly to all sides.”
What We’re Listening To 🎧
Poisons and Pestilence, 17 I’m All About That Basilisk
Brett Edwards is back with a new episode of Posisons and Pestilence! “In this episode, we examine the western gunpowder revolution and consider ideas for poison weapons which were outlined at this time in numerous military manuals.”
EVENT RECAP: UNODA and the Organisation for the Prohibition of Chemical Weapons Hold Joint Event About Priorities and Challenges for Sustaining a World Free of Chemical Weapons
From UNODA: “On Wednesday, 18 October 2023, the United Nations Office for Disarmament Affairs (UNODA) and the Organisation for the Prohibition of Chemical Weapons (OPCW) organized a joint event on the margins of the United Nations General Assembly First Committee to discuss the remaining priorities and challenges for sustaining a world free of chemical weapons after the verified destruction of all declared chemical weapons stockpiles in July 2023.”
NEW: Charting a Responsible Future in AI & Biosecurity: A Webinar Series
From NASEM: “This two-part webinar will bring together technology developers, researchers, and policymakers working at the intersection of generative artificial intelligence (AI) and biological research for nuanced discussions that explore the impact of these technologies on innovation, potential biosecurity risks, and promising solutions. The first session (Nov 6) will examine the technological capabilities and bridge the needs for risk management between developers and policymakers. The second session (Nov 15) will focus on governance of these emerging technologies, including challenges in defining regulatory policies as well as approaches in safeguarding against these risks.”
NEW: Fireside Chat: Chemical Weapons Threats and Responses
“The Council on Strategic Risks (CSR) will host a public event on Monday, November 13, 2023 in Washington, D.C. on chemical weapons threats and responses. This will be the first in a series of quarterly “fireside chat” discussions that CSR plans to host regarding weapons of mass destruction issues.”
NEW: Key Issues at the 28th CWC Conference of States Parties
“The CWC Coalition will host a webinar on Tuesday, November 14 on the key issues facing the Chemical Weapons Convention ahead of its annual Conference of States Parties in The Hague from November 27 through December 1, 2023.
We will highlight key issues, followed by a general discussion with all participants. Our goal is to define the issues that civil society would like to raise at the Conference of States Parties. Issues include:
– Compliance
– Accountability
– Universality
– Expansion of schedules
– and more”
This event will take place at 10 am EST. Learn more and register here.
2023 EPA International Decontamination Research and Development Conference-“Advancing Preparedness through Science and Collaboration”
“The clean-up of chemical, biological, or radiological (CBR) contamination incidents and natural disasters is a critical challenge for the United States. Understanding how to characterize and remediate affected areas of environmental contamination and waste is necessary for daily life to return.”
“The Decon Conference is designed to facilitate presentation, discussion, and further collaboration of research and development topics focused on an all-hazards approach to remediate contaminated indoor and outdoor areas, critical infrastructure, water distribution systems, and other environmental areas/materials.”
“This conference is free and open to the public. Content and presentations are geared towards the emergency response community, including local and state emergency managers, homeland security officials, first responder coordinators, private sector industry, risk managers, educators in the field of emergency management, and others.”
This event will take place December 5-7 in Charleston, SC. Learn more and register here.
61st ISODARCO Course: Nuclear Order and International Security after Ukraine
“The war in Ukraine has had an enormous impact on global security, reviving nuclear fears, undermining the prospects for arms control, and shattering many of the norms and constraints that were the foundation of European security. ISODARCO 2024 will examine the global nuclear order in light of the Ukraine war, focusing on the states, the policies and the technologies that will shape the future in a much more difficult environment. How will we cope with this more dangerous world?”
This course will take place January 7-14, 2024, at the University of Trento. Learn more and register here.
Registration for GHS 2024 Now Open
Registration is now open for the Global Health Security 2024 conference in Sydney, Australia. This iteration will take place 18-21 June, 2024. The call for abstracts is also still open. “The mission of the Global Health Security conference is to provide a forum where leaders, researchers, policy-makers, and representatives from government, international organisations, civil society, and private industry from around the world can engage with each other, review the latest research and policy innovations, and agree solutions for making the world safer and healthier. To that end, our mission is to help foster a genuinely multidisciplinary community of practice that is committed to working collaboratively to enhance global health security and eliminate disease, irrespective of its origin or source.”
Job Opportunity: Senior Research Program Manager
“The Hoover Institution’s Biotechnology Policy Initiative, based at Stanford University, is seeking highly motivated Senior Research Program Manager to join our team”.
Job purpose and duties include: “Lead biopolicy research efforts on matters arising at the intersection of emerging biotechnologies and national security, economic strategy, political theory, democracy, and freedom. Work under the general direction of joint senior faculty at Stanford/Hoover to develop, implement, and administer the vision, strategy, and goals of the assigned academic entity/program(s). Participate in entity/program strategy development, long-range planning, and partnership development. Open to considering candidates from post baccalaureate through post-doctoral or others with significant industry or government experience.”
This job posting is from the WHO’s Health Emergencies Program. “The mission of WHO’s Health Emergencies Programme (The Programme) is to help countries, and coordinate international action, to prevent, prepare for, detect, rapidly respond to, and recover from outbreaks and emergencies. The team objective is to support the Incident Management team in Operation Support and logistics related to response operations. The scope of the work will be aligned with the WHO principles of work and strategic documents on the health system infrastructure and health care services provision, public health essential operations and public health emergency preparedness and response principles.” Learn more and apply here.
Standing Committee on Advances and National Security Implications of Transdisciplinary Biotechnology: Call for Experts
The National Academies of Sciences, Engineering, and Medicine is seeking suggestions for experts to be considered for the membership rotation with the Standing Committee on Advances and National Security Implications of Transdisciplinary Biotechnology and associated activities, including forthcoming meetings of experts and a workshop. This Standing Committee convenes meetings and workshops to identify advanced biotechnology capabilities of interest and to explore transdisciplinary biotechnological research and development that holds promising scientific or technical capabilities for addressing national security needs. The committee discusses barriers or challenges to adoption, and practical and operational factors in the innovation ecosystem that enable the translation of these technologies. In addition to exploring broad biotechnology developments, the Standing Committee during 2023-2024 will have a particular emphasis on exploring the applicability of artificial intelligence and machine learning and automated experimentation (also referred to as “cloud labs” and “self-driving labs”) for biotechnology discovery and development across various applications (e.g., health, agriculture, materials, etc.). The committee also will: explore these technologies for the prevention of misuse of biotechnology; identify methods and data that can be used to forecast and track the development and adoption of these technologies; discuss opportunities for driving innovation in these technologies including technical, policy, financial, and similar types of drivers; and discuss methods to assess the costs and benefits of investing (or not investing) in the development of these technologies. The committee will further explore the feasibility of developing a US-based research network related to these technologies, and regulatory processes related to the transition of these and associated defense-specific biotechnology products and services to different sectors.
Using these suggestions, National Academies staff will look to fill 2-4 open seats on the standing committee of approximately 20 total volunteer experts and to establish a workshop planning committee of approximately 6-7 members, in addition to collecting information for potential speakers, participants, and other forms of engagement.
Learn more and submit nominations by November 10here.
Participant Nomination Call: Launching a Global Research Agenda for Evidence-Based Biosafety
From Gryphon Scientific: “Join us to build a global research agenda for evidence-based biosafety! We’re hosting a series of workshops on the sidelines of international conferences and seeking technical experts to contribute from across the one health spectrum and from countries of all resource levels. Participants will have the opportunity to shape potential future biosafety research projects and to collaborate with multisectoral experts from around the world.”
This week’s edition covers good news and upcoming open house events with the Schar School, the end of the EPA’s requirements for water utility facilities to undergo cybersecurity audits, and the arrest of the owner of the unauthorized, Chinese-owned lab in Fresno County, CA we previously covered. As always, new publications, upcoming events, and announcements round us out this week.Happy Halloween!
Biodefense PhD Student Lands Job with National Security Commission on Emerging Biotechnology
Kimberly Ma, a Biodefense PhD student, recently started a new job as a policy analyst on the National Security Commission on Emerging Biotechnology (NSCEB), which has been tasked with delivering a report on how advances in emerging biotechnology and related technologies will shape current and future DOD activities. Commissioners range from members of Congress to industry leaders and biotechnology subject matter experts, and the report will likely include components of both research analysis and policy recommendations. Kimberly’s primary work on the NSCEB will focus on the risks and threats associated with emerging biotechnology, along with international standards for managing these new tools within industry, government, and/or academia. These details and more about the NSCEB’s mission can be found here: https://www.biotech.senate.gov/section-1091-fy22-ndaa/
EPA Axes Certain Cyber Regulations for Water Utilities
Following growing concerns about the cybersecurity of the United States’ water infrastructure, the Environmental Protection Agency announced this week it will no longer require cybersecurity audits of water utility facilities through sanitary surveys. As explained in Cyberscoop, “In a letter to state drinking water administrators on Thursday, the EPA said litigation from Republican states and trade associations, which raised questions about the long-term legal viability of the initiative to regulate the cybersecurity of water utilities, drove the decision to rescind a March memorandum implementing the rule.”
“The announcement represents a major setback to the White House’s efforts to add more stringent cyber mandates to critical infrastructure sectors. The Biden administration’s National Cybersecurity Strategy described improving the digital defenses of critical infrastructure as a key priority.”
“Owners and operators of these systems are struggling to combat the deluge of ransomware and state-backed attacks and infiltration of the nation’s most sensitive networks. For critical infrastructure sectors, the consequences for a major cyberattack can be dire, and U.S. water utilities have been identified as particularly lacking in security.”
“EPA said it encourages “all states to voluntarily review public water system cybersecurity programs to ensure that any vulnerabilities are identified and corrected, and assistance is provided to systems that need help.”’
Owner of Unauthorized Lab in California Charged with Mislabeling and Lacking Permits for Work
Following reports of the uncovering of a Chinese-owned, unauthorized lab in Reedley, CA in August, the owner of the facility, Jia Bei Zhu, was arrested Thursday after an investigation conducted by the FDA. According to the AP, “The Chinese owner of an unauthorized central California lab that fueled conspiracy theories about China and biological weapons has been arrested on charges of not obtaining the proper permits to manufacture tests for COVID-19, pregnancy and HIV, and mislabeling some of the kits.”
In its press release, the US Attorney’s Office for the Eastern District of California said, ‘“As part of his scheme, the defendant changed his name, the names of his companies, and their locations,” U.S. Attorney Talbert said. “The disarray at the Reedley lab led to the glare of publicity he was trying to avoid, and the ensuing investigation unraveled his efforts to circumvent the requirements that are designed to ensure that medical devices are safe and effective.”’
‘“Providing materially false information to FDA inspectors regarding medical device manufacturing and distribution impedes the agency’s ability to protect public health, especially when those false statements relate to unauthorized and misbranded COVID-19 tests. Consumers who unknowingly use these misbranded COVID tests run the risk of incorrect results about their COVID status, which can lead to further spread of the virus,” said Special Agent in Charge Robert M. Iwanicki, FDA Office of Criminal Investigations Los Angeles Field Office. “We will continue to investigate and bring to justice those who jeopardize the health of U.S. consumers.”’
“According to court documents, between December 2020 and March 2023, Zhu and others manufactured, imported, sold, and distributed hundreds of thousands of COVID-19 test kits, in addition to test kits for HIV, pregnancy, clinical urinalysis, and other conditions in the United States and China. They did so through the companies Universal Meditech Incorporated (UMI) and Prestige Biotech Incorporated (PBI), which were based in Fresno and Reedley. UMI and PBI did not obtain the required authorizations to manufacture and distribute the test kits and mislabeled some of the test kits. When questioned by FDA officials, Zhu made false statements about his identity, his ownership and control of UMI and PBI, and the activities of UMI and PBI.”
“According to the criminal complaint, Reedley Code Enforcement officials received a complaint regarding a warehouse in Reedley for using non-permitted plumbing that was visible from outside the warehouse. When code enforcement officials went to the warehouse the next day, they saw various types of in vitro diagnostic test kits, related manufacturing equipment, and shipping supplies.”
“Further investigation found that UMI first registered as a medical device manufacturer with the FDA in November 2015 in Tulare and moved to Fresno in 2018. FDA records show that its registration lapsed in 2022, and it is no longer permitted to manufacture or import any in vitro diagnostic test kits in the United States. Any test kits that the company manufactured or imported after that date are considered misbranded medical devices.”
“To manufacture, import, and distribute COVID-19 test kits in the United States during the pandemic, a company must have applied for, and ultimately received, an Emergency Use Authorization (EUA) from the FDA. According to FDA records, UMI applied for an EUA for its COVID-19 test kits, but never received it due to major deficiencies in UMI’s test studies.”
“In November 2022, Fresno County officials notified UMI that they were going to inspect UMI’s Fresno facility to ensure everything was up to code following a fire that occurred at the facility. FDA officials then received an email from UMI’s attorney saying that the company had gone out of business and sold its assets to PBI, a company that was formed in Las Vegas, Nevada. PBI was never registered with the FDA to manufacture or import any in vitro diagnostic test kits in the United States, and never received an EUA to manufacture and distribute COVID-19 test kits. Therefore, any such test kits would be misbranded medical devices.”
“According to the criminal complaint, during the investigation, Zhu made several false statements to FDA officials, including that his name was Qiang “David” He; that he was hired by UMI as a COVID-19 consultant in 2021; that he was hired by PBI just a couple of weeks ago to communicate with government agencies and dispose of property at the warehouse as requested by those agencies; that he did not know anything about the manufacturing or distribution histories for UMI or PBI; and that he knew nothing about an Amazon webpage showing PBI‑branded pregnancy test kits for sale or a shipment of 47,500 pregnancy test kits from China to UMI at an address in Las Vegas.”
The press release concluded by explaining that “If convicted, Zhu faces a maximum statutory penalty of three years in prison for the misbranding of medical devices charge, and five more years in prison for the false statements charge. Any sentence, however, would be determined at the discretion of the court after consideration of any applicable statutory factors and the Federal Sentencing Guidelines, which take into account a number of variables. The charges are only allegations; the defendant is presumed innocent until and unless proven guilty beyond a reasonable doubt.”
Schar School Open Houses
In-Person Graduate Open House
George Mason University’s School of Business, Schar School of Policy and Government, and the Carter School of Peace and Conflict Resolution invite prospective students to attend our IN-PERSON Graduate Open House.
Explore the different degree programs we offer at the master’s, doctoral, and professional levels, as well as our graduate-level certificates. Representatives will be in attendance to discuss our various graduate programs as well as how you can further your studies and continue to work while pursuing your degree. This event will take place on November 2 from 5 to 7 pm EST. Learn more and register here.
Virtual PhD Open House
Prospective students are invited to attend a virtual open house to learn more about the Schar School of Policy and Government PhD Programs and interact with the admissions staff and faculty program directors. This event will take place on November 8 from 7 to 8:30 pm EST. Learn more and register here.
VirtualBiodefense MS Open House
Prospective students are invited to attend a information session to hear more about the Biodefense M.S. program offered at the Schar School. The online session will provide an overview of the program, as well as the application process, student experience and graduate outcomes. This session admissions will be led by the Graduate Admissions team. This event will take place on November 13 from 12 to 1 pm EST. Learn more and register here.
“Safeguard the World’s Worst Pathogens”
Piers Millett recently published this editorial in Science, quoting the work of the Global Biolabs co-led by Biodefense Graduate Program Director Gregory Koblentz in the piece: “More people in more places are researching the world’s most dangerous pathogens. This work helps prepare against future pandemics, but it’s not without danger. Pathogens could escape from research facilities, so it is vital for countries to assess potential hazards and have procedures in place to manage the risks. This doesn’t happen enough…Earlier this year, the Global Biolabs initiative released a report tracking the growth of maximum containment labs. These facilities provide extremely high levels of protection when there are very high risks to lab personnel, the wider community, or the environment. The report reveals that in 2000, there were only 13 such labs in the world. The number of labs in operation, under construction, or planned has risen steadily: to 59 labs in 23 countries in 2021, and 69 labs in 27 countries in 2023. This boom in labs has not been sufficiently accompanied by strengthened safety and security.”
“The Code of Life and Death”
Braden R. Leach recently published this article in the Journal on Emerging Technologies, writing in part: “Biotechnology is advancing at an astonishing clip, but our safeguards are decades behind. Given new technologies and economies of scale, it is possible for nefarious actors to assemble deadly viruses from scratch using synthetic DNA ordered off the internet.”
“The Select Agents statute helps to prevent malicious actors from acquiring dangerous pathogens, but the Department of Health and Human Services has interpreted it to not cover synthetic DNA. Recognizing the gap, HHS issued guidance recommending that gene synthesis companies verify their customers to ensure their legitimacy and screen genetic sequences for matches to pathogen sequences.”
“Unsurprisingly, voluntary guidance has not inspired full adherence. I argue that HHS should require providers to screen the sequences they provide and that it has the statutory authority to do so. This would improve security and level the playing field.”
“But it would not be enough. Private companies are not in the best position to perform background checks on their customers, and their economic incentives point the other way. I propose a novel license regime, where every buyer and seller of synthetic DNA and gene synthesis equipment would need to undergo a background check before transacting. In a world where biotechnology will only grow cheaper and easier to use, open access is untenable.”
“Informed by experts at the frontlines of science, industry, and security, this article advances novel regulatory solutions to counter the risks posed by dual-use biotechnology. If the US wishes to protect its people and remain the leader in the field, it must control who can access the code of life and death.”
“Verifying the BWC: A Primer”
James Revill recently authored this report for UNIDIR: “At the Ninth Review Conference of the Convention on the Prohibition of the Development, Production and Stockpiling of Bacteriological (Biological) and Toxin Weapons and on their Destruction (BWC) in 2022, States Parties agreed to establish a new Working Group on the strengthening of the Convention, which will operate during the next intersessional period between 2023 and 2026. The agenda for the Working Group includes discussion on, among other things, compliance and verification. This is the first time in 20 years that verification will be formally discussed within the BWC framework, initiating a new process that opens a window of opportunity for States to advance work around monitoring and compliance.”
“This UNIDIR report, the first in a series, serves as a primer for the consideration of verification in the context of the BWC, with a particular focus on Article I and the core obligations contained in the title of the BWC. The paper begins with elements of a working definition of verification, before considering theoretically what contemporary biological weapons and biological weapons programmes might look like. The paper proceeds to discuss tools and approaches to verification of the BWC, and the importance of agreed procedures and resources, before concluding with some reflections on what the Working Group might be able to achieve.”
“The Biological and Toxin Weapons Convention Confronting False Allegations and Disinformation”
Jean Pascal Zanders recently authored this paper for the EU Non-Proliferation and Disarmament Consortium. He writes in part, “This paper reviews Russia’s information warfare campaign surrounding biological weapon research in Ukraine since the late 2000s and how Russia escalated the accusations after its invasion of Ukraine in 2022. It traces how Russia, having presented its allegations several times to the Security Council, manoeuvred to bring the USA-funded biological research in Ukraine within the ambit of the BWC, leading to the triggering of Articles V and VI. The paper then analyses why Russia failed in its objectives. It reflects on how the BWC has stood up against disinformation and sustained false allegations and concludes with some recommendations for the European Union (EU) given its long-standing commitments to strengthening the norm against biological weapons and major financial support for treaty implementation worldwide.”
“Annual Progress Report on the Implementation of the European Union Strategy against the Proliferation of Weapons of Mass Destruction (2022)”
EEAS recently released its annual WMD report, covering the EU’s participation and contribution in nonproliferation and related activities, including:
The EU supported efforts by the International Atomic Energy Agency (IAEA) to ensure nuclear safety and security worldwide, including by financing the IAEA’s staff presence in Ukrainian nuclear facilities in the face of Russia’s illegal war of aggression. This comes in addition to other bilateral EU assistance to Ukraine in this field.
The European Commission launched a new ambitious programme aimed at uplifting nuclear safeguards in Africa, in cooperation with the African Commission on Nuclear Energy (AFCONE) and Finland.
On the year of the 25th anniversary of the entry into force of the Chemical Weapons Convention, the EU continued to fully support its implementing body, the Organisation of the Prohibition of Chemical Weapons (OPCW), both politically and financially. It also imposed further restrictive measures linked to the poisoning of Alexei Navalny and the production of chemical weapons delivery systems in Syria.
The EU participated actively in the Ninth Review Conference of the Biological Weapons Convention that decided to establish a Working Group to identify specific and effective measures to improve its implementation. The EU also played an active role in countering Russia’s disinformation campaign related to biological weapons in the context of its illegal war of aggression against Ukraine.”
“Testing Playbook for Biological Emergencies”
From Better Testing Now: “The purpose of this Diagnostic Testing Playbook is to provide executive leaders with a guide to easy-to-use information that will inform their planning on how equitable access to accurate testing can quickly be provided to all communities during an emerging biological event and how the data from testing can inform emergency decisions at each stage of a crisis.”
“Machine Learning and Gene Editing at the Helm of a Societal Evolution”
From the RAND Corporation: “The integration of artificial intelligence (AI) and biotechnology, while in its infancy, presents significant opportunities and risks, and proactive policy is needed to manage these emerging technologies. While AI continues to have significant and broad impact, its relevance and complexity magnify when integrated with other emerging technologies. The confluence of machine learning (ML), a subset of AI, with gene editing (GE) can foster substantial benefits as well as daunting risks that range from ethics to national security.”
“Both genome editing and AI technologies are being pursued at scale in various global markets. There is clearly an urgency to addressing policy issues surrounding these emerging technologies. Yet, this combined field has not been adequately studied from a policy perspective. The components need clear definitions and analyses with respect to their practical combined implications.”
“We investigated the policy implications of the application of AI/ML to gene editing in humans, in particular technology governance as a cross-cutting theme. This analysis developed a future scenario-focussed framework to protect human interest by considering the implications of these technologies being pursued at scale and globally.”
“The conversation will focus on the national security implications of securing a robust U.S. bioeconomy, the remaining challenges to fully capture its potential, and the steps policymakers should take to strengthen American leadership across the biotech landscape.”
Report Launch: The Convergence of Artificial Intelligence and the Life Sciences
“Significant advances in artificial intelligence (AI) offer tremendous benefits for modern bioscience and bioengineering. However, AI-bio capabilities—AI tools and technologies that enable the engineering of living systems—also could be accidentally or deliberately misused to cause significant harm, with the potential to cause a global biological catastrophe.”
“Join NTI | bio for the launch of the new report, “The Convergence of Artificial Intelligence and the Life Sciences: Safeguarding Technology, Rethinking Governance, and Preventing Catastrophe,” which draws on interviews with more than 30 experts in the field and makes recommendations about governance approaches for AI-bio capabilities to reduce biological risks without unduly hindering scientific advances.”
“This event is part of the AI Fringe, and is convened on the margins of the UK AI Safety Summit.”
This event will take place in-person and on YouTube at 3 pm GMT on October 30. Learn more here.
The Convergence of AI and the Life Sciences: New Report on Safeguarding Technology, Rethinking Governance, and Preventing Catastrophe
“Join NTI | bio for the launch of the new report, “The Convergence of Artificial Intelligence and the Life Sciences: Safeguarding Technology, Rethinking Governance, and Preventing Catastrophe,” which draws on interviews with more than 30 experts in AI, biotech industry, bioscience research, and biosecurity. The report offers recommendations for governance approaches to safeguard AI-bio capabilities in order to reduce biological risks without unduly hindering scientific advances.”
This event will take place on October 30 at 3 pm GMT. Learn more and register here.
A New Missile Age in the Indo-Pacific
“The Indo-Pacific is on the cusp of a new missile age. As regional tensions rise, many countries are increasing their inventories of short- to intermediate-range missile systems. This proliferation could intensify already complex security dilemmas, particularly related to North Korea and the Taiwan Strait, and heighten nuclear escalation risks.”
“Geopolitical dynamics, including U.S.-China competition and action-reaction relations between North Korea and South Korea, are driving investments by Indo-Pacific countries in a range of missile capabilities. The U.S. withdrawal from the INF Treaty in 2019, after years of alleging Russian noncompliance, is also accelerating proliferation. Washington is now pursuing new ground-launched missiles, with a focus on Asia.”
“Join Carnegie for a discussion on the drivers and consequences of the spread of missiles in the Indo-Pacific with Masashi Murano, Ankit Panda, and Jenny Town. Panda will share findings and recommendations from his new Carnegie report, Indo-Pacific Missile Arsenals: Avoiding Spirals and Mitigating Escalation Risks. George Perkovich will moderate.”
This hybrid event will take place on October 31 at 2 pm EST. Register here.
2023 EPA International Decontamination Research and Development Conference-“Advancing Preparedness through Science and Collaboration”
“The clean-up of chemical, biological, or radiological (CBR) contamination incidents and natural disasters is a critical challenge for the United States. Understanding how to characterize and remediate affected areas of environmental contamination and waste is necessary for daily life to return.”
“The Decon Conference is designed to facilitate presentation, discussion, and further collaboration of research and development topics focused on an all-hazards approach to remediate contaminated indoor and outdoor areas, critical infrastructure, water distribution systems, and other environmental areas/materials.”
“This conference is free and open to the public. Content and presentations are geared towards the emergency response community, including local and state emergency managers, homeland security officials, first responder coordinators, private sector industry, risk managers, educators in the field of emergency management, and others.”
This event will take place December 5-7 in Charleston, SC. Learn more and register here.
61st ISODARCO Course: Nuclear Order and International Security after Ukraine
“The war in Ukraine has had an enormous impact on global security, reviving nuclear fears, undermining the prospects for arms control, and shattering many of the norms and constraints that were the foundation of European security. ISODARCO 2024 will examine the global nuclear order in light of the Ukraine war, focusing on the states, the policies and the technologies that will shape the future in a much more difficult environment. How will we cope with this more dangerous world?”
This course will take place January 7-14, 2024, at the University of Trento. Learn more and register here.
Registration for GHS 2024 Now Open
Registration is now open for the Global Health Security 2024 conference in Sydney, Australia. This iteration will take place 18-21 June, 2024. The call for abstracts is also still open. “The mission of the Global Health Security conference is to provide a forum where leaders, researchers, policy-makers, and representatives from government, international organisations, civil society, and private industry from around the world can engage with each other, review the latest research and policy innovations, and agree solutions for making the world safer and healthier. To that end, our mission is to help foster a genuinely multidisciplinary community of practice that is committed to working collaboratively to enhance global health security and eliminate disease, irrespective of its origin or source.”
Call for Experts: Current State of Research, Development, and Stockpiling of Smallpox Medical Countermeasures
The National Academies of Sciences, Engineering, and Medicine is seeking suggestions for experts to participate in the new study on “Current State of Research, Development, and Stockpiling of Smallpox Medical Countermeasures”.
An ad hoc committee of the National Academies of Sciences, Engineering, and Medicine will conduct a study to examine lessons learned from the recent Coronavirus Disease 2019 (COVID-19) pandemic and mpox multi-country outbreak to inform an evaluation of the current state of research, development, and stockpiling of smallpox medical countermeasures (MCMs). The committee will:
Consider how the COVID-19 pandemic and the mpox multi-country outbreak can inform improvements to smallpox readiness and response, including the availability of smallpox MCMs and the ability to meet potential demand.
Examine the current state of MCMs for the diagnosis, prevention, and treatment of smallpox, including:
How the mpox outbreak altered assumptions about the efficacy and utility of smallpox MCMs.
The continued role of live Variola virus for research and public health purposes.
Implications for the composition of smallpox MCMs in the U.S. Strategic National Stockpile (SNS).
Explore the benefits and risks of scientific and technological advances on smallpox readiness and response and identify key priorities in research and development of smallpox MCMs.
Building on the Institute of Medicine’s previous reports, Assessment of Future Scientific Needs for Live Variola Virus (1999) and Live Variola Virus: Considerations for Continuing Research (2009), and a review of existing literature, analyses, and other expert and public input, the committee will develop a report with its findings and conclusions on priorities for additional research or activities to improve the U.S. Government readiness and response posture against smallpox, and on the composition of the SNS to ensure appropriate smallpox MCM response options.
Using these suggestions, National Academies staff will be looking to build a committee of approximately 10-12 volunteer experts in addition to collecting information for potential speakers, participants, and peer reviewers for any publications resulting from the activity.
Learn more and submit nominations by November 3here.
Standing Committee on Advances and National Security Implications of Transdisciplinary Biotechnology: Call for Experts
The National Academies of Sciences, Engineering, and Medicine is seeking suggestions for experts to be considered for the membership rotation with the Standing Committee on Advances and National Security Implications of Transdisciplinary Biotechnology and associated activities, including forthcoming meetings of experts and a workshop. This Standing Committee convenes meetings and workshops to identify advanced biotechnology capabilities of interest and to explore transdisciplinary biotechnological research and development that holds promising scientific or technical capabilities for addressing national security needs. The committee discusses barriers or challenges to adoption, and practical and operational factors in the innovation ecosystem that enable the translation of these technologies. In addition to exploring broad biotechnology developments, the Standing Committee during 2023-2024 will have a particular emphasis on exploring the applicability of artificial intelligence and machine learning and automated experimentation (also referred to as “cloud labs” and “self-driving labs”) for biotechnology discovery and development across various applications (e.g., health, agriculture, materials, etc.). The committee also will: explore these technologies for the prevention of misuse of biotechnology; identify methods and data that can be used to forecast and track the development and adoption of these technologies; discuss opportunities for driving innovation in these technologies including technical, policy, financial, and similar types of drivers; and discuss methods to assess the costs and benefits of investing (or not investing) in the development of these technologies. The committee will further explore the feasibility of developing a US-based research network related to these technologies, and regulatory processes related to the transition of these and associated defense-specific biotechnology products and services to different sectors.
Using these suggestions, National Academies staff will look to fill 2-4 open seats on the standing committee of approximately 20 total volunteer experts and to establish a workshop planning committee of approximately 6-7 members, in addition to collecting information for potential speakers, participants, and other forms of engagement.
Learn more and submit nominations by November 10here.
Participant Nomination Call: Launching a Global Research Agenda for Evidence-Based Biosafety
From Gryphon Scientific: “Join us to build a global research agenda for evidence-based biosafety! We’re hosting a series of workshops on the sidelines of international conferences and seeking technical experts to contribute from across the one health spectrum and from countries of all resource levels. Participants will have the opportunity to shape potential future biosafety research projects and to collaborate with multisectoral experts from around the world.”
This week covers experts’ response to a White House OSTP RFI regarding potential changes to Policies for Federal and Institutional Oversight of Life Sciences Dual Use Research of Concern and Potential Pandemic Pathogen Care and Oversight Policy Framework, new publications focused on topics ranging from pandemic influenza and the BW taboo to global nuclear conflict, upcoming events, and professional development opportunities.
Hopkins Center for Health Security Publishes Response to White House Office of Science and Technology Policy RFI on Dual Use Research of Concern and Potential Pandemic Pathogen Care and Oversight Policy Framework
Experts in public health and security recently responded to an OSTP RFI regarding “potential changes to the Policies for Federal and Institutional Oversight of Life Sciences Dual Use Research of Concern (DURC) and Potential Pandemic Pathogen Care and Oversight (P3CO) Policy Framework.” This included several faculty members at Johns Hopkins Center for Health Security, whose response “…follows the release of findings and proposed recommendations by the National Science Advisory Board on Biosecurity (NSABB) earlier this year. The NSABB report included recommendations for governance of research involving enhanced pathogens of pandemic potential (ePPP), an extremely small subset of gain-of-function research that has significant enough risks to warrant oversight.”
According to the authors, “The group’s RFI response supports the NSABB recommendations and emphasizes the importance of protecting humans, animals, plants, and the environment from especially dangerous DURC and ePPP research. “Research activities must be seen in the broader and more significant context of the United States Government’s responsibility to reduce risks of accidental or deliberate pandemics to which a narrow and limited segment of research—ePPP research—may contribute if un- or underregulated,” write the authors.”
Several other experts signed in support of the RFI, including Biodefense Graduate Program Director, Gregory Koblentz.
What We’re Listening To 🎧
GovCast: S6 E29, Protecting the Health Care Ecosystem from Cybersecurity Threats
“The Administration for Strategic Preparedness and Response (ASPR) at the Department of Health and Human Services leads the nation’s medical and public health preparedness for all disasters and public health emergencies.”
“After spending more than a decade at the Government Accountability Office, Brian Mazanec is taking on a new challenge as the Deputy Director of the Office of Preparedness at ASPR.”
“In his newly appointed position, Mazanec will use his expertise in cybersecurity and conflict to ensure the health care ecosystem has critical infrastructure protection to combat cyber threats.”
Listen here. Mazanec is an alumnus of the Biodefense PhD Program and a current Schar School adjunct professor.
“The Operational Risks of AI in Large-Scale Biological Attacks: A Red-Team Approach”
From the RAND Corporation: “The rapid advancement of artificial intelligence (AI) has far-reaching implications across multiple domains, including its potential to be applied in the development of advanced biological weapons. The speed at which AI technologies are evolving often surpasses the capacity of government regulatory oversight, leading to a potential gap in existing policies and regulations. Previous biological attacks that failed because of a lack of information might succeed in a world in which AI tools have access to all of the information needed to bridge that information gap.”
“The authors of this report look at the emerging issue of identifying and mitigating the risks posed by the misuse of AI—specifically, large language models (LLMs)—in the context of biological attacks. They present preliminary findings of their research and examine future paths for that research as AI and LLMs gain sophistication and speed.”
“The Biological Weapons Taboo”
Michelle Bentley recently authored this piece in War on the Rocks that is based on her recently released book of the same name. She writes in part, “COVID-19 has revitalized the debate on why biological weapons should not be used. International actors have expressed a new interest in the bioweapons threat — one that is focused on preventing and stigmatizing that threat as a priority concern. Biowarfare is on the global political agenda to a greater extent than it has ever been before.”
“This fresh interest has often centered on the biological weapons taboo. The taboo is the claim that bioweapons are so disgusting, immoral, and unacceptable that actors will not use them. The taboo has previously been dismissed as anemic and of little significance to both state and international security. The taboo was even criticized as a “potentially dangerous” way of doing arms control relating to biowarfare.”
“Yet the taboo is currently experiencing something of a second life in the wake of COVID-19. The pandemic has demonstrated the potential destruction of bioviolence in a whole new way. In doing so, the COVID-19 pandemic has strengthened the taboo and underpinned a renewed approach to biowarfare prevention that has the taboo at its core. This new shift in perception has significant implications not only for how we understand what actors think about bioweapons but also how we prohibit these armaments. The taboo is changing bioweapons policy in a major move further away from more traditional methods of arms control.”
“Many Potential Pathways to Future Pandemic Influenza”
Morens, Park, and Taubenberger recently published this piece in Science Translational Medicine: “Although influenza A viruses have caused pandemics for centuries, future pandemics cannot be predicted with our current understanding and resources. Concern about an H5N1 avian influenza pandemic has caused alarm since 1997, but there are many other possible routes to pandemic influenza.”
“Scientists Discuss Prototype Pathogens for Pandemic Preparedness”
From NIAID: “A special Oct. 19 supplement to the Journal of Infectious Diseases contains nine articles intended as a summary of a National Institute of Allergy and Infectious Diseases (NIAID)-hosted pandemic preparedness workshop that featured scientific experts on viral families of pandemic concern. Sponsored by NIAID, the supplement features articles on 10 viral families with high pandemic potential known to infect people. Concluding the supplement is a commentary from NIAID staff on the “road ahead.”’
“Many of the viruses in these 10 families have no vaccines or treatments licensed or in advanced development for use in people. Rather than facing the enormous task of developing medical countermeasures for individual viruses, one strategy is to use the “prototype pathogen” approach – which was shown to be successful with the rapid development of vaccines during the SARS-CoV-2 pandemic. This approach characterizes “representative” viruses within viral families so that knowledge gained, including medical countermeasures strategies, can be quickly adapted to other viruses in the same family.”
“Examining Risks at the Intersection of AI and Bio”
From CLTR: Artificial intelligence and biotechnology are converging in a way that could catalyse immense progress from areas like personalised medicine to sustainable agriculture—as well as substantial risks. There is a potential for new capabilities that threaten national security, including those that may lower barriers to the misuse of biological agents.
Without achieving a calibrated understanding, threats in AI-Biosecurity risk being overstated or, alternatively, not recognised and therefore underappreciated. In the face of rapid innovation, there is an imperative to monitor, measure, and mitigate these risks.
We’re excited to highlight a new publication by the Centre for Long-Term Resilience analysing the potential risks at the intersection of AI and bio. This report covers:
The role of AI in accelerating the threat of biological weapons
We explore how AI-enabled tools (particularly those with specialised life sciences capabilities) impact individual steps of the biological weapon development process, from malicious intention to a deliberate release event.
Our goal was to make a more specific case for where and how AI-enabled tools may contribute to misuse risk. We believe this is an essential starting point for (i) identifying potential intervention points and (ii) aiding the development and evaluation of different risk mitigation strategies.”
Furthering understanding of AI-enabled biological tools
In this report, we share our approach to subcategorising “AI-enabled biological tools” including: what they are capable of, how mature those capabilities are and what use cases might be at high risk of misuse.
Our goal with this work was to facilitate more precise risk assessments and identify priority capabilities for monitoring. These insights enhance our ability to anticipate concerning capabilities and develop targeted governance mechanisms, without stifling innovation.
“Lab Leak Fights Casts Chill Over Virology Research”
Benjamin Mueller and Sheryl Gay Stolberg discuss how concerns that SARS-CoV-2 originated in a Chinese lab are affecting funding for virology in the United States in this piece for The New York Times. They write in part, “Questions about whether Covid leaked from a Chinese laboratory have cast a chill over American virus research, drying up funding for scientists who collect or alter dangerous pathogens and intensifying a debate over those practices. The pullback has transformed one of the most highly charged fields of medical science. While some believe such experiments could fend off the next pandemic, others worry that they are more likely to start one.”
“At Pennsylvania State University, a proposal to infect ferrets with a mutant bird flu virus passed the federal government’s most rigorous biosafety review only to be rebuffed by the National Institutes of Health. Troy Sutton, the scientist behind the studies, said that health officials referred to the public controversy over the lab leak theory in advising him to pursue different experiments…In Washington, international development officials pulled the plug this summer on a $125 million program to collect animal viruses on several continents after two senior Republican senators demanded that they end the project.”
“Operation Warp Speed: The Untold Story of the COVID-19 Vaccine”
Joe Nocera and Bethany McLean offer an in-depth, casual telling of OWS and “How an unlikely group of scientists, generals, and government officials supercharged the effort to get us back to some kind of normal,” in this piece for Vanity Fair. They write in their conclusion, “By focusing solely on the job at hand and by refusing to get distracted by politics, the Warp Speed team made vaccines available faster than anyone in human history, pulling off the one true triumph of America’s battle against COVID-19—and saving millions of lives. Many things went wrong with America’s response to the pandemic, but Warp Speed still stands as an unambiguous success.”
“Global Effects of Nuclear Conflict: Implications for Nuclear Policymaking, Then and Now”
From NTI: “Forty years ago, findings on the global climatic effects of nuclear war first introduced the prospect of “nuclear winter.” In the decades since, the consequences of nuclear use have remained only incidental to considerations of nuclear policy. This paper explores that history and presents new research and key questions for policymakers to address given today’s increasingly interconnected world. The authors highlight the need for renewed attention to the catastrophic effects of nuclear conflict as a crucial step toward reducing the risk of nuclear use.”
ICYMI: Briefing on Verification of the Biological Weapons Convention
“At the Biological Weapons Convention (BWC) Ninth Review Conference in 2022, States Parties to the BWC agreed to establish a new Working Group on the strengthening of the Convention, which will operate during the next intersessional period. The agenda for the Working Group includes discussion on, among other things, compliance and verification.”
“This is the first time in 20 years that verification will be formally discussed within the BWC framework, initiating a new process that opens a window of opportunity for states to advance work around monitoring and compliance.”
“This UNIDIR briefing, the first in a series of virtual events focused on verification, served as a primer for consideration of verification in the context of the BWC.”
NEW: Report Launch: The Convergence of Artificial Intelligence and the Life Sciences
“Significant advances in artificial intelligence (AI) offer tremendous benefits for modern bioscience and bioengineering. However, AI-bio capabilities—AI tools and technologies that enable the engineering of living systems—also could be accidentally or deliberately misused to cause significant harm, with the potential to cause a global biological catastrophe.”
“Join NTI | bio for the launch of the new report, “The Convergence of Artificial Intelligence and the Life Sciences: Safeguarding Technology, Rethinking Governance, and Preventing Catastrophe,” which draws on interviews with more than 30 experts in the field and makes recommendations about governance approaches for AI-bio capabilities to reduce biological risks without unduly hindering scientific advances.”
“This event is part of the AI Fringe, and is convened on the margins of the UK AI Safety Summit.”
This event will take place in-person and on YouTube at 3 pm GMT on October 30. Learn more here.
NEW: A New Missile Age in the Indo-Pacific
“The Indo-Pacific is on the cusp of a new missile age. As regional tensions rise, many countries are increasing their inventories of short- to intermediate-range missile systems. This proliferation could intensify already complex security dilemmas, particularly related to North Korea and the Taiwan Strait, and heighten nuclear escalation risks.”
“Geopolitical dynamics, including U.S.-China competition and action-reaction relations between North Korea and South Korea, are driving investments by Indo-Pacific countries in a range of missile capabilities. The U.S. withdrawal from the INF Treaty in 2019, after years of alleging Russian noncompliance, is also accelerating proliferation. Washington is now pursuing new ground-launched missiles, with a focus on Asia.”
“Join Carnegie for a discussion on the drivers and consequences of the spread of missiles in the Indo-Pacific with Masashi Murano, Ankit Panda, and Jenny Town. Panda will share findings and recommendations from his new Carnegie report, Indo-Pacific Missile Arsenals: Avoiding Spirals and Mitigating Escalation Risks. George Perkovich will moderate.”
This hybrid event will take place on October 31 at 2 pm EST. Register here.
Biological Weapons: The Interconnectivity of Norms
“The bans on chemical and biological weapons (CBW) are central elements of the international disarmament and security architecture. We however need to consider how these regimes can overcome current issues and strengthen themselves for the future. What can be done to ensure the strength of the taboos against chemical and biological weapons is not weakened. In light of this the conference seeks to understand the relevant normative regimes for Chemical and Biological weapons and especially how different norms and levels of norms interact with one another.”
This conference will take place on October 23 and 24 in Gießen, DE. Learn more and register here.
Medical Countermeasures-Expanding Delivery and Increasing Uptake Through Public-Private Partnerships Upcoming Workshop Series
The National Academies Forum on Medical and Public Health Preparedness for Disasters and Emergencies will host a series of virtual public workshops to examine lessons learned and future opportunities for public-private partnerships to facilitate delivery, monitoring, uptake, and utilization of medical countermeasures to the public during a public health emergency.
The workshop will be accessible via webinar. Learn more on the project page.”
The Convergence of AI and the Life Sciences: New Report on Safeguarding Technology, Rethinking Governance, and Preventing Catastrophe
“Join NTI | bio for the launch of the new report, “The Convergence of Artificial Intelligence and the Life Sciences: Safeguarding Technology, Rethinking Governance, and Preventing Catastrophe,” which draws on interviews with more than 30 experts in AI, biotech industry, bioscience research, and biosecurity. The report offers recommendations for governance approaches to safeguard AI-bio capabilities in order to reduce biological risks without unduly hindering scientific advances.”
This event will take place on October 30 at 3 pm GMT. Learn more and register here.
2023 EPA International Decontamination Research and Development Conference-“Advancing Preparedness through Science and Collaboration”
“The clean-up of chemical, biological, or radiological (CBR) contamination incidents and natural disasters is a critical challenge for the United States. Understanding how to characterize and remediate affected areas of environmental contamination and waste is necessary for daily life to return.”
“The Decon Conference is designed to facilitate presentation, discussion, and further collaboration of research and development topics focused on an all-hazards approach to remediate contaminated indoor and outdoor areas, critical infrastructure, water distribution systems, and other environmental areas/materials.”
“This conference is free and open to the public. Content and presentations are geared towards the emergency response community, including local and state emergency managers, homeland security officials, first responder coordinators, private sector industry, risk managers, educators in the field of emergency management, and others.”
This event will take place December 5-7 in Charleston, SC. Learn more and register here.
61st ISODARCO Course: Nuclear Order and International Security after Ukraine
“The war in Ukraine has had an enormous impact on global security, reviving nuclear fears, undermining the prospects for arms control, and shattering many of the norms and constraints that were the foundation of European security. ISODARCO 2024 will examine the global nuclear order in light of the Ukraine war, focusing on the states, the policies and the technologies that will shape the future in a much more difficult environment. How will we cope with this more dangerous world?”
This course will take place January 7-14, 2024, at the University of Trento. Learn more and register here.
Registration for GHS 2024 Now Open
Registration is now open for the Global Health Security 2024 conference in Sydney, Australia. This iteration will take place 18-21 June, 2024. The call for abstracts is also still open. “The mission of the Global Health Security conference is to provide a forum where leaders, researchers, policy-makers, and representatives from government, international organisations, civil society, and private industry from around the world can engage with each other, review the latest research and policy innovations, and agree solutions for making the world safer and healthier. To that end, our mission is to help foster a genuinely multidisciplinary community of practice that is committed to working collaboratively to enhance global health security and eliminate disease, irrespective of its origin or source.”
Strategic Learning: Comprehensive Courses on Strategic Dynamics with a Focus on Southern Asia
From the Stimson Center: “The Strategic Learning initiative offers free online courses that aim to sharpen analysts’ understanding of strategic concepts in Southern Asia and beyond. By developing interactive online courses and exclusive video lectures, we make diverse viewpoints from experts around the world accessible for our community of engaged “strategic learners.”’
“Strategic Learning’s latest course, Missile Technologies in Southern Asia, is a 3-hour course that connects technology to strategy by explaining major missile technologies and how they work and by presenting diverse perspectives on their relevance to strategic competition in Southern Asia and globally. It explores key missiles and missile defense systems, missile arsenals across China, India, and Pakistan, and emerging developments for audiences of all vantage points.”